2.1 USP14 expression increased in NSCLC patients with DDP resistance

To analyze the clinical relevance of USP14, the mRNA levels of USP14 in human lung cancer tissue and adjacent normal tissue were measured. The mRNA levels of USP14 were higher in lung cancer tissues compared with the levels in normal lung tissues in The Cancer Genome Atlas (TCGA) database (Figure 1A). The survival rate of people with high USP14 expression was lower than the survival rate of people with low USP14 expression in the TCGA database (Figure 1B). The expression of USP14 in tumor and normal lung tissues from subjects with lung cancer in a hospital cohort was measured by quantitative real-time polymerase chain reaction (qRT-PCR) and immunohistochemistry (IHC). As shown in Figures 1C,D, USP14 mRNA and protein levels were higher in the lung tissues of patients with lung cancer, especially in DDP-resistant patients, compared with the levels in normal lung tissues. Gene set enrichment analysis (GSEA) showed that USP14 expression was related to apoptosis and the AKT signaling pathways (Figure 1E). These data suggest that USP14 is associated with DDP resistance in patients with lung cancer.

2.2 USP14 regulates cell viability, apoptosis, and DDP resistance

To investigate the function of USP14 in lung cancer, two siRNAs targeting USP14 (siUSP14#1 and siUSP14#2) were transfected into A549/DDP cells and a USP14 expression vector was transduced into A549 cells. DDP cytotoxicity in A549/DDP and A549 cells was shown in Figure 2A and 2B, respectively. DDP with IC50 of 133.3 and 63.7 μM was obtained for A549/DDP cells with siNC or siUSP14#1 transfection, respectively (Figure 2A). DDP with IC50 of 57.7 and 86.2 μM was obtained for A549 cells with empty vector or USP14 expression vector transduction, respectively (Figure 2B). Moreover, apoptosis rates were higher in A549/DDP cells with relatively low USP14 expression compared with the rates in control cells (siNC) (Figure 2C,E). Apoptosis rates were lower in A549 cells with high USP14 expression compared with the rates in control cells (Vector) (Figure 2D,F). More importantly, low USP14 expression sensitized A549/DDP cells to DDP, while high USP14 expression desensitized A549 cells to DDP (Figure 2A–F). Western blots showed that the expression of USP14 positively correlated with the expression of p-EGFR, EGFR, p-PI3K, and p-AKT (Figure 2G), suggesting that USP14 silencing inhibits DDP resistance via the EGFR/PI3K/AKT signaling pathway. Due to the similar effects of siUSP14#1 and siUSP14#2 on USP14 expression and EGFR/PI3K/AKT signaling pathway, siUSP14#1 was therefore selected randomly for subsequent experments.

2.3 USP14 interacts with EGFR and facilitates deubiquitination of EGFR

USP14 is a DUB enzyme, and EGFR can be regulated by ubiquitination and DUB.³¹ Thus, we hypothesized that USP14 regulates EGFR protein levels via DUB. USP14-EGFR interaction was confirmed using co-immunoprecipitation (Figure 3A). Silencing USP14 significantly decreased EGFR protein levels, but not mRNA levels, and overexpressing USP14 remarkably increased EGFR protein expression but not EGFR mRNA in A549/DDP cells (Figure 3B,C). USP14 induced EGFR DUB to increase EGFR protein in A549/DDP cells (Figure 3D). These results demonstrate that USP14 interacts with EGFR and induces EGFR DUB.

2.4 Screening and characteristics of AM binding to A549/DDP using Cell-SELEX

Accurate targeting is the key to improving therapeutic effects. Therefore, we used Cell-SELEX to screen for AMs in 12 pools (Figure S1). The binding forces of ssDNA from the 12 pools were compared using a cell-enzyme-linked oligonucleotide assay. The binding forces from the 11th and 12th pools were not significantly different (Figure 4A). The ssDNA from the 11th pool was amplified into dsDNA using PCR, and the dsDNA library was inserted into the pUC19 plasmid and transformed into E. coli DH5ɑ. Recombinant plasmids from colonies of E. coli DH5ɑ were identified by digestion with endonuclease enzyme (EcoR I and Sac I) (Figure 4B). The plasmids from positive colonies were amplified into ssDNA with unique sequences and binding force was compared using asymmetrical PCR. Four AMs (numbers 2, 5, 10, and 17) showed higher binding forces than the other AMs (Figure 4C). The Kd values of the four AMs were measured using cell-ELONA and number 10 exhibited the highest binding force, with a Kd of 38.69 ± 10.51 nM (Figure 4D). The binding of fluorescein thiocyanate (FITC)-labeled AM 10 (A10) to A549/DDP cells was dose-dependently increased, as determined by flow cytometry (Figure 4E). The subcellular localization of A10 in A549/DDP and A549 cells was visualized using FITC-labeled A10. Labeled A10 bound specifically to A549/DDP (Figure 4F), suggesting that A10 is a successful tool for targeting A549/DDP cells.

2.5 Aptamer-siRNA nano-zinc carriers regulate DDP resistance in A549/DDP cells

Nanotube zinc particles were designed as siUSP14 carriers in A10 oriented cells using the cell's phagocytic ability to internalize the nano-zinc carriers and release siUSP14 inside the cell. The nano-zinc carriers had a long (120–300 nm) cylindrical porous structure, as determined by the scanning electron microscopy (Figure 5A). To verify the targeting of this system, aptamer A10 was coupled to nano-zinc carriers, and Cy3-labeled siUSP14#1 was loaded into the nano-zinc carriers. The modified nano-zinc carriers were incubated with A549 and A549/DDP cell lines and the cells were observed using laser confocal microscopy. The aptamer A10 coupled with nano-zinc carriers loaded with Cy3-labeled siUSP14#1 bound specifically to A549/DDP cells (Figure 5B). Figure 5C shows the siUSP14#1 loading efficiency of the nano-zinc carriers at various nano-zinc carriers/siUSP14#1 weight ratios; maximum siUSP14 loading efficiency was observed at a weight ratio of 1/1. As shown in Figure 5D, the treatment of free siUSP14#1 with RNase A for 2 h resulted in the complete degradation of siRNA. However, nano-zinc carriers increased the stability of siUSP14#1. In addition, the release profile of siUSP14#1 from nano-zinc carriers was determined at pH values of 5.2, 6.2, and 7.4. We observed a 72 h sustained release of siUSP14 from the nano-zinc carriers at different pH values (Figure 5E). At a relatively low pH of 5.2, 79% of siUSP14#1 was discharged from the nano-zinc carriers in 72 h. In contrast, at a physiological pH of 7.4, only 24% of the siUSP14#1 was discharged in 72 h. When the aptamer A10-coupled nano-zinc carriers loaded with siUSP14#1 were internalized, DDP induced dose-dependent apoptosis (Figure 5F). These results demonstrate that aptamer-siRNA nano-zinc carriers inhibit DDP resistance in A549/DDP cells.

2.6 Antitumor efficacy of aptamer-siRNA nano-zinc carriers in a lung cancer mouse model bearing A549/DDP cells

To examine the antitumor efficacy of aptamer-siRNA nano-zinc carriers in lung cancer in vivo, A549/DDP or A549 tumor cells were implanted into nude mice. After 10 days, mice received a single intravenous injection of 5 mg/kg/d aptamer A10-coupled nano-zinc carriers loaded with siUSP14#1 (A10/NaZ/siUSP14#1). The distribution of Cy3-labeled siUSP14#1 delivered by the A10/NaZ carriers was evaluated using biophotonic imaging technology. Whole body images showed a strong signal for A10/NaZ/siUSP14#1 in the heart, liver, and kidneys 5 and 10 h after injection (Figure 6A). A10/NaZ/siUSP14#1 accumulated in tumors, and the signal was stronger in mice bearing A549/DDP cells compared with mice bearing A549 cells (Figure 6A). The penetration depth of the optical source was limited in whole-body imaging. Thus, mice bearing A549/DDP cells were sacrificed and the organs were excised for ex vivo imaging. Ex vivo fluorescent imaging showed a strong signal in tumors, heart, liver, and kidney 4 h after injection, while a fluorescent signal was detected in tumors but not other organs 16 h after injection (Figure 6B). Surviving A549/DDP and A549 cells were detected using bioluminescence at 0, 1, 2, 3, and 4 weeks after injection, verifying the in vivo targeting efficacy of A10/NaZ/siUSP14#1 (Figure 6C). These results demonstrate that aptamer-siRNA nano-zinc carriers inhibit tumor growth in vivo.

Different concentrations of the nano-zinc carrier (0, 5, and 10 mg/kg/d) were intravenously injected into nude mice. Initially, mouse body weights decreased in the 10 mg/kg/d group (Figure S2A). The heart, liver, lungs, spleen, and kidneys were histologically analyzed 30 days after injection with the indicated concentrations of the nano-zinc carrier. Some chronic toxicity was observed in the 10 mg/kg/d group, mainly in the liver and kidney (Figure S2B). Therefore, a concentration of 5 mg/kg/d was used in subsequent studies. The survival rate and tumor morphology and volume were compared. Treatment with A10/NaZ/siUSP14#1 combined with DDP induced the best therapeutic effects, including smaller tumor volume and weight (Figure 6D,E). Expression levels of USP14 and relative proteins in the EGFR pathways were also examined in the xenograft tumors of mice after different treatments (Figure 6F). The survival rate of mice after different treatments is shown in Figure 6G. The changes in survival may be related to the improved pro-apoptotic effects of DDP after nano-zinc carriers released siUSP14#1 into cells (Figure S3A,B). These results demonstrate that aptamer-siRNA nano-zinc carriers inhibit DDP resistance in vivo.

4.1 Bioinformatics analysis

Gene expression information was gathered from TCGA database for lung cancer, which included 526 cases of tumor tissues and 59 cases of normal lung tissues. The GSEA algorithm was employed to identify pathways that were strongly supplemented in response to higher USP14 expression.

4.2 Clinical samples

Sixty samples with lung cancer for whom the first line drug therapy was DDP were selected from Fudan University Shanghai Cancer Center from July 2020 to October 2021. The samples were categorized into four groups based on the difference in tumor volume following treatment, as follows: (1) complete response group (CR) who had no tumor left, (2) partial response group (PR) who showed tumor shrinkage of > 50%, (3) stable disease group (SD) for whom the tumor shrinkage was < 50% or tumor enlargement was > 25%, and (4) progressive disease (PD) for whom tumor grew by > 25% or more. CR along with PR was identified as chemotherapy sensitive cases, whereas SD and PD were considered chemotherapy-resistant cases. Following informed consent, tissues were collected and frozen in liquid nitrogen until use. All procedures were approved by the Institutional Ethical Committee at Fudan University Shanghai Cancer Center (approval number: 2004216-19-2005). All patients who donated tissues provided informed consent.

4.3 Immunohistochemistry

Primary lung cancer tissues were embedded in paraffin solution and sectioned for IHC analysis. The specimens were stained with an anti-USP14 antibody (ab137433; Abcam) followed by HRP-conjugated anti-IgG antibody (Long Island Biotech, China; D-3004), using the standard protocol. IHC analysis was conducted by two independent pathologists who were blinded to the clinical and pathological features of the cases.

4.4 Cell culture and transfection

The A549 (ATCC, Manassas, VA, USA; CRM-CCL-185), A549 cisplatin-resistant (A549/DDP; National Infrastructure of Cell Line Resource, Beijing, China; 1101HUM-PUMC000519), and human lung bronchial epithelial 16HBE cells (Shanghai Fuheng Biotechnology Co., Ltd. China; FH1013) were cultured in RPMI 1640 medium (Hyclone, Logan, UT, USA) with 10% fetal bovine serum and 1% penicillin/streptomycin (Life Technologies) in an atmosphere of 5% carbon dioxide and 95% air at 37°C.

Lung cancer cells were transfected with USP14 siRNA (siUSP14#1 and siUSP14#2) or nonspecific siRNA (siNC) (all from Shanghai GenePharma Co., Ltd, China) using DharmaFECT one siRNA infection reagent (Thermo Fisher Scientific). The siRNA sequences were: siUSP14#1: GACAGAAAGUUAUGGUGAAAG; siUSP14#2: AGUUCUUAAGGAUGUUAAAUU; siNC: GGACGAGCUGUACAAGUAA. For USP14 overexpression, the coding sequence was synthesized and cloned into pLVX-Puro plasmids (TSPLA16346, Testobio Co., Ltd, Ningbo, China). Recombinant plasmids, along with psPAX2 (#12260) and pMD2.G (#12259) packaging plasmids (all from Addgene Headquarters, Watertown, MA, USA), were co-transfected into 293T cells (ATCC; CRL-3216) by using Lipofectamine 2000 (Thermo Fisher Scientific). At 48 h post-transfection, recombined vectors were used for cell transduction. The empty vector and nonspecific siRNA acted as negative controls.

4.5 Cell counting kit-8 assay

Cell viability was measured using the CCK-8 (SAB Biotech., College Park, MD, USA) assay. Cells were cultured in 96-well plates at 3 × 10³ cells/well for 12 h. Following treatment for 48 h, the CCK-8 reagent was added to each well and incubated for 1 h. Absorption was measured at 450 nm.

4.6 Cell apoptosis assay

Cells were seeded into 6-well plates (5 × 10⁵/well) and grown to 50% confluency. After treatment, cell apoptosis was analyzed by flow cytometry. Cells were incubated with 5 μL fluorescein isothiocyanate-labeled recombinant annexin V (Annexin V-FITC) for 15 min in the dark at 4°C and then incubated with 5 μL PI for 15 min. FACScan flow cytometry (Becton Dickinson, Franklin Lakes, NJ) with CellQuest software (Becton Dickinson) was performed to assess cell apoptosis.

4.7 Co-immunoprecipitation and ubiquitination assay

Cells were lysed with radioimmunoprecipitation assay (RIPA) buffer and incubated with anti-USP14 (ab70311; Abcam), anti-EGFR (ab52894; Abcam), or normal IgG (sc-2027; Santa Cruz Biotechnology, Inc.) antibodies and then incubated with protein A/G PLUS-Agarose beads (sc-2003; Santa Cruz Biotechnology, Inc.) for 2 h at 4°C. The immune complex was washed thrice with lysis buffer. Proteins were then detected with standard Western blot analysis using anti-USP14 (ab175810; Abcam), anti-EGFR (ab32077; Abcam), and anti-ubiquitin (ab7780; Abcam) antibodies.

4.8 Quantitative real-time polymerase chain reaction

Total RNA was isolated from lung cancer tissues and cell lines using Trizol reagent (Invitrogen, USA) following the manufacturer's guidelines and reverse-transcribed with a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher, USA). Quantitative RT-PCR was performed with SYBR green PCR Master Mix (Thermo Fisher) on an ABI7300 system. The forward and reverse primers used for qRT-PCR were as follows: USP14 (5′-AGGTCATTATGTATCATGGGTG-3′ and 5′-ATTTCAACTCTGCGAGGC-3′); EGFR (5′-GAAGAAGACATGGACGACG-3′ and 5′-TGTATTCAGGCACTGGGAG-3′); GAPDH (5′-GGATTGTCTGGCAGTAGCC-3′ and 5′-ATTGTGAAAGGCAGGGAG-3′). The relative abundance of genes was quantified using the comparative 2^−ΔΔCt method with GAPDH as an internal control.

4.9 Western blot

Cells were lysed in RIPA buffer supplemented with fresh protease inhibitor cocktail (Sigma, St. Louis, MO, USA). Proteins were separated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto nitrocellulose membranes (Millipore, Bedford, USA). Membranes were blocked with 5% skim milk and incubated with primary antibodies against USP14 (ab235960; Abcam), p-EGFR (ab182618; Abcam), EGFR (#4267; CST), p-PI3K (ab245781; Abcam), PI3K (ab191606; Abcam), AKT (#4685; CST), p-AKT (#4060; CST), PCNA (ab29; Abcam), cleaved caspase-3 (ab214430; Abcam), and GAPDH (#5174; CST) followed by an HRP-conjugated secondary antibody (A0208; Beyotime, Shanghai, China). Antibody binding was detected with enhanced chemiluminescence (Bio-Rad, Richmond, CA, USA).

4.10 Cell-SELEX

A549/DDP and A549 cells were grown to the logarithmic growth stage. A549/DDP cells were adjusted to 1 × 10⁷ and washed three times with pre-cooled sterile PBS. Sequences for the AM libraries and primers were as follows: Library (5′-GAATTCCAGAGTGACGCAGCA-(45N)-TGGACACGGTGGCTTGAGCTC-3′) (crossed sequences were EcoR I and Sac I restriction sites) and primers (P1: 5′-GaattCCagAGTGACgCAGC-3′; P2: 5′-GAGCTCAAGCCACCGTGTCC-3′). Library DNA (1000 pmol) was dissolved in binding buffer (Duchenne PBS; Sigma–Aldrich, St. Louis, MO), heated to 95°C, immediately placed on ice for 10 min, and incubated with A549/DDP cells at 37°C for 1 h. Cells were washed three times with Duchenne PBS. Then, the ssDNA bound to A549/DDP cells was eluted with elution buffer (0.1 M NaCl solution). NATCH-5 column desalting (GE Healthcare) was used as a template, and primer P1 was used for asymmetric PCR amplification to obtain ssDNA in a new library round. The next round of screening was performed by binding to A549/DDP cells. In the fourth round, A549 cells were used as the reverse screening target. The ssDNA of unbound A549 cells was in the supernatant and was retained as the template, and the ssDNA was amplified by asymmetric PCR with primer P1 as the library for the next round of screening. After 12 rounds of forward screening and 6 rounds of directional screening, the resulting ssDNA was used as a template. Primers P1/P2 were added, and dsDNA was amplified by PCR. After digestion with restriction endonucleases, the dsDNA was inserted into the pUC19 plasmid and introduced into DH5ɑ cells. After overnight culture at 37°C, monoclonal colonies were selected. Extracted plasmids were identified by enzyme digestion. Biotin-labeled ssDNA was amplified by asymmetric PCR using bio-P1 primers and positive cloned plasmids as templates. The bio-ssDNA from the same number of the clone sources was heated at 95°C for 5 min and immediately placed on ice for 10 min after denaturation. The bio-ssDNA was mixed with A549/DDP and A549 cell lines respectively for 1 h, washed three times, and incubated with FITC coupled with avidin for 30 min. After washing three times, the AM binding was detected by flow cytometry. AMs with increased affinity and specificity were screened and their dissociation constants were determined. FITC-labeled AM and unlabeled AM were synthesized according to the sequencing results and detected by flow cytometry and laser confocal microscope.

4.11 Preparation of nano-zinc carrier and its coupling with Aptamers

To prepare the nano-zinc carrier, 36 g sodium hydroxide, 70 mL deionized water, 563 μL EDA, and 34% hydrazine 263 μL were stirred vigorously for 15 min, and 4 mL of 0.1 M copper nitrate was added drop by drop to the solution with intense agitation. The liquid was transferred to a stainless steel autoclave lined with Teflon, and 2 g/L polyethylene pyrrolidone (1300 KD molecular weight) solution was gently added above the liquid level. After sealing, the solution was heated in an electric oven at 80°C for 3 h, and then cooled to room temperature. The solution was centrifuged and the resulting brown-red copper nanoparticles were washed with deionized water and 0.01% hydrazine solution and vacuum dried overnight at 50°C. Nanocopper (6.35 mg), deionized water (6 mL), and ethanol (6 mL) were successively added to a 50 mL flat-bottomed flask. After 15 min of ultrasound, 300 mg polyvinylpyrrolidone with a molecular weight of 24,000 was added to the solution. The solution was stirred vigorously for 15 min, then ZnCl₂ (8 mg) in 0.6 mL aqueous solution was added. After stirring for 10 min, 4 mL (drops/2s) of 1 M Na₂S₂O₃ aqueous solution was added to the mixture. Finally, after stirring for 10 min, the red mixture gradually turned transparent gray. The solid substance was collected by centrifugation and cleansed with acetone and methanol three times. The dry transparent gray solid substance (6 mg, nano-zinc carrier) was dissolved in 15 mL toluene solution. After ultrasonication for 3 h, 15 μL of triethoxysilane was added and the mixture was stirred for 24 h. The solid matter was washed with ethanol, resulting in the aminoated nano-zinc carrier. The aminoated nano-zinc carrier was dispersed in 1 mL of Duchenne PBS. Sulfo- sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (1 mg) was dissolved in 50 μL DMSO, and then mixed with Duchenne PBS and shaken for 1 h. After centrifugation, the aminoated nano-zinc carrier was dispersed in 0.5 mL Duchenne PBS, mixed with 100 μL AM (16 μmol/L), and shaken for 24 h.

4.12 Loading of Aptamers -coupled nano-zinc carrier with USP14 siRNA

The AM-coupled nano-zinc carrier was mixed with 10 μM USP14 siRNA in Duchenne PBS at a weight ratio of 1/1 and incubated for 24 h.

To quantify siRNA loaded in nano-zinc carriers, the nano-zinc carriers loaded with USP14 siRNA at various weight ratios were centrifuged at 10,000 rpm for 15 min and separated on a 2% agarose gel in 0.5 × tris-acetate-EDTA (TAE) buffer at 80 V for 40 min. The gel was stained with ethidium bromide, and siRNA bands were detected at 302 nm using Azure C300 (Dublin, CA, USA) as previously described.⁵⁵ The USP14 siRNA loading efficiency was calculated using the following formula: (band intensity of pellets of nano-zinc carriers loaded with USP14 siRNA complex/band intensity of 10 μM of USP14 siRNA) × 100%.

To evaluate the protection of the USP14 siRNA against RNase A digestion, 5 pmol of free siRNA or nano-zinc carriers loaded with USP14 siRNA complex was incubated with 5 mU RNase A for 2 h at 37°C. The samples were then separated by electrophoresis using a 2% agarose gel as described above.

4.13 Release of siRNA

Nano-zinc carrier equivalent to 10 μM of USP14 siRNA was mixed in 100 μL of deionized water at pH 5.2, pH 6.2, or pH 7.4. The nano-zinc carrier mixes were incubated at 37°C under continuous agitation and the suspension was sampled at selected time intervals, loaded on a 2% agarose gel, and run in 0.5 × TAE buffer at 80 V for 40 min. After staining with ethidium bromide, the siRNA bands were identified at 302 nm using Azure C300 (Dublin, CA, USA). The percent of USP14 siRNA release was calculated using the following formula: (band intensity of released USP14 siRNA/band intensity of 10 μM of USP14 siRNA) × 100%.

4.14 Targeting of the nano-zinc carrier in vivo

Targeting of the nano-zinc carrier to A549/DDP or A549 cells in vivo was detected after subcutaneous injection in a mouse xenograft tumor model. A549/DDP or A549 cells (1 × 10⁶ cells) in 50 μL of PBS were injected into the armpits of 4-week-old nude mice (BALB/c, nu/nu; SIPPR-BK Laboratory Animal Co. Ltd, Shanghai, China) using a 25-gauge needle. After allowing tumors to form for 10 days, 5 mg/kg/d of the nano-zinc carrier-AM-USP14 siRNA complex was introduced via the tail vein for 4 weeks. Cy3-labeled USP14 siRNA fluorescent images were obtained using the Caliper IVIS Lumina III (Perkin Elmer, USA) at 5, 10, and 15 h to verify biodistribution of the nano-zinc carrier-AM-USP14 siRNA complex. Survival of the A549/DDP and A549 cells in vivo was measured using bioluminescence at 0, 1, 2, 3, and 4 weeks to verify the in vivo targeting efficacy of the nano-zinc carrier. An intraperitoneal injection of DDP (50 mg/kg/week) was administered on day 12 post-injection. Tumor volume was calculated every 3 days using the following equation: Volume = (length × width²)/2. After anesthetizing with 3% isoflurane, mice were sacrificed by cervical dislocation on day 39, and the liver, heart, lungs, kidneys, spleen, and xenograft tumors were collected, washed, fixed with 4% paraformaldehyde, and processed to produce paraffin-embedded sections. To evaluate toxicity and apoptosis, sections were stained with hematoxylin and eosin or terminal-deoxynucleoitidyl transferase-mediated nick end labeling (TUNEL; Sigma, Shanghai, China). Another 120 mice were collected for survival analysis for 90 days. All animal procedures were approved by the Animal Care and Use Committee of Shanghai Rat@Mouse Biotech Co., Ltd., China (approval number: 20210318).

4.15 Statistical analysis

All experiments were performed three times and the quantitative data are presented as mean ± standard deviation. GraphPad Prism version 8.4.2 (GraphPad Software, San Diego, CA, USA) was used to compute statistics. Variables were compared using unpaired t-tests or analysis of variance (ANOVA) followed by post hoc analyses using Tukey's post-multiple test. The significance level for the study was fixed at P < 0.05.