Europium-doped LaSr₂AlO₅ (LSA:Eu) has been investigated as photocatalyst for methylene blue degradation in water solutions under UV light. The photograph shows a sequence of the solutions taken each 10 min in the third cycle of use, and achieving total degradation after 360 min of UV irradiation.

In this work, zinc chloride and copper sulfate have been used as precursors and Cu₂O/ZnO nanoparticles have been synthesized in aqueous/alkali media at the presence of cotton fabrics and folic acid. Folic acid, as a biotemplate for synthesis of Cu₂O/ZnO, was used to improve the reducing and stabilizing the ability of cotton fabric. Cotton fabric was used as a soft template to control the synthesis of desirable nanostructures with specific size and morphology.

Formulations of aluminum chloride phthalocyanine were prepared in polymeric micelles of pluronic^™ surfactants F-127 and P-123 and tested for inactivation of microorganisms. The process of incorporation of AlPcCl on copolymers was effective and the formulation obtained for the system AlPcCl/P-123 had good results against different kind of microorganisms.

An innovative mercury-free Dielectric Barrier Discharge (DBD) flat lamp has been developed to obtain large spectrum UV-C radiation. The UV-C radiation is produced by a pyrophosphate phosphor doped with Pr3+ (α-Ca2P2O7: Pr2%Na2%) internal coating excited by the 172 nm emission of a Ne-Xe plasma. This work investigates the influence of the plasma parameters on the newly developed UV source energy efficiency and its bactericidal efficiency.

Hiporfin is one kind of photosensitizer that has been approved by Chinese SFDA. In this study, hiporfin was used to see its photodynamic activity in osteosarcoma. After illumination by 630 nm laser, hiporfin killed osteosarcoma cells by increased ROS level and through apoptosis and necroptosis pathways. In vivo study also showed potent tumor eradication. All these provided evidences for the clinical trial of hiporfin on osteosarcoma.

Spectral irradiance of 195 sunbeds in five areas of the United Kingdom was measured in order to assess the radiant doses as increased use of indoor tanning has led to concerns for its impact on the risk of cutaneous cancers. Use of sunbeds for cosmetic purposes should be discouraged, with effective enforcement of the ban on under-18 use, strict control on tanning duration and promotion of information on health risks of sunbed use. Such an integrated approach on safe equipment, safe use and information should reduce the risk of detrimental impact of sunbed use on public health.

An Excel spreadsheet that calculates solar spectral irradiance between 290–3000 nm on an unshaded, horizontal surface under a cloudless sky at sea level, together with summary outputs such as global UV index, illuminance and percentage of energy in different wavebands. The spreadsheet is easy to use by anyone with an interest in sunlight and solar power irrespective of their background in that just four inputs are required—geographical latitude, month, day of month and time of day.

Plant extracts can be incorporated in photoprotective formulations. The crude extract and the fraction containing gallic acid, ethyl gallate and a mixture of flavonoids were obtained from Schinus terebinthifolius leaves. Emulsion and gel formulations containing the crude extract were prepared to evaluate the permeation and the histology of the skin after topical application of the formulations. The photoacoustic spectroscopy measurements confirmed absorption in the UV region and related to the permeation of these formulations. No histopathological changes were detected.

Subjects residing at Canadian Forces Station (CFS) Alert (82° 30′ 00″ N) filled out questionnaires regarding sleep difficulty, psychological well-being and mood and wore Actigraphs to obtain objective sleep data. Saliva was collected prior to and following treatment to measure melatonin and assess melatonin onset. Individuals were given individualized daily light treatment interventions based on their pretreatment salivary melatonin profile. The light treatments were effective in improving sleep quality and reducing negative affect among the participants.

Trace quantities of hydrogen-bonding impurities in otherwise highly purified and dried glassy hydrocarbon matrices at 77 K modify the relative triplet state energy levels, and hence the photophysical properties of two aromatic ketones, xanthone and chromone, to the extent that the intrinsic spectroscopic properties are obscured. The intrinsic spectroscopic properties of each are revealed in multicrystalline n-alkane Shpol'skii matrices, and also in rigorously purified and dried hydrocarbon glasses at 77 K. The extreme sensitivity to substoichiometric quantities of hydrogen-bonding impurities arises from the near-degeneracy of the two lowest-lying triplet states, and the sensitive nature of the n→π* blueshift phenomena to specific hydrogen-bonding interactions.

Minor long-wavelength absorption bands of the excited state intramolecular proton transfer (ESIPT) dye 2-(2′-hydroxyphenyl)benzoxazole (HBO) have been observed in DMSO by us and others. These bands might have been caused by base or metal salt impurities introduced by glass Pasteur pipettes that are equipped with latex rubber bulbs. Without the interference of extraneous bases or metal salts, solvent-mediated deprotonation fails to occur. The propensity of HBO to deprotonation is much higher in DMSO than in less polar solvents. The solvatochromic shifts of HBO suggest that the ESIPT is hindered in polar solvents that are also strong hydrogen bond acceptors.

Femtosecond optical excitation of the localized surface plasmon resonance of Au–Cu₂O core-shell nanocages creates hot electrons which transfer energy to the Au and Cu₂O lattices on picosecond timescales, leading to coherent vibrational motion. Structural mechanics simulations reproduce the dominant lattice vibrational frequency by treating the rapid thermal expansion of the Au nanocage as a force that acts on the Cu₂O shell.

One bond twist photoisomerization of cis-I,2-di(1-methyl-2-naphthyl)ethene in glassy media.

In an effort to create a molecule that can absorb low energy visible or near-infrared light for photochemotherapy (PCT) with easily tunable excited state properties, the new complexes [Ru(biq)₂(dpb)](PF₆)₂ (1, biq = 2,2′-biquinoline, dpb = 2,3-bis(2-pyridyl)benzoquinoxaline) and [(biq)₂Ru(dpb)Re(CO)₃Cl](PF₆)₂ (2) were synthesized and characterized. Complex 1 undergoes photoinduced ligand dissociation of the dpb ligand in coordinating solvent in the PCT window, however, the bimetallic complex is photoinert but does absorb lower energy light. The differences in the photophysical properties and the crystal structures of the complexes are discussed and used to explain the differences in photoreactivity.

Exciplexes of 9,10-dicyanoanthracene with low oxidation potential (E_ox) alkylbenzenes in cyclohexane show structureless emission spectra suggesting ideal charge-transfer (CT) states. With higher E_ox donors, vibrational structure emerges. A theoretical model of mixing with a locally excited (LE) state reproduces the spectra and radiative rate constants. The fractional CT character of a highly mixed exciplex varies widely with fluctuations in the microscopic environment and/or librational geometry. Fluctuations favoring the LE (or CT) state contribute more to the blue (or red) side of the overall spectrum. The “ideal CT” appearance of the low-E_ox spectra is illusory, resulting instead from several compensating factors.

We report synthesis and studies of organic compounds incorporating indolo[3,2-b]-carbazole (ICZ), and 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene (BODIPY) or diketopyrrolopyrrole (DPP). The spectroscopic studies suggest stronger interaction between ICZ and BODIPY in both ground and excited states as well as more efficient energy transfer from ICZ to BODIPY, compared to those of the ICZ-DPP compound, which could be related to the unfavorable orientation of the transition dipoles of ICZ and DPP chromophores. Furthermore, in a solid film of the ICZ–π–BODIPY triad an aggregate of the triad molecules was observed, resulting in a redshift of the absorption maximum (~100 nm) relative to a solution.

A new series of fluorescent indicators are developed for sensing super acids. The fluorescence intensity switches from the nonemissive state (the diprotonated form) to the intense emissive state (the triprotonated form) with pK_a as low as −3.16. This super acid indicator with the highly emissive intensity, great chemical stability and excitation/emission wavelengths in the visible region may find potential applications in industry.

The steady-state spectroscopy of 2-(N-methylacetimidoyl)-1-naphthol reveals composite absorption and emission spectra from 298 to 193 K in hexane. The S₀ state absorption can be assigned to the sum of three molecular structures in chemical equilibrium: the OH normal tautomer and two NH proton transfer tautomers. On photoexcitation of the OH tautomer the excited state intramolecular proton transfer is undergone, and the corresponding NH emission is monitored at 470 nm. On photoexcitation of the NH tautomers the previous emission is monitored in addition to another emission at 600 nm, which is ascribed to intramolecular hydrogen-bonded (IHB) nonplanar NH tautomers generated from the IHB planar NH tautomers.

Photoexcitation of covalently bound phenothiazine donors with methylviologen acceptors separated by C₈, C₁₀ and C₁₂ alkane chain spacers incorporated in a “through-ring” (rotaxane) fashion to α-cyclodextrin hosts leads to biradicaloid charge-separated states that are studied by time-resolved electron paramagnetic resonance spectroscopy at the X-band and Q-band microwave frequencies. Computer simulation of the spectra using a “static” model for spin-correlated radical pairs allows extraction of the spin exchange interactions, which range from –2 to –1000 Gauss. The results are discussed in terms of through-bond vs through-space electronic coupling mechanisms as a function of donor–acceptor distance.

A quantitative assessment of the stepwise versus concerted photodeazotization pathways of 2-diazo-1,2-naphthoquinone (1) forming ketene 3 is provided. Trapping of the carbene intermediate 2 by methanol yields 2-methoxy-1-naphthol (4) in up to 12% yield. [3+2]Cycloaddition of 2 and acetonitrile yielding 2-methylnaphth[2,1-d]oxazole (5) was also observed. The lifetime of the thermalized carbene 2 is at least 200 ps. A comparison of the yields of 5 formed upon photolysis and upon thermolysis of 1 in acetonitrile provides evidence that a substantial part of the hot nascent carbene 2 formed photolytically rearranges to the ketene 3 during its vibrational relaxation (hot ground-state reaction).

Spectral characteristics of five components of Dissolved Organic Matter (DOM) in Glacial Lake Agassiz peatland porewaters identified by PARAFAC modeling of EEM fluorescence spectra. Color contours reflect intensities expressed in Quinine Sulfate Equivalent (QSE) units; blue low, red high. The relative loadings of these components to total fluorescence vary as a function of peat type and depth, and appear to be a function of the quality of the DOM and the active microbial community present.

Templating properties of urea in solid-state photodimerization of stilbazoles and bispyridylethylenes have been established through a study that combined photochemistry and X-ray crystallography. The templating ability of urea derives from its ability to form hydrogen bond with itself and with coguests stilbazoles and bispyridylethylenes. At this stage, it is not easy to predict when urea will and when will not function as a template.

Photolysis of a Ruthenium-pyrene complex in oxygenated aqueous solutions results in efficient sensitization of singlet oxygen. In the presence of substrates, large increases in the orange luminescence of the Ruthenium-pyrene complex are observed as dissolved oxygen reacts with the substrate. Luminescence intensity changes allow determination of rate constants for singlet oxygen reaction with substrates.

The GFP-like chromophore O0 undergoes solid-state [2 + 2] photodimerization to form a head-to-tail syn-oriented photodimer OD that is confirmed by X-ray crystallography. The excited-state “meta-ortho effect” of the amino analogs of GFP chromophore in solutions and aggregates is also established and discussed.

Binding of 15-crown-5-derived mono- and bis-styryl dyes to the nucleic acids leads to a fluorescence enhancement by a factor of up to 54.

Through the use of optical quenching of a molecular dye (DY680) by a gold nanoparticle appended to DNA, the conformation of the Hybrid-2 conformer in telomeric DNA sequence was measured. The results clearly demonstrate the versatility of nanometal surface energy transfer (NSET) molecular rulers for measuring biopolymer structures, allowing mapping of the structure and no evidence of nonspecific interactions between the gold and DNA sequence which would lead to perturbation of the folding landscape.

The behavior of DNA conjugates having Michler's ketone hairpin linkers is dependent upon the ground state conformation of the linker. Linkers in which there is little interaction with the adjacent base pair undergo fluorescence and intersystem crossing to form a long-lived triplet state; whereas linkers that are stacked with an adjacent purine base undergo fast, reversible electron transfer.

Upon photochemical activation, meta-bis-tetrafluoropyridinylalkyne-lysine conjugates induce pH-dependent DNA ds-photocleavage. Efficiency of DNA damage is strongly enhanced at pH < 7. The observed pH-dependence of the DNA photocleavage activity stems from change in the protonation states of lysine amino groups. The ROS (Reactive Oxygen Species) scavenger experiments suggest that singlet oxygen is partially involved in the DNA damage.

G-quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG) in presence of K⁺ ions are studied by fluorescence spectroscopy from femtosecond to nanosecond domains. Population of exciton states leads to ultrafast energy transfer. Bright excited states with weak charge transfer character emit at the fluorescence maximum and decay between 1 and 100 ps. Charge transfer states with longer lifetime emit at lower energy. Due to the increased rigidity of these monomolecular structures, the persistence of excitations is longer and the contribution of charge transfer states is more pronounced than what is observed for tetramolecular G-quadruplexes.