2.1 Development of a Next-Generation Anti-HER2 STING Agonist ISAC

To overcome the adverse effects associated with the use of STING agonists throughout the body and also the drug resistance of anti-HER2 mAbs, we proposed targeted delivery of the STING agonists to tumor sites by binding to antibodies against HER-2, which is overexpressed in multiple tumor types. The novel ISAC (named B002T-LP004) was designed by chemical conjugation of B002T (anti-HER2 mAb) with LP-004 (Figure 1A). LP-004 (consisting of a STING agonist and an optimized noncleavable PEG linker) was developed by our team's previous research work (patent application number of CN 118619928 A). The ISAC`s relevant physicochemical properties have been identified. Figure S1A presents a schematic diagram of all the theoretical conjugation forms of B002T-LP004 (D0 to D8).

The drug-to-antibody ratio (DAR), which represents the average number of drug molecules attached to each antibody, is a crucial parameter for ADCs. First, the DAR value of B002T-LP004 was determined to be 5.7 via the reduction-LC/MS method (Figure S1B). Its stability in PBS and plasma after 14 days of incubation was also evaluated, with only 4% and 15% decreases in DAR values, respectively (Figure S1C).

Moreover, both the function of the antibody component and the immunostimulatory activity of the STING component were investigated. The affinity of the Fab region in B002T-LP004 for the HER2 antigen on the surface of KYSE-410 cells was slightly weakened compared with that of the naked B002T mAb (Figure 1B), but there was no significant difference between them (Figure S1D, E) when analyzed by an SPR assay using the HER2 antigen fixed in the CM5 chip. In addition, similar to B002T, B002T-LP004 could also be endocytosed into KYSE-410 and SK-BR-3 cells (Figures 1E and S1F), but the endocytosis efficiency was diminished in the THP endocytosis assay (Figure S1G). Furthermore, the function of the Fc region of B002T-LP004 was also examined. Compared with that of the naked B002T mAb, the affinity between the Fc regions of B002T-LP004 and FCγRIIIA-158F/158 V was lower (Figure 1C, D). The ADCC assay further corroborated the above observation, indicating that the ADCC effect of B002T-LP004 was less pronounced than that of B002T (Figures 1F and S1H) and that the ADCC function is not the main mechanism of action (MOA) of B002T-LP004 against cancers.

Next, the antitumor ability of the ADCs was investigated via in vitro coculture experiments. Both B002T-LP004 and B002T demonstrated clear antitumor effects following huPBMC activation (Figures 1G and S1I). The greater the effect‒target (E/T) ratio is, the more pronounced the drug's effect, with small molecules exhibiting a comparatively weaker impact. The 1:1 and 2:1 E/T ratios resulted in minimal background killing, with the rate of killing being less than 50% after drug action, indicating that the 1:1 and 2:1 E/T ratios were relatively low. A 5:1 E/T ratio was subsequently selected for further investigation of the killing effects of different drug concentrations (Figures 1H and S1J), revealing an intersection point between the two curves of B002T-LP004 and B002T. At concentrations above the intersection point, the killing effect of B002T-LP004 was greater than that of B002T, whereas below, the killing effect of B002T-LP004 was inferior to that of B002T.

The immunostimulatory activity of STING in B002T-LP004 cells was tested in THP1-ISG-luc cells (Invitrogen). B002T-LP004 induced robust interferon responses with an EC₅₀ value of 0.0846 nM, which was more than 1 × 10⁻⁵-fold lower than that of the free payload, LP004 (Figure 1I). Unconjugated B002T antibodies did not induce any response, indicating that the stimulation depends on LP004. The immunostimulatory activity of B002T-LP004 likely cannot be separated from the expression of HER2 on target cells because B002T-LP004 failed to induce an interferon response in THP1-ISG-luc cells lacking HER2 expression (Figure S1K).

Here we constructed an ISAC molecule (B002T-LP004) and conducted physicochemical and in vitro activity evaluations, including DAR value assay, assessment of the binding ability of the ISAC to HER2, evaluation of its endocytosis efficiency in HER2 target cells, and investigation of its ADCC effect. Compared with similar ISACs, it has a higher DAR value but maintains better stability. In summary, a next-generation anti-HER2 STING agonist ISAC was successfully constructed with the predicted properties.

2.2 STING Agonist ISAC Exerts Potent Antitumor Effects in Four Cell Line-Derived Xenograft Mouse Models

For testing the in vivo efficacy of B002T-LP004, four cell line-derived xenograft (CDX) mouse models were selected for testing the in vivo efficacy of B002T-LP004, including the HCC1954/CB17SCID immunodeficient murine HER2 high-expression human breast cancer model, the SNU-5/CB17SCID immunodeficient murine HER2 low-expression human gastric cancer model, the JIMT/CB17SCID immunodeficient murine human breast cancer model, and the MC38-hHER2/C57 immunocompetent murine colorectal cancer model. B002T-LP004 demonstrated notable tumor inhibitory efficacy in each mouse model. In both the HCC1954 and SNU-5 mouse models (Figure 2A, B), B002T-LP004 demonstrated superior efficacy to the same dose of the B002T mAb. Furthermore, it exhibited superior efficacy to a higher equivalent dose of the small molecule LP004. Notably, B002T-LP004 exhibited complete tumor suppression at the lower dose (1 mg/kg (mpk)). Interestingly, B002T-LP004 demonstrated significantly greater potency than equal doses of DS8201 and T-DM1 in both the HER-2-resistant JIMT/CB17SCID immunodeficient murine breast cancer model and the MC38-hHER2/C57 immunocompetent murine colorectal cancer model (Figure 2C, D). The B002T-LP004 group of mice exhibited complete tumor inhibition. The above results demonstrated that B002T-LP004 displayed notable tumor inhibitory efficacy in each mouse model.

2.3 STING Agonist ISAC Induces Long-Lasting Immune Memory

Furthermore, we investigated whether B002T-LP004 can induce immune memory and whether immune memory is B002T-LP004 specific (Figure 3A). A transplanted tumor model was first constructed via MC38-hHER2 C57 mice (the tumor cell injection site is marked in red on the left). The mice were subsequently administered 3 mpk and 10 mpk doses of B002T-LP004, as shown in Figure S2A. Administration of B002T-LP004 at doses of 3 mpk and 10 mpk resulted in both suppression and regression of tumors. The inoculation of MC38-hHER2 cells on the opposite side of the cured mice (the tumor cell injection site is marked in red on the right side of the mice) subsequently led to the suppression and regression of tumors in the B002T-LP004 group, which occurred rapidly after a brief period of growth, as shown in Figure 3B. The growth of the tumor cells rapidly decreased, and B002T-LP004 inhibited the growth of the same type of tumor cells at the same target site. Following the regression of the MC38-hHER2 tumor for a second time, the MC38 cells were reinjected into the cured mice (the site of the tumor cell injection is marked in blue on the left side of the mice). As shown in Figure 3C, the MC38 cells of the mice in the B002T-LP004 group also rapidly regressed following a brief period of growth, suggesting that B002T-LP004 inhibited the growth of the same type of tumor cells with distinct target sites but not the same type of tumor cells. However, it appears to affect tumor cell growth differently. Finally, the mice that had been cured were inoculated with B16F10 cells once more (the tumor cell injection site is marked in purple on the right side of the mice). Unfortunately, immune cells do not appear to recognize the growth of different types of tumor cells with different targets (Figure S2B).

2.4 Exploring the Mechanism of Action of STING Agonist ISAC In Vivo

To explore the in vivo MOA of B002T-LP004, different transplantation tumor models were established to investigate the potential involvement of both the host and tumor tissue STING pathway in tumor suppression following B002T-LP004 administration. (The details of the experimental design are delineated in Table S1.) The wild-type (wt) C57BL/6 mice, C57BL/6J STING knockout (C57BL/6J-STING-KO, purchased from GemPharmatech Co., Ltd.), Mc38-hHER2 cells and MC38-hHER2 STING knockout (MC38-hHER2-STING-KO) cells (Figure S3A, B) were prepared to establish different transplantation tumor models. Figure 4A shows tumor inhibition in all the groups. Specifically, a comparison of G1 (C57BL/6J-STING-KO, Mc38-hHER2, and Mc38-hHER2, vehicle) and G2 (C57BL/6J-STING-KO, Mc38-hHER2, B002T-LP004) tumors revealed that the STING of tumor tissues has only a weak tumor-suppressing effect in the presence of ISAC (Figure 4B). Compared with G3 (wt C57BL/6J, Mc38-hHER2-STING-KO, vehicle) and G4 (wt C57BL/6J, Mc38-hHER2-STING-KO, B002T-LP004) tumors, when the ISAC drug is administered to mice in the normal state, the number of tumor cells is significantly suppressed (Figure 4C), and when both STING in mice and STING of the tumor cells are removed, the proliferation rate of the tumor cells is significantly increased (Figure 4D). In the cases of G7 (wt C57BL/6J, Mc38-hHER2, vehicle) and G8 (wt C57BL/6J, Mc38-hHER2, B002T-LP004) with wild-type mice bearing MC38-hHER2 tumors, G8 with B002T-LP004 treatment demonstrated the most effective tumor-suppressive effect. These results suggest that STING signaling in the host is the main driving force underlying tumor killing when B002T-LP004 is administered, whereas the STING signaling in tumor tissue plays a weaker role.

Subsequent to the identification of STING signaling in the host as the principal MOA of tumor rejection, alterations in immune cell populations in the peripheral blood following B002T-LP004 administration were examined. The specific marker selections for the flow cytometry assay were detailed in Table S2. The results clearly demonstrated that on the first day after B002T-LP004 administration, the proportion of immune cells in the peripheral blood, including T (CD45⁺ and CD3⁺), NK and NKT (CD45⁺ and NK1.1⁺), DC, Th (CD4⁺), and other cells, rapidly decreased, followed by gradual recovery to a level approaching that of the control group over time. Furthermore, the expression of immune cell activation markers was analyzed, and the results demonstrated that the proportions of activated immune cells, including T, B, NK, NKT, DC, and other cells, were elevated in the peripheral blood (Figure 5A). In light of these findings, we postulate that B002T-LP004 recruited immune cells from the peripheral blood to the tumor tissue, whereas the remaining T, B, NK, NKT, and other cells in the peripheral blood were still activated by B002T-LP004 (Figure S4A), IFN-γ, KC, TNFα, MCP-1, IL-12p70RANTES, IL-1β, IP-10, GM-CSF, IFN-β, and IFN-α in the peripheral blood of the mice in the ISAC administration group. In addition, the expression of IFN-γ, KC, TNF-α, MCP-1, IL-12p70, IP-10, and IFN-α increased significantly compared with that in the control group, reaching a peak value between 3 and 12 h, followed by a decrease to a level close to that of the control group after 168 h (Figure S4B).

The proportion of CD45⁺ immune cells in tumor tissues was significantly increased following B002T-LP004 administration compared to the other groups, indicating the upregulation of myeloid cells with inherent natural immunity and increased immune infiltration in tumor tissues (Figure 5B). Conversely, the proportion of lymphocytes, including T, B, NK, and NKT cells, tends to decrease. Additionally, T, B, NK, and NKT cells in the tumor tissue were rapidly activated (Figure S4C), and the trend of cytokine alterations in the tumor tissue was largely consistent with that observed in the peripheral blood (Figure S4D), initially showing an upregulation and subsequently returning to a level comparable to that of the control.

To determine which types of immune cells are activated by B002T-LP004 during tumor rejection and, thus, which types of immune cells play a more important role in tumor rejection, we first cleared CD4⁺ T, CD8⁺ T, and NK cells and macrophages from C57BL/6jGpt mice bearing Mc38-hHER2 individually. The mice were subsequently treated with B002T-LP004 (Table S3), and tumor growth was observed (Figure 6A). The details in Figure 6B demonstrate that the tumor growth rate of the mice that had been cleared of CD4⁺ T, CD8⁺ T, and NK cells was greater than that of the control group initially and that the rate slowed at approximately 15–20 days. In contrast, the tumor growth rate of the mice that had been cleared of macrophages was consistently lower than that of the control group. Unfortunately, it was not possible to draw clear conclusions as to which type of cells played a dominant role in tumor suppression, as in all groups, the tumors regressed rapidly and completely shortly after B002T-LP004 was given. We subsequently loaded the tumors further and observed the efficacy in NCG (NOD/ShiLtJGpt-Prkdc^em26Cd52Il2rg^em26Cd22/Gpt) mice with more severe immunodeficiency. These results indicated that B002T-LP004 could still exert a tumor inhibitory effect in this model. However, it did not lead to complete regression of the tumor. These findings suggest that B002T-LP004 may activate macrophages and DCs in NCG mice, thereby inhibiting tumors. In conclusion, it can be hypothesized that B002T-LP004 likely activates many immune cells when it eradicates tumors. Therefore, the killing activity of B002T-LP004 can be attributed to the collective action of multiple immune cells.

2.5 Safety Profile of B002T-LP004 ISAC

To evaluate the safety of B002T-LP004 ISAC, the effects of B002T-LP004 on the liver and kidney of mice bearing MC38 tumors were examined. First, liver function indices were compared between the B002T-LP004 and control groups. The B002T-LP004 group presented a slight decrease in alanine aminotransferase (ALT) and a significant decrease in azelaic aminotransferase (AST) (Figure 7A, B). In this context, the liver indices of healthy mice were also collected (Figure S5A). The ALT and AST indices of healthy control mice were significantly lower than those of the control group because the mice bearing tumor cells had some liver damage. Conversely, B002T-LP004 administration decreased the ALT and AST indices. With respect to renal function indices, the urea nitrogen (BUN) and creatinine (CREA) levels of the B002T-LP004-treated group and the control group did not significantly differ and were close to those of the healthy mice (Figures 7C, D and S5B). Thus, from the results of hepatic and renal indices, our ISAC drug does not appear to exhibit any discernible hepatic or renal toxicity.

5.1 Linker-STING Agonist

LP-004 (the synthetic information is detailed in the patent, application number: CN 118619928 A) was developed by our team.

5.2 Expression and Purification of the Anti-HER2 Antibody B002T

According to the amino acid sequence of trastuzumab (a recombinant anti-HER2 monoclonal antibody, https://go.drugbank.com/drugs/DB00072), the DNA sequences of the light chain and heavy chain were synthesized and cloned and inserted into the pCHO1.0 expression vector. The recombinant pCHO1.0-HER2 plasmid was transfected into CHO-S host cells via the lipofection method to establish a stable cell line with the selection drugs puromycin (A1113803; Gibco) and MTX (M8407; Sigma). Positive clones were screened to obtain a final monoclonal cell line by limit dilution on the basis of cell growth, expression and product quality. To produce antibodies, the seeded cells were cultured in Hycell CHO medium (SH30934.01; Cytiva) for resuspension and expanded to a density greater than 3.5×106 cells/mL. They were transfected and cultured in a 30 L bioreactor containing Dynamis medium (A24363SA; Gibco) for 14 days. EfficientFeed C+ media supplemented with AGT was added starting from the 3rd day. The collected cell culture supernatant was purified into an antibody-drug stock solution via protein A affinity chromatography, low pH inactivation, anion chromatography, cation chromatography, viral filtration, and ultrafiltration/diafiltration steps.

5.3 Preparation of the STING Agonist ISAC: B002T-LP004

A solution of 20 mg of anti-HER2 monoclonal antibody (c = 10 mg/mL, dissolved in pH = 7.4 PBS) was prepared, followed by the addition of triple molar equivalents of TCEP. The reduction was conducted at 0°C for 24 h. The LP-004 molecule (10 equivalents) was dissolved in DMA and added to the above solution. The coupling was continued at room temperature for 2 h. At the end of the reaction, the monoclonal antibody was subjected to centrifugation. The solution was then purified by elution using an Amicon Ultra 15 mL (50 kDa) and an Akta Avant 150. The elution system consisted of citrate buffer as follows: citrate dihydrate (5.59 mg), citrate monohydrate (0.21 g), sucrose (60 g), and purified water to a total mass of 1 kg.

5.4 Determination of the Drug-to-Antibody Ratio (DAR) in the STING Agonist ISAC

Samples of ISAC were taken in 1.5 mL EP tubes and diluted to 100 µL with PBS, resulting in a final concentration of 4 mg/mL. To the diluted sample, 100 µL of 8 M guanidine hydrochloride solution and 50 µL of 0.5 mL of DTT solution were added, and the mixture was incubated in a water bath at 37°C for 30 min. Centrifugation at 12,000 rpm for 5 min was then performed, after which 200 µL of the supernatant was removed from the injection vials for the uptake assay. A Waters ACQUITY UPLC was utilized with mobile phases A (0.1% FA, H₂O) and B (0.1% FA, ACN). The gradient elution program was as follows: 0–5 min, 22% B; 5–5.1 min, 22–26% B; 5.1–16 min, 26–36% B; 16–17.5 min, 36–90% B; 17.5–18 min, 90–22% B; and 18–20 min, 22% B. The flow rate was set at 0.35 mL/min, a MAbPac column (4 µm, 2.1 mm × 50 mm (P/N 088648)) was used, the column temperature was 80°C, and 5 µg sample was loaded. A Waters Time-of-flight (TOF) mass spectrometer (Synapt G2) equipped was used for mass measurement. The MS settings: resolution mode; capillary voltage, 3.0 kV; cone voltage, 60 V; desolvation temperature, 300°C; ion source temperature, 100°C; the flow rate of drying gas was 800 L/h; the flow rate of cone gas was 50 L/h.

5.5 Cell Lines

SK-BR-3 human breast cancer cells were purchased from the National Collection of Authenticated Cell Culture and were cultured in McCoy's 5A (Modified) medium supplemented with 10% fetal bovine serum (FBS). Both MC38-hHER2 (mouse colorectal cancer cells with knockdown of the mouse Her2 gene and overexpression of the human Her2 gene in MC38 cells) and MC38-hHER2-STNG KO (mouse colorectal cancer cells with knockdown of the mouse HER2 gene and STING gene and overexpression of the human HER2 gene in MC38 cells) were constructed by Shanghai Jiaolian Drug Development Co. Ltd. Both MC38-hHER2 and MC38-hHER2-STNG KO cells were cultured in MEM/high medium containing 10% FBS supplemented with 1.5 µg/mL blasticidin S HCl (#ST018; Beyotime) and 1 µg/mL puromycin. All the cell lines were maintained at 37°C in 5% CO₂.

5.6 Binding Activity of STING Agonist ISAC to FcγR/HER2 Antigen on the Cell Surface

CHO-K1/CD16A-158F cells (GenScript) expressing the FcγRIIIA-158F receptor, CHO-K1/CD16A-158 V cells (GenScript) expressing the FcγRIIIA-158 V receptor and KYSE-410 cells (ATCC) expressing the HER-2 antigen were selected for analysis. Following centrifugation, the cells were resuspended and washed once with DPBS. After resuspension with DPBS again, the cell density was adjusted to 2E⁶ cells/mL, and 100 µL of cell suspension was added to each well of a 96-well plate. The ISAC samples of varying concentrations were added separately and incubated at 4°C for 1 h. The plate was then washed three times with DPBS, and all the supernatants were removed. Subsequently, the Alexa FluorTM 488-conjugated goat anti-human IgG (H+L) secondary antibody (Invitrogen) was diluted 1:400 and added to each well (100 µL per well). The plate was then incubated at 4°C for 40 min. Following two washes with DPBS, the cells were resuspended in 400 µL of DPBS per well, and the mean fluorescence intensity (MFI) was analyzed via flow cytometry.

5.7 Real-time Binding and Analysis by Surface Plasmon Resonance (SPR)

Surface plasmon resonance analysis. Real-time binding and analysis by surface plasmon resonance (SPR) were conducted on a BIAcore T200 instrument (GE Healthcare) at 25°C. Anti-human lg (Fc) was diluted with acetate solution (pH = 5.0) to 20 µg/mL and immobilized on channels 1 and 2 of a research-grade CM5 chip via the amino coupling method (channel 1 of which was the reference channel). The ligands (B002T, B002T-LP004) were diluted to 2 µg/mL and injected into two channels (sample channels) at a flow rate of 20 µL/min. The ligands were captured by anti-human IgG (Fc) with a capture time of 60 s, and then the human HER2 antigen as an analyte was injected into channels 1 and 2 at concentrations of 6.25 nM, 12.5 nM, 25 nM, 50 nM and 100 nM at a flow rate of 20 µL/min. The binding time was 180 s, and the dissociation time was 480 s. The chip was regenerated with 3 M MgCl₂; the regeneration time was 30 s, and the flow rate was 30 µL/min. Finally, the affinities of the B002T, B002T-LP004 and human HER2 antigens were obtained via a 1:1 binding assay.

5.8 Endocytosis of STING Agonist ISAC Drugs

Endocytosis by KYSE-410 (ATCC), SK-BR-3 (ATCC), and THP-1 (ATCC) cells was detected using flow cytometry. The cells were made into a single cell suspension with a density of 4×10⁶ cells/mL. 200 µL of cell suspension was added to 200 µL of ISAC samples of different concentrations and incubated at 4°C for 60 min to bind antigen on cell surface. The cells were washed 2–3 times with 4°C DPBS to remove unbound antibodies. Cells were resuspended by 650 µL incubation buffer (serum-free basal medium), and then divided into six groups (100 µL per group), including incubation at 37°C for 2, 4, and 6 h and at 4°C for 2, 4, and 6 h. At the end of the incubation period, 300 µL of 4°C buffer was added to each sample to terminate internalization. The cells were then precipitated by centrifugation at 200 × g for 5 min at 4°C, and the supernatant was discarded. Subsequently, the Alexa FluorTM 488-conjugated goat anti-human IgG (H+L) secondary antibody (Invitrogen) was diluted 1:400 and added to each well (100 µL per well). The plate was then incubated at 4°C for 30 min. Following two washes with DPBS, the cells were resuspended in 400 µL of DPBS per well and MFI was assayed via flow cytometry. The internalization rate of the samples was calculated by comparing the MFI at 4°C and 37°C.

5.9 ADCC Evaluation With Human Peripheral Blood Mononuclear Cells (PBMCs)

Antibody-dependent cell-mediated cytotoxicity (ADCC) was evaluated using PBMCs derived from a donor as effector cells and SK-BR-3 cells as target cells. PBMC were resuscitated and added to 100 U/mL IL2 (#S10970058; Jiangsu Kingsley Pharmaceutical Co., Ltd.) containing T-cell medium (#BC-M-041; Bio-Channel) and activated with 5 µg/mL anti-CD3 antibody (#16-0037-85; Invitrogen) and 5 µg/mL anti-CD28 (#16-0289-85; Invitrogen) antibody for 72 h before cell spreading. The effector cells and the target cells (1 × 10⁴ cells) were incubated with each substance, and the effector:target (E:T) ratios used were 10:1, 5:1, 2:1, and 1:1. The samples were subsequently incubated with different drugs. After 48–72 h of incubation, cell viability was evaluated via a CellTiter-Glo Luminescent Cell Viability Assay (#G7558; Promega) following the manufacturer's instructions.

5.10 ADCC Evaluation ISAC With Reporter Bioassay

The density of target cells (KYSE-410/SK-BR-3) was adjusted to 2.5E⁵/mL, and 100 µL of the cell suspension was added to a 96-well plate and incubated overnight at 37°C in a 5% CO₂ incubator. The samples to be tested were diluted to varying concentrations, and 25 µL was added to a white 96-well plate and coincubated with cells for 45 min. The effector cells (Rhinogen ADCC Reporter Bioassay) were adjusted to a concentration of 3E⁶/mL, and 25 µL of the cell suspension was added to the 96-well plate, which was then incubated at 37°C in a 5% CO₂ incubator. After removing the medium from the plate, wash once with ADCC buffer and add 25 µL/well buffer. The 96-well plate was then incubated for an additional 6 h. The plate was subsequently removed and allowed to equilibrate at room temperature for 15 min. 75 µL of the luciferase assay reagent in the Bioassay was then added, and the signal was immediately detected.

5.11 Reporter Gene Assay for STING Activation in THP-1-ISG-luc Cells

The density of the SK-BR-3 cells was adjusted to 1E⁵/mL, and 100 µL of the SK-BR-3 cell suspension was added to a 96-well plate and incubated overnight at 37°C in a 5% CO₂ incubator. After removing the medium from the plate, the samples to be tested were diluted to varying concentrations, and 50 µL was added to a 96-well plate and coincubated with SK-BR-3 cells for 30 min. The THP-1-Lucia-ISG cells (Invivogen, thpl-isg) were adjusted to a concentration of 2E⁶/mL, and 50 µL of the THP-1 cell suspension was added to a 96-well plate, which was then incubated at 37°C in a 5% CO₂ incubator. The 96-well plate was then incubated for an additional 24 h. The plate was subsequently removed and allowed to equilibrate at room temperature for 15 min. Guassia luciferase assay reagent (Invivogen, rep-qlc4lg1) was then added, and the signal was immediately detected.

5.12 Flow Cytometry (FCM)

Blood sample processing: red blood cell lysate (#00-4300-54; Bioscience) was added to the blood sample and processed into a single cell suspension, followed by FCM analysis. Lymph node and spleen samples were also processed into single cell suspensions, then FCM analysis was performed.

The tumor samples were digested with enzymes (#DHTE-5001; RWD) and processed with the tissue processor (#DSC-800; RWD). The treated solution was filtered through a cell strainer (70 µm) to obtain single cell suspensions, then FCM analysis was performed.

For surface staining, the single cell suspensions were incubated with Fc blocking (#156604; Biolegend) for 10 min at 4°C and subsequently stained with an antibody cocktail against CD11b (#550993; BD), CD11C (#117339; Biolegend), CD45 (#103140; Biolegend), CD80 (#104708; Biolegend), CD86 (#105032; Biolegend), CD206 (#25-2061-82; eBioscience), CD274 (#124324; Biolegend), F4/80 (#17-4801-82; eBioscience), and MHCII (#107645; Biolegend) in the dark at 4°C for 1 h and then washed with FACS buffer. Sytox Blue (#S34857; Invitrogen) was then added, and the mixture was incubated for 5‒10 min before detection.

For intracellular staining, the single-cell suspensions were incubated with Fixable Viability Dye eFluor 780 (#65-0865-18; eBioscience) in the dark at 4°C for 30 min and then washed with FACS buffer. The single-cell suspensions were incubated with Fc block (#156604; Biolegend) for 10 min at 4°C and subsequently stained with an antibody cocktail against CD3 (#100216; Biolegend), CD3 (#555274; BD), CD4 (#100414; Biolegend), CD4 (#100447; Biolegend), CD8 (#100734; Biolegend), CD8 (#562283; BD), CD11b (#550993; BD), CD11C (#117339; Biolegend), CD19 (#115546; Biolegend), CD45 (#103140; Biolegend), CD69 (#104507; Biolegend), CD80 (#104743; Biolegend), CD86 (#105110; Biolegend), CD107a (#121618; Biolegend), CD274 (#124324; Biolegend), NK1.1 (#550627; BD), and MHCII (#107645; Biolegend) in the dark at 4°C for 1 h. The samples were fixed in fixation buffer (#00-8222-49; eBioscience) at room temperature for 50 min, washed with permeabilization/wash buffer (#00-8333-56; eBioscience), and incubated.

5.13 Pharmacodynamic (PD) Analysis

Whole blood was collected from the mice, and the serum was isolated for cytokine detection. Tumor tissue samples were lysed with lysis buffer (#78510; Thermo Scientific), and the lysed supernatants were used for cytokine detection. Indicators of the cytokine detection profile included IFN-γ, CXCL1 (KC), TNF-α, CCL2 (MCP-1), IL-12p70, CCL5 (RANTES), IL-1β, CXCL10 (IP-10), GM-CSF, IL-10, IFN-β, IFN-α, and IL-6 (#740622; Biolegend), and the detection was conducted according to the LEGENDplex kit instructions.

5.14 In Vivo Efficacy Experiments

HCC1954, SNU5, JIMT-1, and Mc38-hHER-2 tumor cells were selected to construct different transplantation tumor models in CB17/SCID and C57/BL6 mice. Eight-week-old mice were selected and inoculated with 1 × 10⁷ tumor cells. Once the tumor has reached an appropriate size (average volume 80–120 mm³), ISAC administration is performed, and subsequent changes in tumor volume, body weight and other indicators are observed. In the tumor rechallenge experiments, the drug was administered on a single occasion, and the complete disappearance of the tumor was ensured before each subsequent administration.

5.15 Generation of STlNG-Knockout MC38-hHER2-STNG-KO Cells

CRISPR/Cas9-mediated gene knockout was used to generate MC38-hHER2-STNG-KO cells. MC38-hHER2 cells were transfected with the Lenti-CRISPR-Cas9-sting·sgRNA plasmid (sg#1: acggcccagaggtcaccgct, sg#2: ggtcatactacattgggtac) via ExFect Transfection Reagent (Vazyme, cat. T101-AA). Selection was started by adding puromycin (Thermo Fisher) to the cell culture media approximately 24 h after transfection. Single cells were then plated in individual wells of a 96-well plate, and clones were identified via PCR sequencing. STING knockout cells were designated MC38-hHER2-STNG KO. The MC38-hHER2-STNG-KO cell lines selected according to the sequencing results were expanded and cultured, and cells with good growth status were selected and plated on white bottom transparent 96-well plates overnight. The cells were transfected with the pGL4.21/ISG5 plasmid via ExFect Transfection Reagent. After 24 h of transfection, MCB-22-049 (sting agonist) at a final concentration of 100 nM was added for stimulation, and the cells were incubated at 37°C and 5% CO₂ for 6 h. A biolite luciferase assay system (Vazyme, cat. DD1201-02) was added, and the chemiluminescence value was detected.

5.16 In Vivo Efficacy Experiments in STING-KO Mice

In vivo efficacy studies were conducted in severe combined C57BL/6 and C57BL/6J-STING-KO mice (Gempharmatech). We suspended 3 × 10⁶ MC38-hHER2 or MC38-hHER2-STNG KO cells in 0.1 mL of PBS (pH 7.4) and injected them subcutaneously into the right flanks of the mice. For the colon cancer MC38-hHER2 and MC38-hHER2-STNG KO xenograft experiments, treatment was initiated when the tumor volume averaged 80–120 mm³ and was administered once intravenously at an ISAC concentration of 2 or 0.075 mg/kg (i.v., 10 µL/g, n  = 4–8 mice per group). Tumor volumes were measured twice a week via a caliper device (length × width) and calculated via the following formula: TV = 0.5 × a × b², where a and b are the long and short diameters of the tumor, respectively. When the tumor volume of an individual mouse is greater than 3000 mm³, the mouse will be euthanized, and photos of the mouse and tumor will be taken.

5.17 In Vivo Immune Cell Depletion

NK cells were depleted during MC38-hHER2 tumor growth via the intraperitoneal injection of 100 µL of anti-asialo GM1 (#146002; BioLegend) or 1 mL of water to dissolve asialo GM1 powder, 20 µL of which was taken and diluted in PBS to 100 µL via intraperitoneal injection into the mice (Q5D × 5 doses). CD4+ T cells and CD8+ T cells were depleted via InVivoMAb anti-mouse CD4 (#BE003-1; BioxCell) and InVivoMAb anti-mouse CD8 (#BE0061; BioxCell) antibodies and intraperitoneal injections of 200 µg/mouse, Q4D × 6 doses. The macrophages were depleted of clodronate liposomes (#40337ES10 and #40337ES08; Yeasen) at a dose of 1 mg/mouse, Q4D × 6.

5.18 Safety Evaluation

Four C57BL/6J mice were subcutaneously inoculated with MC38-hHER2 cells. When the average tumor volume reached 113.17 mm³, the mice were grouped. The day of grouping was designated as D0, and dosing was initiated. The administration volume was 5 µL/g × body weight (g). Subsequently, tumor size was measured twice weekly, and body weight was recorded twice weekly. At the experimental endpoint (D24), mice were photographed, tumors were excised, weighed, and photographed, approximately 100 µL of peripheral blood was collected for flow cytometry, and approximately 60 µL of serum was collected for ALT, AST, CREA, and BUN measurements.

5.19 Statistical Analysis

In vitro experiments were performed in triplicate for each group, and the data are presented as the mean ± standard error of the mean (SEM). IC₅₀ and EC₅₀ values were calculated via GraphPad Prism 9 software, which was also used for data visualization. Survival data are expressed as the mean ± standard deviation (SD), and additional data are expressed as the mean ± SEM. For comparisons between two groups of samples, independent t tests were performed. All the data were analyzed via SPSS (version 24). p < 0.05 was considered statistically significant.