2.1 Downregulated ZFP41 is correlated with poor survival in HCC patients

ZFPs play an important role in various types of cancers.^{14, 15} Nevertheless, the specific function of ZFP41 in HCC remains unknown.¹⁶ To explore the function of ZFP41 in HCC progression, we analyzed the immunohistochemical (IHC) staining on tissue arrays that included 105 paired HCC specimens and normal tissues (Figure 1A). The results revealed that ZFP41 expression was obviously elevated in normal tissues compared with the paired HCC specimens. The further to test the expression level of ZFP41 in HCC, its mRNA expression in patient samples was checked. qPCR was conducted to evaluate ZFP41 mRNA expression in 63 pairs of tissue samples from patients. The findings revealed that ZFP41 level was notably lower in HCC tissues compared with normal tissues (p < 0.01; Figure 1B). Then, we noticed that ZFP41 protein level was reduced in HCC tissues relative to normal tissues (Figures 1C and S1A). Following this, the expression levels of ZFP41 mRNA and protein in both normal liver and HCC cells were measured. Both qPCR and western blot assay results showed that the expression level of ZFP41 was much higher in HL-7702 cells than HCC cells (Figure 1D,E). These findings indicated that ZFP41 was overexpressed in normal tissues compared with HCC tissues. Based on the IHC scoring, patients were classified into two groups: a high ZFP41 expression group and a low ZFP41 expression group (Table S2). Consistent with the TCGA database, the findings indicated that patients exhibiting low ZFP41 levels had a worse overall survival (Figure 1F). Overall, the results suggested that the ZFP41 expression was downregulated in HCC and positively associated with the survival time of HCC patients (Table S1).

2.2 ZFP41 suppresses HCC cells proliferation in vitro and in vivo

To ascertain the role of ZFP41 in HCC, siRNA transfection was performed to knock down ZFP41 in MHCC-97H and HLF cells, as well as overexpressed ZFP41 in Hep3B cells. The protein level of ZFP41 was verified following transfection (Figure S2A). In MHCC-97H and HLF cells, siRNA-induced knockdown of ZFP41 caused increased cell proliferation and colony numbers. Conversely, the overexpression of ZFP41 in Hep3B cells resulted in reduced cell proliferation and colony numbers (Figure 2A,C–E). Immunofluorescence EdU further demonstrated that knockdown of ZFP41 increased cell growth compared with the control group in MHCC-97H cells, while upregulation of ZFP41 suppressed Hep3B cells growth (Figures 2B and S2B). We created various xenograft models to assess how ZFP41 influences HCC progression in vivo. First, Hep3B cells overexpressing ZFP41 were subcutaneously injected in nude mice. After 4 weeks, the group with ZFP41 overexpression showed reduced tumor volume and decreased tumor weight relative to the control group (Figure 2F,G). Then, we injected MHCC-97H cells with ZFP41 knockdown in the same way, the results were opposite (Figure 2H,I). IHC staining demonstrated that overexpression of ZFP41 could decrease the Ki-67 expression relative to the control group, while reducing ZFP41 resulted in opposite results (Figure S2C,D).

2.3 ZFP41 decreases HCC metastasis in vitro and in vivo

To confirm the involvement of ZFP41 in HCC metastasis, experiments for migration and invasion were first conducted in vitro. The result demonstrated that siRNA-induced knockdown of ZFP41 increased the ability of migration and invasion in MHCC-97H and HLF cells (Figures 3A and S3A). On the contrary, overexpression of ZFP41 in Hep3B cells resulted in the opposite effects (Figure 3B). Wound healing assays further confirmed these findings (Figures 3C,D and S3B). To evaluate the metastasis effect of ZFP41 in vivo, MHCC-97H control cells and MHCC-97H cells with reduced ZFP41 expression were injected via the tail vein in nude mice. After 6 weeks, the mice injected with ZFP41 knockdown cells showed more lesions compared with those injected with control cells (Figure 3E,G). In contrast, overexpression of ZFP41 in Hep3B cells significantly suppressed lung metastasis, as evidenced by a reduced number of nodules compared with the control group (Figure 3F,H). Based on to these results, ZFP41 could repress the development and metastasis of HCC in vitro and in vivo.

2.4 YTHDF3-mediated m⁶A modification of ZFP41 mRNA and its causes in decay of its mRNA stability

As the interest in RNA modifications continues to grow, more research reporting on the molecular mechanism of m⁶A in HCC has arised.¹⁷ The m⁶A modification is initiated or removed by “writers” or “erasers” respectively, while “readers” specially bind m⁶A-modified RNA and regulate RNA stability.¹⁸ To determine which the m⁶A regulator might be involved in regulation of the ZFP41 expression, we analyzed the mRNA level of ZFP41 in MHCC-97H and HLF cells after siRNA-mediated knockdown of several common m⁶A regulators, including METTL3, METTL14, WTAP, IGF2BPs, and YTHDFs. The result suggested that only si-YTHDF3 caused a rise to an in ZFP41 mRNA level, while the others showed no significant effects (Figures 4A,B and S4A,B). We then assessed the mRNA level of ZFP41 after transfecting siRNA targeting YTHDF3 and overexpressing YTHDF3 in MHCC-97H and Hep3B cells. RT-qPCR results indicated that ZFP41 mRNA level was significantly upregulated upon YTHDF3 inhibition, whereas overexpression of YTHDF3 resulted in downregulation of the ZFP41 mRNA level (Figure 4C,D). Western blot analysis demonstrated that reducing YTHDF3 level led to an elevation in ZFP41 protein in MHCC-97H and HLF cells, whereas increasing YTHDF3 expression led to a reduction in ZFP41 protein in Hep3B cells (Figure 4E,F).

On the basis of on-line prediction of SRAMP (http://www.cuilab.cn/sramp) on ZFP41 mRNA, a putative m⁶A site was showed with high confidence (Figure 4G). To validate this predicted site, a point mutation was introduced into the site to further construct a luciferase reporter plasmid containing the wt or the mutants of ZFP41. The results indicated that YTHDF3 failed to change the luciferase activity when the mutant was present (Figure 4H). Moreover, the m⁶A-specific antibody was found to be significantly enriched in ZFP41-wt but was not mutant in MHCC-97H and Hep3B cells (Figure 4I). In addition, the RNA decay assay validated that the stability of ZFP41 mRNA increased upon knockdown of YTHDF3 in MHCC-97H cells, while it decreased following the overexpression of YTHDF3 in Hep3B cells (Figure 4J). Moreover, through RIP-qPCR results, the binding of ZFP41 RNA to YTHDF3 in MHCC-97H and Hep3B cells was identified (Figure 4K). Then, the RNA-pull down assay was conducted to detect the physical binding of ZFP41 and YTHDF3 in these two cell lines, which was confirmed by the results of western blot assays (Figures 4L and S4C). Collectively, these findings revealed that YTHDF3 could directly bind to ZFP41, supporting the inhibition role of YTHDF3 in the regulation of ZFP41.

2.5 Snail is transcriptionally repressed by ZFP41 in HCC cells

The ZFP family is one of the largest transcription factor families.¹⁹ To explore how ZFP41 affects HCC progression, RNA-sequencing (RNA-seq) was conducted on MHCC-97H cells with ZFP41 knockdown (Figure 5A). We identified and verified some differentially expressed genes through qPCR assays (Figure S5A). Notably, Snail, a key player in the EMT pathway across multiple tumors, appeared in our results. To confirm whether ZFP41 could regulate Snail, the qPCR assays were performed in MHCC-97H and Hep3B cells overexpressing ZFP41. The mRNA level of Snail was decreased upon ZFP41 overexpression, while knocking down ZFP41 led to an upregulation of the Snail mRNA level in both two cell lines (Figure 5B,C). The JASPAR 2022 (https://jaspar.genereg.net/) prediction further showed the presence of two potential binding elements for ZFP41 within the −2000 to 0 bp region of the Snail promoter (Figure 5D). To validate the binding sites of ZFP41 on the Snail promoter, a luciferase reporter plasmid (PGL4.17) was constructed by cloning the promoter region of Snail from nucleotide −2000 to 0 bp. Luciferase reporter assays revealed that the upregulation of ZFP41 boosted the luciferase activity of Snail promoter in a dose-dependent manner (Figure 5E). Five different truncated PGL4.17 plasmids were created and cotransfected into MHCC-97H and Hep3B cells with ZFP41 and negative control to confirm the precise regions of ZFP41 interaction the Snail promoter. The results revealed that ZFP41 bound to the regions from −2001 to -897 bp (−2001/−897) and −2001 to -1449 bp (−2001/−1449) (Figure 5F,G). Therefore, it was hypothesized that ZFP41 might have a binding site at PBE1 in the Snail promoter. To test this hypothesis, we generated a mutation into the two different potential binding sites in the promoter, respectively. The results demonstrated that mutation of PBE1 eliminated the decrease of luciferase activity; however, mutation of PBE2 resulted in no difference compared with the complete promoter. These data suggested that ZFP41 could bind to the promoter of Snail at PBE1 (Figure 5H,I). Subsequently, CHIP assay was performed to investigate whether ZFP41 directly binds to the promoter of Snail in MHCC-97H and Hep3B cells (Figure 5J). Overall, these results suggested that ZFP41 transcriptionally repressed the Snail expression in HCC cells.

2.6 ZFP41 suppresses the proliferation and invasion of HCC cells by inhibiting the Snail expression and EMT pathway

To examine whether ZFP41 regulates the repression effects by inhibiting the Snail expression in HCC cells, we detected the protein levels of Snail and EMT pathway-related targets in Hep3B cells overexpressing ZFP41 and MHCC-97H cells with ZFP41 knockdown were detected. The findings indicated that ZFP41 overexpression elevated E-cadherin protein level and reduced Snail and N-cadherin levels. Knockdown of ZFP41 resulted in the opposite results (Figure S5B). To test whether ZFP41 functions as a cancer suppressor through Snail, we established cell lines in which MHCC-97H stably expresses ZFP41, as well as stably expressing both ZFP41 and Snail. First, we started with some in vitro assays. We transfected pcDNA3.1-vector and ZFP41 into MHCC-97H and Hep3B cells, or cotransfected pcDNA3.1-ZFP41 and Snail into the same cells. The result indicated that increased Snail expression restored cell migration and invasion capabilities in both MHCC-97H and Hep3B cells (Figure S6A). Similarly, the wound healing assay revealed the similar effects (Figure S6B). CCK8 assays and colony formation assays demonstrated that overexpression of ZFP41 suppressed the HCC cells proliferation ability, while overexpression of Snail abolished the suppressive effects of ZFP41 overexpression (Figure S6C–F). Next, we constructed different xenograft models. First, MHCC-97H cells with overexpressing Vector, ZFP41 and both ZFP41 and Snail were subcutaneously injected in nude mice. After 4 weeks, the group with ZFP41 overexpression showed smaller tumor volume and tumor weight. Rescued tumor volume and tumor weight were showed in the overexpressing ZFP41+Snail group (Figure 6A,B). To evaluate the impact of ZFP41 on HCC metastasis in vivo, we injected MHCC-97H cells with overexpressing Vector, ZFP41 and both ZFP41 and Snail through the tail vein in nude mice. After 6 weeks, the mice injected with ZFP41 overexpressed cells showed less lesions compared with those injected with control cells, and the overexpressing ZFP41+Snail group showed the rescued results compared with the overexpressing ZFP41 group (Figure 6C,E); the number of nodules in groups showed the same trend (Figure 6D). Furthermore, western blot assay results suggested that overexpression of ZFP41 increased the protein level of E-cadherin, but decreased Snail and N-cadherin protein levels. After overexpressing Snail, the relative protein levels were restored (Figure 6F). Consistent trends were also observed in these targets through IHC staining (Figure S2C,D).

Overall, above findings demonstrated that ZFP41 inhibits the EMT pathway by transcriptionally suppressing Snail, which in turn inhibits the proliferation and metastasis of HCC cells.

4.1 Cell culture

All cell lines were kept as single-layer cells in DMEM (Hyclone) supplemented with 10% fetal bovine serum (FBS) (Tsingmu, Wuhan, China) at 37°C in 5% CO₂.

The anti-sense oligonucleotides were designed and provided by AuGCT Biotecho to suppress the ZFP41 gene along with other m⁶A regulatory elements. Following the provided guidelines, siRNA was transfected using the Lipomaster 3000 Transfection Reagent (Vazyme, China). AuGCT Biotech (Wuhan, China) supplied the complete coding sequences of ZFP41, Snail, and YTHDF3.

4.2 Cell proliferation assay

The proliferation of HCC cells was assessed using the Cell Counting Kit 8. After cell transfection, the cells were evenly spread on 96-well plates (1000 cells/well). Following the established procedure, cells were grown and the absorbance at 450 nm was measured at intervals of 24, 48, 72, 96, and 120 h.

4.3 Colony formation assay

MHCC-97H, HLF, and Hep3B cells were seeded with six-well plates (1500 cells/plate), and DMEM (10% FBS). Cells were cultured for 2 weeks, and the fluid was changed once every week. After a fortnight, the cells underwent three times washed with cold PBS, add 4% paraformaldehyde, and set for 15 min, then add crystal violet and stained for 15 min. The number of cells in each group was counted and analyzed.

4.4 Western blots and antibodies

The PVDF membrane (0.45 µm; Millipore) was blocked for 1 h at room temperature using TBST containing 5% BSA, then added the primary antibody, followed by incubation on a shaker at 4°C for 8 h. Then, the PVDF membrane was washed three times with TBST before being incubated for 1 h at room temperature with anti-rabbit or anti-mouse immunoglobulin G secondary antibody (Servicebio). Wash it three more times with TBST. Finally, the ECL development solution was used to identify the PVDF membrane. Antibodies for YTHDF3 (25537-1-AP), E-cadherin (20874-1-AP), N-cadherin (22018-1-AP), and GAPDH (60004-1-Ig) were supplied by Proteintech. Novus Biologicals provided the ZFP41 (NBP2-83801) antibody. Cell Signaling Technology provided the Snail (#3879) antibody.

4.5 Immunohistochemistry

IHC staining was performed on the tissues with the kit provided by Servicebio. After dewaxing and rehydrating the paraffin sections, we performed antigen retrieval and blocked endogenous peroxidase. All steps are carried out in strict accordance with the instructions until the color detection is complete.

4.6 RNA stability assay

HCC cells were prepared by seeding them overnight in six-well plates, followed by treatment with actinomycin D (5 µg/mL, HY-17559; MedChemExpress) for durations of 0, 4, and 8 h. RNA extraction was performed with TRIzol after 36 h, and then qPCR was performed.

4.7 Dual-luciferase report assays

The CDS length of ZFP41 gene, the mutant of the ZFP41 were cloned into the psiCHECK-2 plasmid. Cells were plated at exceeding 60% density into 24-well plates for 12 h, followed by cotransfected with the appropriate reagents. Thirty-six hours after transfection, the relative activity was measured by the Dual Luciferase Reporter Assay Kit (DL101-01; Vazyme).

4.8 Chromatin immunoprecipitation

ChIP experiment was performed using the CST Chromatin immunoprecipitation Kit. The cells were crosslinked with 1% formaldehyde at room temperature for 10 min, and then glycine was added to terminate the reaction. The cells are scraped off, centrifuged, collected, and washed. The collected cells were resuspended with Buffer A, then centrifuged to collect the nuclear precipitate, then resuspended with Buffer B for the first time, then centrifuged to collect the nucleus, and then resuspended with Buffer B for the second time. The second suspension with Buffer B requires a brief ultrasound treatment of the sample to allow complete chromatin release. FLAG antibody (F1804; Sigma–Aldrich) were then added to the sample and incubated at 4°C overnight, while IgG antibody (#2729; Cell Signaling Technology) was added to the control group as a negative control and incubated overnight at 4°C. Then, added Protein A/G magnetic beads and incubate together with the sample for 2 h at 4°C. After three rinses with low salt solution and one with high salt solution, the chromatin was eluted and cross-linked, and the purified DNA was obtained by DNA purification column. Then, the qPCR assays were performed following the protocols. The specific CHIP primers are as follows: Snail-F: TAAATTGACACGGGACGGGG, Snail-R: CTGGTTCTAGCTGGAGAGCG.

4.9 Animal experiments

All animals are from GemPharmatech (Nanjing, China). All male BALB/c nude mice (4 weeks old) were allocated into Vec group, oeZFP41 group, shNC group, and shZFP41 group. The 1 × 10⁶ MHCC-97H or HLF cells were injected under both arms to generate a subcutaneous xenograft model. After 3−4 weeks, the tumors were then weighed, photographed, and measured. In the lung metastasis model, luciferase bearing MHCC-97H and Hep3B cells were injected into the tail vein of the BALB/C nude mice. Six weeks after the cells were injected, all the mice groups were sacrificed, and the intensity of luciferase bioluminescence were measured. Lung specimens were taken for HE section for subsequent data statistics

4.10 Statistical analysis

Each value was shown as the average plus or minus the standard deviation. Each experiment was performed three times. To assess statistical significance between two groups, Student's t-tests (for normal distribution) or Wilcoxon signed-rank tests (for matched pairs) were utilized. For multiple groups, statistical analysis was performed using either one-way ANOVA or two-way ANOVA. The Kaplan–Meier method illustrated the survival curves, while the log-rank test evaluated their statistical significance. Correlations were evaluated using a Pearson correlation test. Appropriate statistical tests were conducted for all figures, with p < 0.05 considered statistically significant: *p < 0.05; **p < 0.01; ***p < 0.001; ns: not significant. All statistical values were calculated using GraphPad Prism 8.0 software.