Volume 2, Issue 4 pp. 361-374

ORIGINAL ARTICLE

Open Access

Emergence and detection of gastro-enteric virulence genes in non-pathogenic Vibrio cholerae: Implications for public health and water safety in African developmental regions

Bright Esegbuyota Igere,

Corresponding Author

Bright Esegbuyota Igere

[email protected]

orcid.org/0000-0003-0059-4593

Department of Microbiology, Biotechnology Unit, Delta State University, Abraka, Nigeria

Biotechnology and Emerging Environmental Infectious Pathogens Research Group (BEEIPREG), Department of Microbiology, Biotechnology Unit, Delta State University, Abraka, Nigeria

Applied and Environmental Microbiology Research Group, Department of Biochemistry and Microbiology, University of Fort Hare, Alice, South Africa

SAMRC Microbial Water Quality Monitoring Centre, University of Fort Hare, Alice, South Africa

Correspondence

Bright Esegbuyota Igere.

Email: [email protected]

Contribution: Conceptualization (equal), Data curation (equal), Formal analysis (equal), Funding acquisition (equal), Investigation (equal), Methodology (equal), Project administration (equal), Resources (equal), Software (equal), Supervision (equal), Validation (equal), Visualization (equal), Writing - original draft (equal), Writing - review & editing (equal)

Search for more papers by this author

Bright Esegbuyota Igere,

Corresponding Author

Bright Esegbuyota Igere

[email protected]

orcid.org/0000-0003-0059-4593

Department of Microbiology, Biotechnology Unit, Delta State University, Abraka, Nigeria

Biotechnology and Emerging Environmental Infectious Pathogens Research Group (BEEIPREG), Department of Microbiology, Biotechnology Unit, Delta State University, Abraka, Nigeria

Applied and Environmental Microbiology Research Group, Department of Biochemistry and Microbiology, University of Fort Hare, Alice, South Africa

SAMRC Microbial Water Quality Monitoring Centre, University of Fort Hare, Alice, South Africa

Correspondence

Bright Esegbuyota Igere.

Email: [email protected]

Search for more papers by this author

First published: 11 December 2024

https://doi.org/10.1002/med4.88

Share a link

Email
Wechat
Bluesky

Abstract

Background

Water, an indispensable component of life, has in recent times been associated with the distribution/spread of gastro-enteric diseases especially as safe water is a concern in Southern, Eastern and Western African developmental regions.

Methods

This study evaluated the molecular fingerprints of potential gastro-enteric associated virulence genes of 58 somatic antigen non-agglutinating Vibrio cholerae 1/139 (SA-NAG-Vc-1/139) strains from domestic water sources. Strains were isolated and characterized applying both culture-based-microbiological techniques and molecular-fingerprinting of target-specific identification genes using simplex/multiplex PCR assay and ERIC-PCR fingerprints.

Results

Our study revealed diverse gene-based indices vis T3SS (29/58, 50.00%), T6SS (33/58, 56.9%), rtxA (37/58, 63.79%), rtxC (12/58, 20.69%), NAG-stn/sto (13/58, 22.41%), prtV (17/58, 29.31%), hlyA (41/58, 70.69%), nanH (40/58, 68.97%), mshA (44/58, 75.86%), chxA (37/58, 63.79%), hapA (17/58, 29.31%), ace (22/58, 37.93%), and cep (20/58, 34.48%) etc. Such results show that 53.45% (31/58) of isolates harboured more than three virulence associated genes while nanH, mshA, chxA, T6SS, T3SS, rtxA, hlyA, mshA, chxA, ace and cep fingerprints were detected predominantly with corresponding ilea-loop test positive strains. ERIC-PCR also showed multiple target specific repetitive intergenic consensus sequence regions ranging from 2 to 8.

Conclusions

This is an indication that the previously known non-pathogenic strains now harbour potential gastro-enteric virulence which may be controlled by more than one virulent gene dynamics. It also suggests a current potential shift in the virulence dynamics of V. cholerae strains recovered from the study area and a re-evaluated view of the previously non-pathogenic V. cholerae strains. Furthermore, the presence of such genes in SA-NAG-Vc-1/139 strains indicates a potential public health related concern. Although these detected potential gastro-enteric associated genes may be implicated in sporadic gastroenteritis, our result has re-emphasized their probable public health concern as they may be involved in both endemic and severe gastroenteritis cases, which suggests the need for water routine monitoring or surveillance.

Abbreviations

AWD/C: acute watery diarrhea and cholera
BBEIAC: bacteria based enterocyte infection associated conditions
BEEIPREG: biotechnology and emerging environmental infectious pathogens research group
BIE: bacterial infections of the enterocyte
C/AWD: cholera/acute watery diarrhea
D: dams
DNTP: deoxyribonucleoside triphosphate
IC: earth canals
NAG: non-agglutinating
PCR: polymerase chain reaction
R: rivers
SA-NAG-T-1/139Vc: somatic antigen non-agglutinating type-1/-139 V. cholerae
TCBS: thiosulphate citrate bile salts-sucrose
WHO: world health organization
WWFEs: wastewater final effluents

1 BACKGROUND

Water being an indispensable component of life has in recent times been associated with distribution and spread of gastro-enteric diseases especially as there is an increasing need for water supply due to lack of safe water in Southern, Eastern and Western African developmental region. Field investigators and the World Health Organisation (WHO) have recently reported that there is an increasing annual case fatality (greater than 4 million) of contaminated and unsafe water associated/related infection cases with annual mortality higher above 143,000 globally [1, 2]. In Southern, Eastern and Western African developmental region, such cases have been linked with the gastro-enteritis, cholera and acute watery diarrhea (AWD) potential pathogen (Vibrio cholerae) revealing the high clinical relevance of such strains. Major known globally implicated strain are the O1 and O139 V. cholerae strains with poor interest on the somatic antigen non-agglutinating strains (SA-NAG-1/139 V. cholerae). Such poor interest has also necessitated poor knowledge-base on the virulence potential of the strain as well as pathogenesis especially in domestic water sources. Suffice it to say that report from WHO since the last five-10 years shows these non-agglutinating O1/O139 V. cholerae (SANAG-1/139- Vc) such as O75 and O141 are potential outbreak associated strains, which reveal the need for an integrated surveillance study [3, 4]). Although pathogenesis and virulence amongst bacterial strains remains a mechanism of competition/survival in any environment, the products from such mechanism has produced deleterious effect on diverse environment especially when it's associated with man, animal or plant. Various potential pathogenic bacteria produce diverse gene products in multiple environments which affect and/or influence such environment positively or negatively. Those that affect the intestine, ilia and gastric enterocyte, cause conditions that are regarded as gastro-enteric diseases (gastro-enteritis). Other intestinal, ilia and gastric enterocyte defective conditions associated with bacteria are acute-watery-diarrhea AWD or diarrhea, cholera and dysentery. These bacteria based enterocyte infection associated conditions (BBEIAC) or bacterial infections of the enterocyte (BIE) have been reported by various investigators to involve diverse virulent genes with related names arising from their toxins, disease type and region of infection [5-8]. Notable example of such are ace (encoding accessory cholera enterotoxin), cep (encoding core-encoded pilin for adhesion), rtxA (repeat in toxin type (A), rtxC (repeat in toxin type (C), NAG-stn/sto (non-agglutinating heat stable enteric toxin), prtV (collagenase or novel metaloprotease gene), hlyA (hemolysin gene type (A), hlyB (a haemolysin secretin protein or gene), hlyC (a lactonising lipase gene) hapA (protease A gene), nanH (the neuraminidase gene: involved in sialic acid catabolism; it is in some cases involved in the sensitivity of host cells to cholera toxin), mshA (mannose-sensitive haemaglutinin type (A)and chxA (Cholix toxin or a ribosylating toxin). Other virulent markers may elicit proteases which are protein degrading enzymes (prtV), hemolysis (hlyA) which degrades haemoglobin etc [6, 9-11]. The multiple effects of these aforementioned effectors proteins/genes as well as other secretion system genes (T3SS and T6SS) results a disease condition which may be confirmed after cellular machineries of host is subverted and homeostasis is disrupted [12]. These genes present potential of eliciting pathogenic function amongst Vibrio cholerae strains even in the absence of core known pathogenic genes such as TCP, Tox and CTX genes [13].

Major DNA-based techniques proposed by most investigators for detection and targeted surveillance intervention of such enterocyte infecting bacteria cases are PCR specific gene detection, Enterobacterial Repetitive Intergenic Consensus sequence Polymerase Chain Reaction (ERICs-PCR), Repetitive Extragenic Palindromic Polymerase Chain Reaction (REP-PCR), Random Amplified Polymorphic DNA (RAPD) and Pulse Field Gel Electrophoresis (PFGE) [14-17]. Although the entero-pathogenesis associated with the cholera toxin (CTX in Vc) has been extensively studied, such virulo-relevant gene products are not common among SA-NAG-Vc-1/139. We are of the opinion that multiple virulo-relevant gene products may also be associated with gastro-enteric preponderance among the SA-NAG-Vc-1/139. Up till now, there has been dearth experimental evidence that associate these genetic fingerprints with such gastro-enteritis amongst environmental non agglutinating strains of V. cholerae. This study investigates/evaluates the molecular fingerprints of potential gastro-enteric associated virulence genes in non-pathogenic Vibrio cholerae strains isolated from domestic water sources in Southern, Eastern, and Western African developmental regions. This includes characterizing the genetic profiles of these strains using culture-based microbiological techniques and molecular fingerprinting assays, identifying virulence genes associated with gastro-enteric illnesses, and assessing their implications for public health. Ultimately, the study aims to inform evidence-based strategies for water quality management, disease prevention in resource-limited settings, address global health disparities and advance some sustainable development goals.

2 METHODS

Fifty-eight V. cholerae candidate-organisms for the study were isolated from water sources (domestic and surface water) commonly used within three local municipalities (Chris Hani, Amahlathi, and Lukhanji local municipalities) in Eastern Cape Province, South Africa and other municipalities in Nigeria, Botswana, Ethiopia, Uganda, Zimbabwe and Zambia. These V. cholerae isolates and our laboratory typed culture collections were gifted from our previous study at AEMREG laboratory South Africa, and shipped into our research group laboratory (Biotechnology and Emerging Environmental Infectious Pathogens Research Group (BEEIPREG)), Biotechnology unit, Department of Microbiology, Delta State University Abraka, Delta State, Nigeria for analysis. The strains were distinctly cultured onto thio-sulphate citrate bile salt agar (TCBSA) and further sero-grouped (after purity test) as somatic antigen non-agglutinating strains using the polyvalent antisera and molecular biology technique using Vc-O1F/Vc-O1R and Vc-O139F/Vc-O139R primer pairs sets as depicted in Table 1. Other in vitro culture-based gastro-virulent phenotypic determinants were employed such as Lipase detection (Ryan test), Protease detection (Skimmed milk agar test), Lecithinase detection (Egg York agar test) and Choleragen detection (Cholera red production test) and reported elsewhere [6, 7, 33, 34].

TABLE 1. The various primer sets, annealing temperature and expected amplicon size.

Target gene	Primer name	Sequence	Expected Band size(bp)	Annealing Temp(°C)	Reference
16S rRNA	VF169	GGA TAA CC/TA TTG GAA ACG ATG	617	53	[18]
16S rRNA	VR744	CAT CTG AGT GTC AGT G/ATC TG
OmpW	V. choleF	CACCAAGAAGGTGACTTTATTGTG	304	64	[19]
OmpW	V. choler	GGTTTGTCGAATTAGCTTCACC
Vc Serogrp	Vc-O1F	GTTTCACTGAACAGATGGG	192	55	[20]
	Vc-O1R	GGTCATCTGTAAGTACAAC
	Vc-O139F	AGCCTCTTTATTACGGGTGG	449	55	[20]
	Vc-O139R	GTCAAACCCGATCGTAAAGG
TSS	T3SS vcsV2-F	GGCTCACCAGCTGTTATGGT	263	50	[21]
	T3SS vcsV2-R	CGTATTGCACAAGTAGCCGC
	T6SS vasH-F	TGTTGATGGGCGAGAGTCAC	631	55	[21]
	T6SS vasH-R	ACGTGTGTGGCAGATACCAG
RTX	rtxA-F	CTG AAT ATG AGT GGGTGA CTT ACG	418	55	[22]
	rtxA-R	GTG TAT TGT TCG ATA TCC GCTACG
	rtxC-F	CGA CGAAGA TCA TTG ACG AC	263	55	[22]
	rtxC-R	CAT CGT TAT GTG GTTGC
Ace	ace F	TAAGGATGTGCTTATGATGGACACCC	316	59	[23]
Ace	ace R	CGTGATGAATAAAGATACTCATAGG
Cep	cep F	GCTACATGTTTAGCTCACTG	251	60	[24]
Cep	cep R	TTTAGCCTTACGAATTAAGCC
NanH	nanH F	CTTCCTCCAATACGGTTCTTGTCTCTTATGC	314	55	[25]
NanH	nanH R	TTCGGCTACCATCGGCAACTTGTATC
chxA	chxA F	TGGTGAAGATTCTCCTGCAA	421	49	[26]
chxA	chxA R	CTTGGAGAAATGGATGCGCTG
sto/stn	NAG-ST F	GAGAAACCTATTCATTGCA	192	55	[27]
sto/stn	NAG-ST R	GCAAGCTGGATTGCAAC
PrtV	PrtV F	CATACTGAGATGCTCTACGAT	864	55	[28]
PrtV	PrtV R	TTTCACCATGTTCGGGCGTGA
HapA	hapA F	TCAACTACAACACCGCAGAC	270	55	[28]
HapA	hapA R	GACGACAATCCCAAGAAGAG
MSHA	mshA F	CGCACAATGAGGTTCGCCAAG	512	60	[29]
MSHA	mshA R	CCGAAAATTGACCGCCATTATC
HLY	hlyAF	GTG CGT ATC AGC CTA GAT GA	255	59	[30]
	hlyAR	CCA AGC TCA AAA CCT GAA A
	hlyBF	CAA GCC TTC GCC AAT AAC	622	54	[31]
	hlyBR	CCA CTT TTT TCC CTT CAC C
	hlyC F	AAATCCGCCACTTCTCTTC	653	54	[31]
	hlyC R	AATCAAAGCCACCAAGCC
ERIC	Eric1	ATGTAAGCTCCTGGGGATTCAC	Multiple	48	[32]
ERIC	Eric2	AAGTAAGTGACTGGGGTGAGCG	Multiple	48	[32]

2.1 Hemolytic activity

The production of β-hemolysin by the isolates was conducted applying the method of [28] with few modifications. Briefly, blood agar based containing 13 g of agar was sterilized and a freshly pre-collected 5% rabbit RBC was added, mixed gently, dispensed in plates then allowed to polymerized. The pre-prepared agar plates were inoculated with pure overnight culture supernatant of isolates and incubated for 24 h. Positive report was recorded for isolates that show zones of clearance and haemolysis around isolates/colony grown on the surface of blood agar plates.

2.2 Gastro-enteritis production by isolates broth culture extract in test rabbit ligated ilea

Briefly, a total of twelve (12) apparently healthy rabbits were made to acclimatize in a cage and ten (10) were anaesthetized with 50% chloroform which put the rabbit to temporary sleep. The peritoneum was cut open and the small intestine was asceptically ligated in about 5 cm intervals for 8 regions/loops. The first loop was inoculated with 1 mL sterile water while the second was inoculated with 1 mL broth extract of positive control isolate. Loop three to eight were inoculated with 1 mL extract of each broth test isolates culture [35]. It is important to mention that each of the ligated rabbits ilea were inoculated with six to eight broth inoculum preparation of test isolates as described previously by related investigators.

2.3 DNA extraction

With few modifications from the previous methods of Magueri et al. [36], pre-prepared bacterial suspension was heated to boiling for genomic DNA extraction. Briefly, purified single gifted strains which were previously stored in aliquot of 2 mL graduated skirted Cryo preservation tubes ([Starlabs, Milton Keynes, UK] containing a 0.4 ml mixture of normal saline and glycerol [1∶1 or a 50% glycerol] in 0.6 ml of sterile de-ionised water) were allowed to thaw, subculture onto pre-prepared nutrient agar plate and incubated at 37°C for 24 h. Single culture colonies were harvested and suspended in sterile/nuclease-free tris ethylene diamine tetracetate (TE- 0.5 M) in an eppendorf microfuge tube (1.5 ml). Heat was applied on tubes to boiling or 100°C using Lasec dry heating block (www.lasec.co.za: Dri-Block DB-3D Techne) for 15 min, contents in microfuge-tubes were centrifuged at 15,000 r/min for 8 min in 4°C(Hermle Microfuge; Labortechnik GmbH Germany). Supernatant was collected as DNA template, stored at −20°C for PCR amplification experiments.

2.4 Enterobacterial molecular dynamics fingerprint of 1/139 SA-NAG-V. cholerae isolates

The patho-virulent diversity and associated gastro-enteric determining genes or fingerprints were detected applying simplex PCR detection, Multiplex PCR detection and Enterobacterial Repetitive Intergenic Consensus sequence PCR (ERICs-PCR) on serogrouped/serotyped isolates. The various entero-virulent and gastro-virulent associated genes applied are included in Table 1 below in addition to two sets of ERICs primers (ERIC1 5′-ATGTAAGCTCCTGGGGATTCAC-3′, ERIC2 5′-AAGTAAGTGACTGGGGTGAGCG-3′). All PCR reactions were conducted or carried out in 20 μL final reaction volumes, consisting of 1 μL of ERIC-primers, 1.0 μL of MgCl₂, 10 μL of a GoTaq ℗G2 green master mix supplied in 2X Green GoTaq^℗G2 reaction buffer containing pH: 8.5, dNTPs (400 μM each of dGTP, dTTP, dCTP and dATP), 3 mM MgCl₂ and GoTaq^℗G2 DNA polymerase at optimal concentration for efficient PCR amplification as specified by Promega Corporation USA (www.promega.com). Approximately 3.5 μL of dry-heat extracted DNA (as template) and 4.5 μL of nuclease-free water were simultaneously employed. The thermal cycling conditions for ERIC-PCR consisted time/temperature initial denaturation step at 6 min, 94°C, denaturation, annealing, and extension as follows: 35 cycles of (0.5 min, 94°C), (1 min, 48°C), (5 min, 72°C), and final extension (7 min, 72°C). Amplicons were stored at 4°C until post PCR procedures (electrophoresis detection and photography or documentation). Other genes detection thermal conditions are as reported in Table 1. A ten-microliter (10 μL) product of simplex/multiplex PCR and ERIC-PCR products were separated or electrophoresed using TakaRa Mupid-ONE (SNo: 073,031 and 073,032, Japan) after preparing a 1.5 g agarose powder in 100 ml TBE (Laboratorois Conda, Madrid, Spain). The 1.5% prepared agarose gel was stained with 2 μL ethidium bromide (1 μg/mL, Sigma-Aldrich, USA) submerged in a TBE buffer (pH 8.0) and loaded with PCR amplicons. An equivalent volume of both amplicons and commercially available PCRBIO of 100 bp to 10 kb pairs ladder (PCR Biosystems Ltd, London, UK) was filled onto the well that terminates each agarose gel casted as molecular marker before electrophoresis. The electrophoresed gel was thereafter transferred for visualization after electrophoresis of DNA amplified fingerprints and documented or photographed using UV transilluminator. Reference name and accession number of strains applied during study include O1 V. cholerae N16961 (acc. Num. NC_002505), O139 V. cholerae MO10 (acc. Num. NZ_AAKF00000000), O1 V. cholerae CIRS101 (acc. Num. NZ_ACVW00000000), O1 V. cholerae B33 (acc. Num. NZ_ACHZ00000000), and O1 V. cholerae MJ-1236 (acc. Num. NC_012668). These strains and primer pairs were previously designed/developed by NICD, South Africa for multiplex PCR. Other typed culture collections from our laboratory were also analyzed with reference strains to confirm gastro-enteric virulo-relevant associated genes. These reference strains and nuclease-free water were adopted as positive control and negative control respectively for PCR assay.

2.5 Evaluation of molecular fingerprints data

Procedural standardization, validation, amplified products and gel bands visualization data were normalized while fingerprints (Simplex/Multiplex and ERIC PCR) were scored manually, as “1” for a detected gene and “0” for an absent gene. The binary data were evaluated following the Jaccard coefficient of similarity and phylogeny dendrogram. The details of comparism were constructed using the Unweighted Pair Group Method with Arithmetic mean (UPGMA) [37]. The details of gel reports interpretation based on positive and negative detection were imported onto PAleontological Statistics 3.23 version (PAST3.23v) [38] for similarity and diversity studies. The dendrogram of the matrices was developed using neighbor-joining (NJ) [39] of the Euclidean similarity index (Equation 1), while The differentiating/diversity power was determined using the Simpson's coefficient of diversity (D) by using the formula D = 1{Σ[nj(nj1)]}/[N(N1)], where N is the number of strains tested, and nj denotes the number of strains belonging to the jth type which = 2–8 number of bands (of representative strains) produced by each isolate. Secondly, the numerical density of diverging strains in each clade. This is followed by a comparative resolution power of each fingerprinting as the ratio of number of clades for strains from its NJ clustering to the total number of isolates tested.

3 RESULTS

3.1 Isolation and identification of Vibrio cholera

Fifty-eight V. cholerae candidate-organisms were isolated from water sources (domestic and surface water) commonly used within three local municipalities (Chris Hani, Amahlathi, and Lukhanji local municipalities) in Eastern Cape Province, South Africa and other municipalities in Nigeria, Botswana, Ethiopia, Uganda, Zimbabwe and Zambia as reported from our previous studies. These strains were further characterized as somatic antigen non-agglutinating strains using the polyvalent antisera and molecular biology technique using Vc-O1F/Vc-O1R and Vc-O139F/Vc-O139R primer pairs sets as depicted in Table 1. Other in vitro culture-based gastro-virulent phenotypic determinants were employed such as Lipase detection (Ryan test), Protease detection (Skimmed milk agar test), Lecithinase detection (Egg York agar test) and Choleragen detection (Cholera red production test) and reported elsewhere (Igere et al., 2022a,b,c).

3.2 Haemolysis and in vivo production of gastro-enteritis by test isolates broth in ligated rabbit ilea

All tested isolates were negative to the sero-dynamic molecular study which confirm their non-somatic agglutinating reports. Amongst the 58 isolates tested, 27 (46.55%) showed positive haemolysin phenotype, as a clear transparent lytic zone around isolate indicates positive haemolysis whereas 21 (36.21%) showed positive gastro-enteritis production in in vivo ligated ilea loop test as a positive gastro-enteritis result was reported with the observation of an accumulation of fluid (as swollen intestine) in each ligated loop due to the production of adenylate cyclase and guanylate cyclase which were later converted to both cyclic 3,5-adenosinmonophosphate (AMP) and 3,5-guanosinmonophosphate (GMP) in an energy dependent reaction (Figure 1). As previously reported by related investigators, the produced cyclic AMP and GMP, further induce accumulation of sodium and chloride ion (a hydroscopic compound) and result absorption of water as well as passage of watery stool or diarrhea. This is an in vivo gastro- enteric infection induction in the rabbit ligated ilea as previously reported in investigators related studies [40, 41].

Details are in the caption following the image — **FIGURE 1**
Open in figure viewer PowerPoint

Showing in vivo production of gastro-enteritis by test isolates broth in ligated rabbit ilea. (a) Above shows three ligated ilea with two positive gastroenteritis induction and one negative result. (b) Shows four ligated ilea loop with three positive and one negative results. (c) Shows six ligated ilea with one of the ligated ilea loop of animals tested showing negative whereas five loops were positive for tested isolates indicating potential gastroenteric disease.

3.3 Virulent genotype of gastro-enterocyte infections

A number of gastro-enterocyte virulence associated genes were detected by multiplex-PCR genotyping and simplex PCR detection. These includes the type-VI secretion system (T6SS), type III secretion system (T3SS), which are membrane-embedded, spear/pin-pointed-like weapon that are involved in Gram-negative strain virulence, competition and may also be applicable beyond clinical cases. Other detected potential genes are rtxA, rtxC, NAG-stn/sto, prtV, hlyA, nanH, mshA, chxA, hapA, ace, and cep. A careful observation of the detected genes shows that the phenotypic expression of virulence is a mirror-image of the genotypic detection which represents the effector activity of multiple detected genes produced in an in vivo phenotypic virulent determination amongst strains. It may also imply that a single detected genotype does not control the virulence phenotype observed amongst the somatic antigen non-agglutinating V. cholerae type 1/139 (SA-NAG-Vc-1/139) (Figures 2-7).

4 DISCUSSION

The effector protein products released by most systemic and environment inhabiting organisms due to survival mechanism has been linked with diverse deleterious effect and diseases which has continued to affect greater global population at some instance. Such genes or proteins have been linked with diverse health related situation associated with man and environment, as it have been reported in various cases. This study reveals the molecular fingerprints of multiple potential gastro-enteric associated virulence associated genes amongst non-pathogenic Vibrio cholerae strains (SA-NAG-Vc-1/139) recovered/isolated from water sources in Southern, Eastern, and Western African developmental regions. It was observed from the study that all strains were negative to both the orf-O1 and orf-O139 genes detection using PCR and somatic antigen non-agglutinating polyvalent antisera (Figure 2a,b, Tables 2 and 3) which reveal them as NAG strains of V. cholerae and also presumptively labeling them as non-pathogenic. These strains were positive to the in vitro haemolysis test (27/58, 46.55%) which implies that they are producers of haemolysin. Accordingly, induction of gastro-enteritis (21/58, 36.21%) was also observed in isolates inoculation of rabbit ligated ilea using the experimental rabbit in vivo ligated ilea loop test (Figure 1). This implies that positive strains were potential producers of cholera/diarrhea, if expose to such environment. Similar gastro-enteric infection associated expression and character has been previously reported amongst the enterobacteriaceae members by diverse investigators [42-44]. In addition, such gastro-enteric infection associated phenotypes/expression are predominant amongst O1/O139 V. cholerae members. However in recent times, such expression have been reported amongst SA-NAG-Vc-1/139 (this study) and other environmental enteric strains/pathogens [4, 20, 45-50] in Cuba, America, Africa, China and other places in Bangladesh, India. This is a notable public health implication and indicates a potential concern to the public especially as the call on safe-water for all has become a global interest.

TABLE 2. Confirmed gastro-enteric fingerprint of 1/139 SA-NAG- V. cholerae strains.

Sites/Sources	Confirmed isolates (OmpW)	rfb-O1	rfb-O139	Ilea loop	Haemolysis	T3SS	T6SS	toxR	rtxA	rtxC
Wastewater treatment plants	30	0	0	8	13	14	16	12	17	5
River water	16	0	0	7	9	8	9	7	12	5
Household wastewater	10	0	0	6	5	6	6	5	7	2
Canal water	2	0	0	0	0	1	2	0	1	0
Total	58	Nil	Nil	21	27	29	33	24	37	12

TABLE 3. Confirmed gastro-enteric fingerprint of 1/139 SA-NAG- Vibrio cholerae strains.

Sites/Sources	NAG-stn/sto	hlyA	prtV	nanH	mshA	chxA	hapA	Ace	Cep	hlyB
Wastewater treatment plants	5	20	6	23	24	21	8	9	8	11
River water	3	12	8	11	14	11	6	7	6	6
Household wastewater	3	8	3	5	6	5	3	5	4	2
Canal water	1	1	0	1	0	0	0	1	2	0
Total	13	41	17	40	44	37	17	22	20	19

Apart from haemolysis and the in vivo induction of gastro-enteric infections potential amongst the reported strains, the following potential virulent genotypes of gastro-enteric infection relevance were also detected with details as follows: T3SS (29/58, 50.00%), T6SS (33/58, 56.9%), rtxA (37/58, 63.79%), rtxC (12/58, 20.69%), NAG-stn/sto (13/58, 22.41%), prtV (17/58, 29.31%), hlyA (41/58, 70.69%), nanH (40/58, 68.97%), mshA (44/58, 75.86%), chxA (37/58, 63.79%), hapA (17/58, 29.31%), ace (22/58, 37.93%), and cep (20/58, 34.48%) using simplex/multiplex PCR assay (Figures 3-7, Tables 2 and 3). The study revealed that 50.8% (31/61) of the isolates harboured more than three virulent associated genes with nanH, mshA, chxA, T6SS, T3SS, rtxA, ace and cep fingerprints being predominant amongst detected genes. According to various earlier global investigators reports, these aforementioned virulent genes have been found both in isolates from cholera outbreak cases and in clinical V. cholerae cases of diarrhea in hospitalized patients [46, 48, 50-52]. This implies that such non-pathogenic strains may be pathogenic and may also be implicated in potential outbreak cases which necessitate adroit surveillance in any related case study. It is also important to note that the detected genes have been affirmed to contribute in effective colonization of intestinal mucosa or rabbit ilia model causing diarrhea/cholera etc, that is as severe and similar to the clinical presentations associated with CT, Tox and TCP genes [49, 53] among O1/O139 V. cholerae. Similar observations have also been reported amongst environmental strains, as notable examples of such V. cholerae members are the non-agglutinating V. cholerae strains [54-57]. This implies that the SA-NAG-Vc-1/139 applied in this study is currently evolving with diverse virulo-relevant indices which may produce potential case severity in future outbreaks cases and necessitates evaluation of management strategies.

The observation of T3SS in this study further affirms the patho-virulent severity among strains recovered during the study. A similar report was previously recorded by related investigators affirming that T3SS and other virulent genes [58-60], among V. cholerae AM19226, NRT36S and N16961 strains were carriers and/or encode Vibrio Pathogenicity Island (VPI) and produce severe cholera as well as secretary diarrhea response in infected enterocytes. Suffice it to say that T3SS gene is secretion gene type which may be present in most Gram negative as well as Vibrio species. Furthermore, it has been previously demonstrated that the secretion system type three is a functional gene product amongst entero-pathogenic bacteria strains and may be responsible for intestinal colonization both in rabbit ilia and man [41, 53]. These gene members amongst other related virulent genes are present in most Gram-negative potential pathogens (V. cholerae) which suggest and affirm the gastro-virulent as well as entero-virulent relevance of these studied strains.

In addition, the type six secretion (T6SS) gene is the other secretary-based enterocyte associated virulent determinant detected during the study. It is shown to be widely distributed amongst Gram negative bacterial and the Vibrio species where it functions as a protein translocation/transportation machinery and inter-bacterial antagonism [58, 61-64]. It has resemblance with an inverted phage which has 14 proteins, complexed into three assembly which work interactively to transport protein via contractile mechanism [65, 66]. According to Fu et al. [67] and Chen et al. [58], the mechanism of virulence arising from T6SS genes has remained unknown however; there is high chance that it may be associated with virulence/pathogenesis of SA-NAG-Vc-1/139. Hence our observation of T6SS genes suggest the potential for pathogenesis/virulence as previously reported [58, 67].

There have also been various report of genotyped enteric borne pathogens both of clinical origin (diarrhea stool/faecal samples etc), food (sea food, animal products, vegetables, seeds etc) and environmental (contaminated water, rocks etc) sources using the ERIC-PCR and other PCR techniques [37]. These molecular tools are chosen especially as the pathogens are members of the broad family enterobacteriaceae. We employ these tools as an approach amongst emerging choleragenic Non-O1/Non-O139 to compare their intraclonal diversity/relatedness and the gastro-virulent potential of such strains with specific genetic mosaicism in the environment [5, 68-73]). From our study, there was an observed considerable genetic relatedness amongst the isolates from similar sources, a notable variation was found in the profile generated by the enterobacterial repetitive intergenic consensus sequence PCR (ERIC-PCR) and other PCR determination applied. There was an observable identical base pair banding pattern amongst isolates of similar serogroup and potential pathogenic members but those of null pathogenic potential had a different banding pattern from potential pathogenic strains with high discriminating index. Such discriminatory index was observed in some of the isolates which were previously described/identified as non-pathogenic. The necessity to emphasize on regular and periodic surveillance of water bodies as well as effluents is of epidemiological relevance.

The Enterobacterial Repetitive Intergenic Consensus sequence PCR (ERICs-PCR) detected regions divided the isolates into two clade where isolates number codes such as 35, 31, 39, 30, 45, 34, 433, 411, 181, 33,739, 38 harbors already know potential entero-virulent and gastro-virulent associated genes whereas, other isolates harbor emerging gastro-enterocyte/gastro-enteritis determinants. These specified strains (1/139 SA-NAG- V. cholerae) were further divided into two clades based on their gastro-enterocyte/gastro-enteritis determinants (Figure 8a). The observation was also repeated in the PCA Scatter diagram (Figure 8b) showing biplot and 96% eclipse of isolates, while isolates with number codes 30, 35 and 433 fell outside the eclipse region of relationship. This is a potential indication that gastro-enteritis is controlled by multiple gene function amongst strains.

Our study specific limitation include the geographical scope, sample type and/or size, in vitro genomic expression of the detected genes which are basic components of pathogenicity island for V. cholerae strains and non-detection of other gastro-virulence associated genes among bacterial members. The negative detection of some suggested genes as well as their potential implications for the study were not exhaustively determined by applied methods. It should be noted that the application of MLST would describe such concerns however MLST was not applied due to available resources during study. Furthermore, applied methods for gastro-enteritis was only affirmed using gastroenteritis related gene detection using PCR and rabbit ligated ilea tests. The above are limited area of potential concerns which are current ongoing studies aspect in our laboratory in a bid to affirm the state of the previously non-pathogenic nature of somatic antigen non-agglutinating V. cholerae type 1/139 (SA-NAG-Vc-1/139) and their evolutionary status in study area.

5 CONCLUSIONS

This study has described the production of gastro-enteritis virulence determinants of water origin or environmental V. cholerae strains and the associated emerging potential public health concerns. It has revealed the presence of diverse virulent genotypes including T3SS, T6SS, rtxA, rtxC, NAG-stn/sto, prtV, hlyA, nanH, mshA, chxA, hapA ace and cep. It has reaffirmed that the non-O1/non-O139 V. cholerae strains are potential etiological pathogen with the most recorded severe cholera and acute watery diarrheal disease epidemics which basically thrives in estuaries, coastal waters and environment. The strategy applied for the detection of enterocyte infecting potential pathogens will enhance potential enteric pathogens surveillance schemes and broaden our understanding in the development of Vibrio based vaccine for endemic, epidemic and pandemic strain (VVEEPS). Such cross-sectional and systematic assessment of the environmental waters remains an apt strategy for prevention and prediction of possible impending outbreaks.

AUTHOR CONTRIBUTION

Bright Esegbuyota Igere: Conceptualisation, methodology, investigation, data curation, analysis, interpretation, writing—original draft preparation, writing—review and editing.

ACKNOWLEDGMENTS

The author wishes to acknowledge the contributions of Prof Nwodo Uchechukwu Uche, Prof Igbinosa Etinosa Ogbomoede, Prof Emmanuel Erufoare Odjadjare, Prof Okoh Anthony Ifeanyi and a crowd of diverse related investigators on vibriology. It is hoped that in the near future the menace of cholera and other associated infectious cases would be adequately controlled by major research contributions. The author acknowledges the funds provided by African German Network of Excellence in Science 2022 (AGNES-2022) and Govan Mbeki Research and development centre. Supervisor-Linked Bursary-2017 (SLB-2017).

CONFLICT OF INTEREST STATEMENT

The author declares no competing interest.

ETHICS STATEMENT

Our University/institutional research ethical committee approved the study with number DOU86/2023. Isolates were environmental strains, while animal blood was collected as advised following required consent.

INFORMED CONSENT

Not applicable.

Open Research

DATA AVAILABILITY STATEMENT

The datasets/information used for this study are available within the manuscript and the Figure S1.

Supporting Information

REFERENCES

1Ali M, Nelson AR, Lopez AL, Sack DA. Updated global burden of cholera in endemic countries. PLoS Neglected Trop Dis. 2015; 9(6):e0003832. https://doi.org/10.1371/journal.pntd.0003832
10.1371/journal.pntd.0003832
PubMed Web of Science® Google Scholar
2 World Health Organization. Diarrhoeal disease. WHO fact sheet. Updated May 2017; 2017. http://www.who.int/mediacentre/factsheets/fs330/en/. Accessed 20 August 2018.
Google Scholar
3 WHO-UNICEF. Strategic framework for cholera in eastern and southern Africa: 2017a. 2018–2022 draft final for RMT consultation. http://apps.who.int/data
Google Scholar
4 Centers for Disease Control and Prevention (CDC). Cholera and other Vibrio illness surveillance overview. Atlanta, Georgia: US Department of Health and Human Services, CDC; 2012. http://www.cdc.gov/ncezid/dfwed/PDFs/nat-covissurv-overview-508c.pdf. Accessed 1 November 2013.
Google Scholar
5Gxalo O, Digban TO, Igere BE, Olapade OA, Okoh AI, Nwodo UU. Virulence and antibiotic resistance characteristics of vibrio isolates from rustic environmental freshwaters. Front Cell Infect Microbiol. 2021; 11:732001. https://doi.org/10.3389/fcimb.2021.732001
10.3389/fcimb.2021.732001
CAS PubMed Web of Science® Google Scholar
6Igere BE, Okoh AI, Nwodo UU. Non-serogroup O1/O139 agglutinable Vibrio cholerae: a phylogenetically and genealogically neglected yet emerging potential pathogen of clinical relevance. Arch Microbiol. 2022a; 204(6): 323. https://doi.org/10.1007/s00203-022-02866-1
10.1007/s00203-022-02866-1
CAS PubMed Google Scholar
7Onohuean H, Igere BE. Occurrence, antibiotic susceptibility and genes encoding antibacterial resistance of salmonella spp. and Escherichia coli from milk and meat sold in markets of Bushenyi District, Uganda. Microbiol Insights. 2022; 15:11786361221088992. https://doi.org/10.1177/11786361221088992
10.1177/11786361221088992
Google Scholar
8Maikalu RB, Igere BE, Odjadjare EE. Enterobacter species distribution, emerging virulence and multiple antibiotic resistance dynamics in effluents: a countrified spread-hub and implications of abattior release. Total Environment Research Themes. 2023; 8:100074. https://doi.org/10.1016/j.totert.2023.100074
10.1016/j.totert.2023.100074
Google Scholar
9Igere BE, Igolukumo BB, Eduamodu C, Odjadjare EO. Multi-drug resistant Aeromonas species in annelida: an evidence of pathogen harbouring leech in recreation water nexus of Oghara Nigeria environs. Scientia Africana. 2021; 20(2): 145–166. https://doi.org/10.4314/sa.v20i2.13
10.4314/sa.v20i2.13
Google Scholar
10Monir MM, Hossain T, Morita M, Ohnishi M, Johura FT, Sultana M, et al. Genomic characteristics of recently recognized vibrio cholerae El Tor lineages associated with cholera in Bangladesh, 1991 to 2017. Microbiol Spectr. 2022; 10(2):e0039122. https://doi.org/10.1128/spectrum.00391-22
10.1128/spectrum.00391-22
PubMed Google Scholar
11Monir MM, Islam MT, Mazumder R, Mondal D, Nahar KS, Sultana M, et al. Genomic attributes of vibrio cholerae O1 responsible for 2022 massive cholera outbreak in Bangladesh. Nat Commun. 2023; 14(1):1154. [Internet]. https://doi.org/10.1038/s41467-023-36687-7
10.1038/s41467-023-36687-7
CAS PubMed Google Scholar
12Bhandari M, Rathnayake IU, Huygens F, Jennison AV. Clinical and environmental vibrio cholerae non-O1, non-O139 strains from Australia have similar virulence and antimicrobial resistance gene profiles. Microbiol Spectr. 2023; 11(1):e0263122. https://doi.org/10.1128/spectrum.02631-22
10.1128/spectrum.02631-22
PubMed Google Scholar
13Shackleton D, Memon FA, Nichols G, Phalkey R, Chen AS. Mechanisms of cholera transmission via environment in India and Bangladesh: state of the science review. Rev Environ Health. 2024; 39(2): 313–329. https://doi.org/10.1515/reveh-2022-0201
10.1515/reveh-2022-0201
PubMed Google Scholar
14Shigematsu M, Kaufmann ME, Charlett A, Niho Y, Pitt TL. An epidemiological study of plesiomonas shigelloides diarrhoea among Japanese travellers. Epidemiol Infect. 2000; 125(3): 523–530. https://doi.org/10.1017/s0950268800004817
10.1017/S0950268800004817
CAS PubMed Google Scholar
15González-Rey C, Belin AM, Jörbeck H, Norman M, Krovacek K, Henriques B, et al. RAPD-PCR and PFGE as tools in the investigation of an outbreak of beta-haemolytic streptococcus group A in a Swedish hospital. Comp Immunol Microbiol Infect Dis. 2003; 26(1): 25–35. https://doi.org/10.1016/s0147-9571(02)00019-x
10.1016/S0147-9571(02)00019-X
CAS PubMed Google Scholar
16González-Rey C, Siitonen A, Pavlova A, Ciznar I, Svenson SB, Krovacek K. Molecular evidence of plesiomonas shigelloides as a possible zoonotic agent. Folia Microbiol. 2011; 56(2): 178–184. https://doi.org/10.1007/s12223-011-0032-2
10.1007/s12223-011-0032-2
CAS PubMed Web of Science® Google Scholar
17Igere BE, Okoh AI, Nwodo UU. Genetic characterization of non-O1/non-O139 Vibrio cholerae mobilome: a strategy for 2 understanding and discriminating emerging environmental bacterial. J. of Biological Research-Bollettino della Società Italiana di Biologia Sperimentale. 2023; 96(2).
Google Scholar
18Yong L, Guanpin Y, Hualei W, Jixiang C, Xianming S, Guiwei Z, et al. Design of vibrio 16S rRNA gene specific primers and their application in the analysis of seawater vibrio community. J Ocean Univ China. 2006; 5(2): 157–164. https://doi.org/10.1007/bf02919216
10.1007/BF02919216
Google Scholar
19Alam A, Miller KA, Chaand M, Butler JS, Dziejman M. Identification of vibrio cholerae type III secretion system effector proteins. Infect Immun. 2011; 79(4): 1728–1740. https://doi.org/10.1128/iai.01194-10
10.1128/IAI.01194-10
CAS PubMed Google Scholar
20Aydanian A, Tang L, Chen Y, Morris JJG, Olsen P, Johnson JA, et al. Genetic relatedness of selected clinical and environmental non-O1/O139 vibrio cholerae. Int J Infect Dis. 2015; 37: 152–158. https://doi.org/10.1016/j.ijid.2015.07.001
10.1016/j.ijid.2015.07.001
CAS PubMed Web of Science® Google Scholar
21Marin MA, Thompson CC, Freitas FS, Fonseca EL, Aboderin AO, Zailani SB, et al. Cholera outbreaks in Nigeria are associated with multidrug resistant atypical El Tor and non-O1/non-O139 Vibrio cholerae. PLoS Neglected Trop Dis. 2013; 7(2):e2049. https://doi.org/10.1371/journal.pntd.0002049
10.1371/journal.pntd.0002049
PubMed Google Scholar
22Chow KH, Ng TK, Yuen KY, Yam W. Detection of RTX toxin gene in vibrio cholerae by PCR. J Clin Microbiol. 2001; 39(7): 2594–2597. https://doi.org/10.1128/jcm.39.7.2594-2597.2001
10.1128/JCM.39.7.2594-2597.2001
CAS PubMed Google Scholar
23Singh DV, Matte MH, Matté GR, Jiang S, Sabeena F, Shukla BN, et al. Molecular analysis of vibrio cholerae O1, O139, non-O1, and non-O139 strains: clonal relationships between clinical and environmental isolates. Appl Environ Microbiol. 2001; 67(7):3331. https://doi.org/10.1128/aem.67.7.3331-3331.2001
10.1128/AEM.67.7.3331-3331.2001
CAS Google Scholar
24Chatterjee S, Ghosh K, Raychoudhuri A, Chowdhury G, Bhattacharya MK, Mukhopadhyay AK, et al. Incidence, virulence factors, and clonality among clinical strains of non-O1, non-O139 vibrio cholerae isolates from hospitalized diarrheal patients in Kolkata, India. J Clin Microbiol. 2009; 47(4): 1087–1095. https://doi.org/10.1128/jcm.02026-08
10.1128/JCM.02026-08
CAS PubMed Web of Science® Google Scholar
25Huq A, Haley BJ, Taviani E, Chen A, Hasan NA, Colwell RR. Detection, isolation, and identification of vibrio cholerae from the environment. Curr Protoc in Microbiol. 2012; 26(1):6A. https://doi.org/10.1002/9780471729259.mc06a05s26
10.1002/9780471729259.mc06a05s26
Google Scholar
26Ferdous J, Sultana R, Rashid RB, Tasnimuzzaman M, Nordland A, Begum A, et al. A comparative analysis of vibrio cholerae contamination in point-of-drinking and source water in a low-income urban community, Bangladesh. Front Microbiol. 2018; 9:489. https://doi.org/10.3389/fmicb.2018.00489
10.3389/fmicb.2018.00489
PubMed Web of Science® Google Scholar
27Rivera IN, Chun J, Huq A, Sack RB, Colwell RR. Genotypes associated with virulence in environmental isolates of vibrio cholerae. Appl Environ Microbiol. 2001; 67(6): 2421–2429. https://doi.org/10.1128/aem.67.6.2421-2429.2001
10.1128/AEM.67.6.2421-2429.2001
CAS PubMed Web of Science® Google Scholar
28Rajpara N, Vinothkumar K, Mohanty P, Singh AK, Singh R, Sinha R, et al. Synergistic effect of various virulence factors leading to high toxicity of environmental V. cholerae non-O1/non-O139 isolates lacking ctx gene: comparative study with clinical strains. PLoS One. 2013; 8(9):e76200. https://doi.org/10.1371/journal.pone.0076200
10.1371/journal.pone.0076200
CAS PubMed Google Scholar
29Jagadeeshan S, Kumar P, Abraham WP, Thomas S. Multiresistant vibrio cholerae non-O1/non-O139 from waters in South India: resistance patterns and virulence-associated gene profiles. J Basic Microbiol. 2009; 49(6): 538–544. https://doi.org/10.1002/jobm.200900085
10.1002/jobm.200900085
CAS PubMed Web of Science® Google Scholar
30Teh CS, Thong KL, Ngoi ST, Ahmad N, Nair GB, Ramamurthy T. Molecular characterization of serogrouping and virulence genes of Malaysian vibrio cholerae isolated from different sources. J Gen Appl Microbiol. 2009; 55(6): 419–425. https://doi.org/10.2323/jgam.55.419
10.2323/jgam.55.419
CAS PubMed Google Scholar
31O'Shea YA, Finnan S, Reen FJ, Morrissey JP, O'Gara F, Boyd EF. The vibrio seventh pandemic island-II is a 26· 9 kb genomic island present in Vibrio cholerae El Tor and O139 serogroup isolates that shows homology to a 43· 4 kb genomic island in V. vulnificus. Microbiology. 2004; 150(12): 4053–4063.
10.1099/mic.0.27172-0
PubMed Google Scholar
32Fendri I, Ben Hassena A, Grosset N, Barkallah M, Khannous L, Chuat V, et al. Genetic diversity of food-isolated salmonella strains through pulsed field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC-PCR). PLoS One. 2013; 8(12):e81315. https://doi.org/10.1371/journal.pone.0081315
10.1371/journal.pone.0081315
PubMed Google Scholar
33Igere BE, Okoh AI, Nwodo UU. Lethality of resistant/virulent environmental vibrio cholerae in wastewater release: an evidence of emerging virulent/antibiotic-resistant-bacteria contaminants of public health concern. Environmental Challenges. 2022b; 7:100504. https://doi.org/10.1016/j.envc.2022.100504
10.1016/j.envc.2022.100504
CAS Google Scholar
34Igere BE, Okoh AI, Nwodo UU. Atypical and dual biotypes variant of virulent SA-NAG-Vibrio cholerae: an evidence of emerging/evolving patho-significant strain in municipal domestic water sources. Ann Microbiol. 2022c; 72: 1–3. https://doi.org/10.1186/s13213-021-01661-5
10.1186/s13213-021-01661-5
Google Scholar
35Chatterjee HN. Reduction of cholera mortality by the control of bowel symptoms and other complications. Postgrad Med. 1957; 33(380): 278–284. https://doi.org/10.1136/pgmj.33.380.278
10.1136/pgmj.33.380.278
CAS Google Scholar
36Maugeri TL, Carbone M, Fera MT, Gugliandolo C. Detection and differentiation of vibrio vulnificus in seawater and plankton of a coastal zone of the Mediterranean Sea. Res Microbiol. 2006; 157(2): 194–200. https://doi.org/10.1016/j.resmic.2005.06.007
10.1016/j.resmic.2005.06.007
CAS PubMed Google Scholar
37Mishra A, Taneja N, Sharma RK, Kumar R, Sharma NC, Sharma M. Amplified fragment length polymorphism of clinical and environmental vibrio cholerae from a freshwater environment in a cholera-endemic area, India. BMC Infect Dis. 2011; 11:249. https://doi.org/10.1186/1471-2334-11-249
10.1186/1471-2334-11-249
CAS PubMed Web of Science® Google Scholar
38Hammer Ø, Harper DA, Ryan PD. PAST-palaeontological statistics, ver. 1.89. Paleontological Museum. University of Oslo; 2008. Noruega. También disponible en línea: http://folk.uio.no/ohammer/past/index.html
Google Scholar
39Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987; 4(4): 406–425.
CAS PubMed Web of Science® Google Scholar
40Tam VC, Serruto D, Dziejman M, Brieher W, Mekalanos JJ. A type III secretion system in vibrio cholerae translocates a formin/spire hybrid-like actin nucleator to promote intestinal colonization. Cell Host Microbe. 2007; 1(2): 95–107. https://doi.org/10.1016/j.chom.2007.03.005
10.1016/j.chom.2007.03.005
CAS PubMed Web of Science® Google Scholar
41Rahman MH, Biswas K, Hossain MA, Sack RB, Mekalanos JJ, Faruque SM. Distribution of genes for virulence and ecological fitness among diverse vibrio cholerae population in a cholera endemic area: tracking the evolution of pathogenic strains. DNA Cell Biol. 2008; 27(7): 347–355. https://doi.org/10.1089/dna.2008.0737
10.1089/dna.2008.0737
CAS PubMed Google Scholar
42Madhusudana RB, Surendran PK. Detection of ctx gene positive non-O1/non-O139 V. cholerae in shrimp aquaculture environments. J Food Sci Technol. 2013; 50(3): 496–504. https://doi.org/10.1007/s13197-011-0374-4
10.1007/s13197-011-0374-4
CAS PubMed Google Scholar
43Lu B, Zhou H, Li D, Li F, Zhu F, Cui Y, et al. The first case of bacteraemia due to non-O1/non-O139 vibrio cholerae in a type 2 diabetes mellitus patient in mainland China. Int J Infect Dis. 2014; 25: 116–118. https://doi.org/10.1016/j.ijid.2014.04.015
10.1016/j.ijid.2014.04.015
PubMed Google Scholar
44Kamareddine L, Wong AC, Vanhove AS, Hang S, Purdy AE, Kierek-Pearson K, et al. Activation of vibrio cholerae quorum sensing promotes survival of an arthropod host. Nature microbiology. 2018; 3(2): 243–252. https://doi.org/10.1038/s41564-017-0065-7
10.1038/s41564-017-0065-7
CAS PubMed Google Scholar
45 Centers for Disease Control and Prevention (CDC). CDC laboratory methods for the diagnosis of Vibrio cholerae. Laboratory methods for the diagnosis of Vibrio cholerae. Ch 6. Atlanta: CDC; 2015. Available from: http://www.cdc.gov/cholera/pdf/Laboratory-Methods-for-theDiagnosis-of-Vibrio-cholerae-chapter-6.pdf. Accessed 13 Apr 2016.
Google Scholar
46Bennett SD, Otieno R, Ayers TL, Odhiambo A, Faith SH, Quick R. Acceptability and use of portable drinking water and hand washing stations in health care facilities and their impact on patient hygiene practices, western Kenya. PLoS One. 2015; 10(5):e0126916. https://doi.org/10.1371/journal.pone.0126916
10.1371/journal.pone.0126916
PubMed Google Scholar
47Hao Y, Wang Y, Bi Z, Sun B, Jin Y, Bai Y, et al. A case of non-O1/non-O139 vibrio cholerae septicemia and meningitis in a neonate. Int J Infect Dis. 2015; 35: 117–119. https://doi.org/10.1016/j.ijid.2015.05.004
10.1016/j.ijid.2015.05.004
PubMed Web of Science® Google Scholar
48Janda JM, Newton AE, Bopp CA. Vibriosis. Clin Lab Med. 2015; 35(2): 273–288. https://doi.org/10.1016/j.cll.2015.02.007
10.1016/j.cll.2015.02.007
PubMed Google Scholar
49Gupta PK, Pant ND, Bhandari R, Shrestha P. Cholera outbreak caused by drug resistant vibrio cholerae serogroup O1 biotype ElTor serotype Ogawa in Nepal; a cross-sectional study. Antimicrob Resist Infect Control. 2016; 5:23. https://doi.org/10.1186/s13756-016-0122-7
10.1186/s13756-016-0122-7
PubMed Google Scholar
50Fernández-Abreu A, Bravo-Fariñas L, Rivero-Navea G, Cabrera-Cantelar N, Nuñez-Fernández FA, Cruz-Infante Y, et al. Determinants of virulence and antimicrobial susceptibility in Non-O1, Non-O139 vibrio cholerae isolates. MEDICC Review. 2017; 19: 21–25.
10.37757/MR2017.V19.N4.6
PubMed Google Scholar
51Dziejman M, Serruto D, Tam VC, Sturtevant D, Diraphat P, Faruque SM, et al. Genomic characterization of non-O1, non-O139 vibrio cholerae reveals genes for a type III secretion system. Proc Natl Acad Sci USA. 2005; 102(9): 3465–3470. https://doi.org/10.1073/pnas.0409918102
10.1073/pnas.0409918102
CAS PubMed Web of Science® Google Scholar
52Temba D, Namkinga L, Moyo S, Lyimo T, Lugomela C. Occurrence of pathogenic vibrio cholerae serogroups 01 and 0139 in some estuaries of Tanzania. Tanzan J Sci. 2018; 44(1): 145–158.
Google Scholar
53Tam VC, Suzuki M, Coughlin M, Saslowsky D, Biswas K, Lencer WI, et al. Functional analysis of VopF activity required for colonization in vibrio cholerae. mBio. 2010; 1(5): 10–128. https://doi.org/10.1128/mbio.00289-10
10.1128/mBio.00289-10
Google Scholar
54Igere BE, Okoh AI, Nwodo UU. Antibiotic susceptibility testing (AST) reports: a basis for environmental/epidemiological surveillance and infection control amongst environmental vibrio cholerae. Int J Environ Res Publ Health. 2020a; 17(16):5685. https://doi.org/10.3390/ijerph17165685
10.3390/ijerph17165685
CAS PubMed Google Scholar
55Igere BE, Okoh AI, Nwodo UU. Wastewater treatment plants and release: the vase of Odin for emerging bacterial contaminants, resistance and determinant of environmental wellness. Emerging Contam. 2020b; 6: 212–224. https://doi.org/10.1016/j.emcon.2020.05.003
10.1016/j.emcon.2020.05.003
Google Scholar
56Igere BE, Onohuean H, Igbinosa EO. Polymyxin sensitivity/resistance cosmopolitan status, epidemiology and prevalence among O1/O139 and non-O1/non-O139 vibrio cholerae: a meta-analysis. Infectious Medicine. 2023; 2(4): 283–293. https://doi.org/10.1016/j.imj.2023.11.004
10.1016/j.imj.2023.11.004
Google Scholar
57Igere BE, Onohuean H, Nwodo UU. Water bodies are potential hub for spatio-allotment of cell-free nucleic acid and pandemic: a pentadecadal (1969–2021) critical review on particulate cell-free DNA reservoirs in water nexus. Bull Natl Res Cent. 2022; 46(1): 56. https://doi.org/10.1186/s42269-022-00750-y
10.1186/s42269-022-00750-y
PubMed Google Scholar
58Chen C, Yang X, Shen X. Confirmed and potential roles of bacterial T6SSs in the intestinal ecosystem. Front Microbiol. 2019; 10:1484. https://doi.org/10.3389/fmicb.2019.01484
10.3389/fmicb.2019.01484
PubMed Google Scholar
59Murphy RA, Boyd EF. Three pathogenicity islands of vibrio cholerae can excise from the chromosome and form circular intermediates. J Bacteriol. 2008; 190(2): 636–647. https://doi.org/10.1128/jb.00562-07
10.1128/JB.00562-07
CAS PubMed Google Scholar
60Shin OS, Uddin T, Citorik R, Wang JP, Della Pelle P, Kradin RL, et al. LPLUNC1 modulates innate immune responses to vibrio cholerae. JID (J Infect Dis). 2011; 204(9): 1349–1357. https://doi.org/10.1093/infdis/jir544
10.1093/infdis/jir544
CAS PubMed Google Scholar
61Pezoa D, Blondel CJ, Silva CA, Yang HJ, Andrews-Polymenis H, Santiviago CA, et al. Only one of the two type VI secretion systems encoded in the Salmonella enterica serotype Dublin genome is involved in colonization of the avian and murine hosts. Vet Res. 2014; 45(1):2. https://doi.org/10.1186/1297-9716-45-2
10.1186/1297-9716-45-2
PubMed Google Scholar
62Ringel PD, Hu D, Basler M. The role of type VI secretion system effectors in target cell lysis and subsequent horizontal gene transfer. Cell Rep. 2017; 21(13): 3927–3940. https://doi.org/10.1016/j.celrep.2017.12.020
10.1016/j.celrep.2017.12.020
CAS PubMed Web of Science® Google Scholar
63Logan SL, Thomas J, Yan J, Baker RP, Shields DS, Xavier JB, et al. The Vibrio cholerae type VI secretion system can modulate host intestinal mechanics to displace gut bacterial symbionts. Proc Natl Acad Sci USA. 2018; 115(16): E3779–E3787. https://doi.org/10.1073/pnas.1720133115
10.1073/pnas.1720133115
CAS PubMed Web of Science® Google Scholar
64Corbitt J, Yeo JS, Davis CI, LeRoux M, Wiggins PA. Type VI secretion system dynamics reveals a novel secretion mechanism in Pseudomonas aeruginosa. J Bacteriol. 2018; 200(11): 10–128. https://doi.org/10.1128/jb.00744-17
10.1128/JB.00744-17
Google Scholar
65Sana TG, Lugo KA, Monack DM. T6SS: the bacterial “fight club” in the host gut. PLoS Pathog. 2017; 13(6):e1006325. https://doi.org/10.1371/journal.ppat.1006325
10.1371/journal.ppat.1006325
PubMed Google Scholar
66Zong B, Zhang Y, Wang X, Liu M, Zhang T, Zhu Y, et al. Characterization of multiple type-VI secretion system (T6SS) VgrG proteins in the pathogenicity and antibacterial activity of porcine extra-intestinal pathogenic Escherichia coli. Virulence. 2019; 10(1): 118–132. https://doi.org/10.1080/21505594.2019.1573491
10.1080/21505594.2019.1573491
CAS PubMed Web of Science® Google Scholar
67Fu Y, Ho BT, Mekalanos JJ. Tracking vibrio cholerae cell-cell interactions during infection reveals bacterial population dynamics within intestinal microenvironments. Cell Host Microbe. 2018; 23(2): 274–281. https://doi.org/10.1016/j.chom.2017.12.006
10.1016/j.chom.2017.12.006
CAS PubMed Google Scholar
68Chokesajjawatee N, Zo YG, Colwell RR. Determination of clonality and relatedness of vibrio cholerae isolates by genomic fingerprinting, using long-range repetitive element sequence-based PCR. Appl Environ Microbiol. 2008; 74(17): 5392–5401. https://doi.org/10.1128/aem.00151-08
10.1128/AEM.00151-08
CAS PubMed Google Scholar
69Waturangi DE, Joanito I, Yogi Y, Thomas S. Use of REP-and ERIC-PCR to reveal genetic heterogeneity of vibrio cholerae from edible ice in Jakarta, Indonesia. Gut Pathog. 2012; 4: 1–9.
10.1186/1757-4749-4-2
PubMed Web of Science® Google Scholar
70Ateba CN, Mbewe M. Determination of the genetic similarities of fingerprints from Escherichia coli O157: H7 isolated from different sources in the North West Province, South Africa using ISR, BOXAIR and REP-PCR analysis. Microbiol Res. 2013; 168(7): 438–446. https://doi.org/10.1016/j.micres.2013.02.003
10.1016/j.micres.2013.02.003
CAS PubMed Google Scholar
71Dutta D, Chowdhury G, Pazhani GP, Guin S, Dutta S, Ghosh S, et al. Vibrio cholerae non-O1, non-O139 serogroups and cholera-like diarrhea, Kolkata, India. Emerg Infect Dis. 2013; 19(3): 464–467. https://doi.org/10.3201/eid1903.121156
10.3201/eid1903.121156
PubMed Google Scholar
72Alishahi A, Fooladi AA, Mehrabadi JF, Hosseini HM. Facile and rapid detection of vibrio cholerae by multiplex PCR based on ompU, ctxA, and toxR genes. Jundishapur J Microbiol. 2013 Dec 1; 6(10). https://doi.org/10.5812/jjm.7933
10.5812/jjm.7933
Google Scholar
73Dalusi L, Saarenheimo J, Lyimo TJ, Lugomela C. Genetic relationship between clinical and environmental vibrio cholerae isolates in Tanzania: a comparison using repetitive extragenic palindromic (REP) and enterobacterial repetitive intergenic consensus (ERIC) fingerprinting approach. Afr J Microbiol Res. 2015; 9(7): 455–462. https://doi.org/10.5897/ajmr2014.7307
10.5897/AJMR2014.7307
Google Scholar

Volume2, Issue4

December 2024

Pages 361-374

This article also appears in:

Digestive System

Emergence and detection of gastro-enteric virulence genes in non-pathogenic Vibrio cholerae: Implications for public health and water safety in African developmental regions