Volume 9, Issue 8 e1042
ORIGINAL ARTICLE
Open Access

Insights into the mechanism of cyanobacteria removal by the algicidal fungi Bjerkandera adusta and Trametes versicolor

Guomin Han

Corresponding Author

Guomin Han

School of Life Sciences, Anhui Agricultural University, Hefei, China

National Engineering Laboratory of Crop Stress Resistance Breeding, Anhui Agricultural University, Hefei, China

Correspondence

Guomin Han, School of Life Sciences, Anhui Agricultural University, Hefei 230036, China.

Email: [email protected]

Shihua Zhang, Institute of Applied Mathematics, Anhui Agricultural University, Hefei 230036, China.

Email: [email protected]

Search for more papers by this author
Hui Ma

Hui Ma

Key Laboratory of Rice Genetic Breeding of Anhui Province, Rice Research Institute, Anhui Academy of Agricultural Sciences, Hefei, China

Search for more papers by this author
Shenrong Ren

Shenrong Ren

School of Life Sciences, Anhui Agricultural University, Hefei, China

Search for more papers by this author
Xueyan Gao

Xueyan Gao

School of Life Sciences, Anhui Agricultural University, Hefei, China

Search for more papers by this author
Xiaolong He

Xiaolong He

Institute of Applied Mathematics, Anhui Agricultural University, Hefei, China

Search for more papers by this author
Suwen Zhu

Suwen Zhu

School of Life Sciences, Anhui Agricultural University, Hefei, China

National Engineering Laboratory of Crop Stress Resistance Breeding, Anhui Agricultural University, Hefei, China

Search for more papers by this author
Ruining Deng

Ruining Deng

School of Life Sciences, Anhui Agricultural University, Hefei, China

Search for more papers by this author
Shihua Zhang

Corresponding Author

Shihua Zhang

Institute of Applied Mathematics, Anhui Agricultural University, Hefei, China

Correspondence

Guomin Han, School of Life Sciences, Anhui Agricultural University, Hefei 230036, China.

Email: [email protected]

Shihua Zhang, Institute of Applied Mathematics, Anhui Agricultural University, Hefei 230036, China.

Email: [email protected]

Search for more papers by this author
Guomin Han and Hui Ma authors contributed equally to this work

Graphical Abstract

Algicidal process of fungus Bjerkandera adusta T1 was investigated by a time-course transcriptomic analysis. The results showed that most differentially expressed genes exhibited high endopeptidase activity, cellulose catabolic process, and transmembrane transporter activity. Comparison of gene expression between B. adusta T1 and Trametes versicolor F21a during the algicidal process suggested that endopeptidases together with enzymes of the polysaccharide lyases family 8 might be responsible for the strong algicidal activity of B. adusta T1 as well as T. versicolor F21a.

Abstract

Fungal mycelia can eliminate almost all cocultured cyanobacterial cells within a short time. However, molecular mechanisms of algicidal fungi are poorly understood. In this study, a time-course transcriptomic analysis of algicidal fungus Bjerkandera adusta T1 was applied to investigate gene expression and regulation. A total of 132, 300, 422, and 823 differentially expressed genes (DEGs) were identified at 6, 12, 24, and 48 hr, respectively. Most DEGs exhibited high endopeptidase activity, cellulose catabolic process, and transmembrane transporter activity by using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses. Many decomposition genes encoding endopeptidases were induced a little later in B. adusta T1 when compared with previously investigated algicidal fungus Trametes versicolor F21a. Besides, the accumulated expression of Polysaccharide lyases8 (PL8) gene with peptidoglycan and alginate decomposition abilities was greatly delayed in B. adusta T1 relative to T. versicolor F21a. It was implied that endopeptidases and enzymes of PL8 might be responsible for the strong algicidal ability of B. adusta T1 as well as T. versicolor F21a.

1 INTRODUCTION

The occurrence of algal blooms or cyanobacterial blooms not only leads to the asphyxiation of aquatic fauna, but also releases highly toxic compounds, including microcystins, threatening the health of human beings and other organisms (Dai et al., 2018; Sun, Sun, Zhang, Esquivel-Elizondo, & Wu, 2018). Biological methods are known to be simple and efficient to control algal blooms, with less pollution compared with the physical and chemical methods (Hou et al., 2019; Yu et al., 2019; Zhang et al., 2018). In addition to the inhibition of cyanobacterial growth, algicidal bacteria and viruses can affect the water clarity and aquatic ecosystem (Wang et al., 2010). Recently, a new method for the removal of cyanobacteria by fungi was reported (Jia et al., 2010). Further, it has been reported that the mycelia of fungus Trichaptumabietinum 1302BG could enclose and eliminate almost all cocultivated cyanobacterial cells within a short time (Jia et al., 2010), and the color of cyanobacterial medium turned transparent (Han et al., 2011). Other fungi, such as Trametes versicolor F21a, Bjerkandera adusta T1, Lophariaspadicea, Phanerochaete chrysosporium, Trichoderma citrinoviride, and Irpexlacteus T2b have been reported to exhibit algicidal ability (Han et al., 2011; Shu et al., 2016; Wang et al., 2010; Zeng, Wang, & Wang, 2015; Zeng et al., 2019). Among these, T. versicolor F21a and B. adusta T1 were considered as the two best algicidal fungi (Dai et al., 2018; Han et al., 2011; Zeng et al., 2015, 2019).

Previous studies have reported that both living and dead cyanobacterial cells first adhere to fungal mycelia before being eliminated by surrounding mycelia (Dai et al., 2018; Jia et al., 2010). It has been further demonstrated that the membranes of cyanobacterial cells and the pyrrole ring of chlorophyll a were extensively disrupted by mycelia of P. chrysosporium (Zeng et al., 2015). Transcriptomic and proteomic analyses of the algicidal mechanism of T. versicolor F21a showed that several biological processes, such as glucan 1,4-α-glucosidase activity, hydrolase activity, lipase activity, and endopeptidase activity, and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, including glycolysis/gluconeogenesis, pyruvate metabolism, starch and sucrose metabolism, and amino acids biosynthesis, are involved in the elimination cyanobacterial cells (Dai et al., 2018; Gao et al., 2017). The expression of all Carbohydrate-Active enZYmes (CAZyme) genes significantly increased during the algicidal process in T. versicolor F21a (Dai et al., 2018; Gao et al., 2017). Several members of CAZyme, such as AA5, GH18, GH5, GH79, GH128, and PL8, might play key roles in the decomposition of cyanobacterial cells at different eliminating stages (Dai et al., 2018). Although the underlying molecular mechanism of algicidal fungus T. versicolor F21a was elucidated, there are no reports on the mechanism of other efficient algicidal fungi.

B. adusta is a widely distributed “white rot” fungus, which has been often associated with the decomposition of hardwoods (Moody, Dudley, Hiscox, Boddy, & Eastwood, 2018). The components of wood cell walls, such as cellulose, hemicellulose, and recalcitrant lignin, can be degraded by this fungus (Moody et al., 2018). Besides, this fungus has been reported to decompose a wide range of environmental pollutants (Bouacem et al., 2018; Han et al., 2011; Sugawara, Igeta, Amano, Hyuga, & Sugano, 2019). In our previous study, B. adusta T1 was found to be one of the best algicidal fungi (Han et al., 2011). In this study, gene expression in the mycelia of B. adusta T1, cocultivated with and without cyanobacterial cells during the algicidal process, was compared by a time-serial transcriptomic analysis. Differentially expressed genes (DEGs) were used to identify key decomposition gene(s) and pathway(s) in B. adusta T1, and the results were compared with that of T. versicolor F21a reported in a previous study (Dai et al., 2018).

2 MATERIALS AND METHODS

2.1 Fungal and algal strains

The previously isolated fungus B. adusta T1 from Zijinshan Mountain was used in this study (Han et al., 2011). Cyanobacterial strain (Microcystis aeruginosa PCC7806) was provided by the Institute of Hydrobiology of the Chinese Academy of Sciences (Wuhan, China).

2.2 Cocultivation of fungal mycelia and cyanobacterial cells

The cyanobacterial strain was cultivated at 25°C under 12-hr light and 12-hr dark cycles with ~90 μmol/m2 s-1 of photons in BG-11 medium (Jia et al., 2010). Round fungal mycelium (seven mm in diameter) was inoculated onto a nine-cm plate, containing 15 ml of potato liquid medium, and incubated under static conditions for five days. Then, fungal mycelia were taken and transferred into 250-mL Erlenmeyer flasks containing 100 ml of algal solution or medium. The cocultures were incubated at 25°C, 90 μmol photons/m2 s-1, and 120 rpm to investigate differentially expressed fungal genes. Total chlorophyll a was measured according to the Standard Methods for the Examination of Water and Wastewater (Standard Methods for the Examination of Water & Wastewater, 1998).

2.3 RNA isolation and sequencing

Mycelia of B. adusta T1 were collected from cocultures after 6, 12, 24, and 48 hr of incubation. Two biological replicates of each treatment were used for RNA sequencing. Total RNA was extracted from each sample with TRIzol reagent following the manufacturer's instructions (Takara, Dalian, China). Then, crude RNA was digested via 10 U DNase I (TaKaRa, Japan) at 37°C for 30 min, and then, mRNA was isolated using Dynabeads® Oligo (dT) 25 (Life, America) following the manufacturer's instructions. One hundred ng mRNA of each sample was used to construct a sequencing library using NEBNext® UltraTM RNA Library Prep Kit (NEB, America). Paired-end sequencing of cDNA fragments (~300 bp) was performed using Illumina HiSeq 4,000 platform at BGI-Shenzhen, China.

2.4 Transcriptomic analysis

In this study, RNA-Seq data of B. adusta T1 at 6, 12, 24, and 48 hr were analyzed. The quality of 150-bp reads was assessed using the FASTQC program (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). The paired-end raw reads from RNA sequencing were trimmed using the pipeline Trimmomatic (v0.33) with parameters (LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 HEADCROP:12 MINLEN:36) (Bolger, Lohse, & Usadel, 2014). The clean reads were mapped to the B. adusta genome (v1.0) using STAR software (v2.5.3a) (Binder et al., 2013; Dobin et al., 2013). Expression value in FPKM (fragments per kilobase of exon model per million reads mapped) and DEGs were calculated via Cuffdiff (v2.2.1) using default parameters (p < .05, a fold change ≥ 2) (Si et al., 2019; Trapnell et al., 2012). Gene function was annotated using BLAST against reference protein-encoding sequences from the Nr database of GenBank, Gene Ontology (GO), and KEGG (Ashburner et al., 2000; Kanehisa, Furumichi, Tanabe, Sato, & Morishima, 2017; Kanehisa & Goto, 2000; Kanehisa, Sato, Kawashima, Furumichi, & Tanabe, 2016). Fisher's exact test was used to obtain enriched functional terms at p < .05.

2.5 CAZyme and Secretome Annotation

All putative protein sequences of B. adusta were annotated with hmmscan against dbCAN database (Cantarel et al., 2009; Johnson, Eddy, & Portugaly, 2010; Yin et al., 2012) and further classified according to mycoCLAP database (Strasser et al., 2015). Signal information of the proteins was predicted by Target P 1.1 Server (Emanuelsson, Brunak, von Heijne, & Nielsen, 2007).

2.6 Quantitative PCR (qPCR) validation

qPCR was used to validate the gene expression calculated from RNA-Seq data. A few randomly selected lignocellulose-active enzyme genes were used in this study, and the β-actin gene of B. adusta T1 was used as the endogenous control. The 20 μl reaction mixture consisted of 10 μl SYBR® Fast qPCR Mix (2x), 0.5 μl of each primer (10 μmolL−1), and 120–150 ng cDNA (Table A1). The qRT-PCR program was set as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 15 s, 60°C for 20 s, and 72°C for 30 s. Relative expression levels were calculated using 2−ΔΔCT method (Livak & Schmittgen, 2001). Three biological replicates were used for qRT-PCR.

3 RESULTS

3.1 Elimination rate during the algicidal process

The algicidal process of B. adusta T1 was monitored via spectrophotometer. As shown in Figure 1, the chlorophyll a content gradually decreased with the increase in incubation time. Approximately 86% of cyanobacterial cells were eliminated within 48 hr. The cyanobacterial cells were almost disappeared in the flask cocultivated with living fungal mycelia while the cyanobacterial cells were almost not affected by dead fungal mycelia compared with the blank control (Figure 1).

Details are in the caption following the image
Changes in the algicidal process of B. adusta T1. Note: (a) Images of cocultivation after 48 hr; CK, the cyanobacterial cells as control;T1, the cocultivation of cyanobacterial cells and B. adusta T1 mycelia; S-T1, the cocultivation of cyanobacterial cells and died fungal mycelia. (b) Changes in chlorophyll a content during the algicidal process

3.2 RNA-Seq data generation and mapping

Mycelia of B. adusta T1 that was cocultivated with cyanobacterial cells at 6, 12, 24, and 48 hr were used for RNA sequencing. Fungal mycelia without cyanobacterial cells at the same time point were used as a control. Good quality RNA was isolated and used for RNA sequencing (Figure A1). A total of 63,437,015 pairs of raw reads (SRA accession: PRJNA543936) were generated (Table A2). Approximately 96% of reads were retained after the removal of adaptor and low-quality bases (Table A2). More than 64% of reads were uniquely mapped to the reference genome by pipeline STAR (Table A2), suggesting that the results of mapping can be used for the identification of fungal DEGs.

3.3 Identification of fungal DEGs involved in the algicidal process

Boxplot of FPKM values across all samples showed the consistency of biological replicates of each treatment (Figure A2). Multi-dimensional scaling (MDS) showed that the gene expression in mycelia cocultured with cyanobacterial cells was distinctly separated from that of mycelia without cyanobacterial cells (Figure 2). The difference became highly apparent with the increase in cocultivation time (Figure 2). A total of 132, 300, 422, and 823 fungal DEGs were identified at 6, 12, 24, and 48 hr in the mycelia cocultivated with cyanobacterial cells compared with the control, respectively (Figure 3). The expression of six randomly selected lignocellulose-active enzyme genes, that is, a gene of esterase family, two genes of hydrolase family, a gene of hydrolase family 5, a radical oxidase encoding gene, a gene of hydrolase family 128, and a gene of hydrolase family 13, were further investigated via qRT-PCR (Table A1). Similar expression patterns were observed between qRT-PCR and transcriptomic analysis (Figure A3), indicating that DEGs identified by the transcriptomic analysis were suitable for further analyses.

Details are in the caption following the image
Multi-dimensional scaling of gene expression data. Note: 6h_ck, control sample at 6h; 6h_T, treatment sample at 6 hr; 12h_ck, control sample at 12 hr; 12h_T, treatment sample at 12 hr; 24h_ck, control sample at 24 hr; 24h_T, treatment sample at 24 hr; 48h_ck, control sample at 48 hr; 48h_T, treatment sample at 48 hr
Details are in the caption following the image
Number of fungal DEGs during the algicidal process of B. adusta T1

3.4 Annotation and enrichment analyses of fungal DEGs

After the comparison of candidate genes with Nr from NCBI, GO, and KEGG databases, DEGs were used to obtain enriched terms by Fisher's exact test (p < .05). The GO terms of DEGs were enriched in the extracellular region, cell wall, signal recognition particle, proteasome core complex, prefold in complex, ribosome, and other cellular components categories (Figure 4). Similarly, DEGs were found to be enriched on transport and catabolic processes in the biological process category, particularly cellulose catabolism and carbohydrate transport (Figure 5). Further, DEGs were enriched on decomposition and transporter activities in the molecular function category that included the activities of triglyceride lipase, serine-type peptidase, manganese peroxidase, carboxypeptidase, cellulose 1,4-β-cellobiosidase, β-glucosidase, aspartic-type endopeptidase, α-amylase, glycolipid transporter, amino acid transmembrane transporter, and other (Figure 6). The KEGG analysis showed that DEGs were enriched on glycerolipid metabolism, starch and sucrose metabolism, metabolism of xenobiotics by cytochrome P450, galactose metabolism, and ascorbate and aldarate metabolism in different stages of the algicidal process (Figure 7).

Details are in the caption following the image
GO term enrichment of fungal DEGs in the cellular component category
Details are in the caption following the image
GO term enrichments of fungal DEGs in the biological process category
Details are in the caption following the image
GO term enrichments of fungal DEGs in the molecular function category
Details are in the caption following the image
KEGG term enrichments of fungal DEGs during the algicidal process

3.5 Composition and expression of CAZyme genes of B. adusta T1 and its comparison with that of T. versicolor F21a

A total of401 CAZyme genes were identified in the genome of B. adusta by hmmscan against the dbCAN database (Table 1). The lignocellulose-active genes can be divided into 77 CAZyme modules (Table 1). Most of the genes belonged to Glycoside Hydrolases (GH) family and Auxiliary Activities (AA) family. About 312 CAZyme genes were identified in the genome of T. versicolor F21a (Dai et al., 2018). The number of CAZyme genes in B. adusta T1 genome (401 CAZyme genes) was higher than that of T. versicolor F21a (312 CAZyme genes). Seventy CAZyme modules were detected in B. adusta T1, compared to 43 CAZyme modules in T. versicolor F21a in the previous study (Dai et al., 2018). However, the algicidal effects of T. versicolor F21a were slightly more efficient than that of B. adusta T1 (Han et al., 2011).

TABLE 1. The number of decomposition enzymes detected by RNA-Seq
Enzyme classes CAZyme module No. of decomposition enzymes in the genome No. of decomposition enzymes detected by RNA-Seq No. of decomposition enzymes in DEGs by RNA-Seq
Auxiliary activities AA1 1 1  
AA2 21 19 10
AA3 38 30 12
AA4 1    
AA5 7 8 6
AA6 5 4 3
AA7 10 6 3
AA8 2 2  
AA9 27 20 7
Carbohydrate esterases CE1 18 11 3
CE10 42 31 6
CE12 3 2  
CE14 1 1  
CE15 2 2  
CE16 14 6 3
CE2 1 1  
CE3 1 1  
CE4 5 3 3
CE8 2 2 1
CE9 1    
GH1 2 2 1
Glycoside hydrolases GH10 4 5 4
GH105 3 3 1
GH109 8 8 5
GH115 2 2 1
GH12 2 1  
GH125 1 1  
GH127 1 1  
GH128 5 3 2
GH13 9 9 6
GH131 3    
GH15 2 2  
GH16 19 17 5
GH17 1 1  
GH18 13 10 3
GH2 3 2 2
GH20 4 2  
GH23 1    
GH24 1 1  
GH25 1 1  
GH27 3 3 1
GH28 6 4  
GH3 8 8 4
GH30 1 1 1
GH31 4 5 3
GH35 4 4  
GH37 2 1 1
GH38 1    
GH43 6 6 4
GH47 6 3  
GH5 20 16 8
GH51 2 2 1
GH53 1 1  
GH55 3 3 1
GH6 1 1 1
GH63 2 1  
GH7 5 4 1
GH71 3 3 1
GH72 1 1  
GH74 3 3  
GH76 2 1  
GH78 2 2  
GH79 7 9 6
GH85 1 1  
GH88 1 1  
GH89 1 1  
GH9 1 1  
GH92 3 3 1
GH95 1 1  
GH99 1    
Polysaccharide lyases PL1 1 1  
PL12 1 1  
PL14 5 6 5
PL3 2 2  
PL4 1    
PL5 1 2 2
PL8 1 1  
  Total 401 324 128

The identified 128 differentially expressed CAZyme genes in B. adusta T1 were found to belong to 37 modules (Table 1). The genes within the same module exhibited diverse expression profiles during the algicidal process of B. adusta T1 (Figure 8). It was observed that module GH128, AA7, AA6, and GH109 had the highest accumulated expression during the algicidal process. The sublocation analysis showed that ~ 61% (245/401) of lignocellulose-active proteins contained secretory pathway signal peptides that can be secreted outside of fungal mycelia (Table A3). Genes within GH128 that encoded endo-1,3-β-glucanase (EC3.2.1.39) could decompose xyloglucans and β-1,3-glucans into xylose and glucose, respectively. The enzymes of GH128, AA7, AA6, and GH109 were less efficient in cyanobacterial cell disruption. It is noteworthy that the accumulated expression of Polysaccharide lyases genes, particularly the PL8 module was highly up-regulated during the later stage of the algicidal process of B. adusta T1, which was much delayed when compared to T. versicolor F21a (Dai et al., 2018).

Details are in the caption following the image
Total expression levels of each CAZyme module during the algicidal process

3.6 Expression of other decomposition genes in B. adusta T1 and their comparison with that of T. versicolor F21a

Only a few serine-type peptidase, carboxypeptidase, and aspartic-type endopeptidase, with strong ability in cyanobacterial cells disruption, were enriched in the DEGs list during the early stage of the algicidal process (6 hr) (Figure 6). However, no strong decomposition enzyme was enriched during the later stage of the algicidal process until 24 hr (Figure 6). During the later stage (24 hr), proteins with aspartic-type endopeptidase activity and manganese peroxidase activity were the main decomposition enzymes (Figure 6). Various types of decomposition enzymes, such as threonine-type endopeptidase and serine-type endopeptidase, were induced after 48 hr of cocultivation. In this study, proteases with Protein ID jgi|Bjead1_1|36244|fgenesh1_kg.4_#_443_#_Locus8459v1_medCvg1568.9s and jgi|Bjead1_1|342083|CE153752_10262, and jgi|Bjead1_1|110676|e_gw1.8.836.1 were observed to be the main degradation genes that might be involved in cyanobacterial cells disruption (Figure 9). Thus, these proteases can play significant roles in the algicidal process. The decomposition genes showed delayed expression compared with that of T. versicolor F21a.

Details are in the caption following the image
Time-course change of protease genes expression level of T1 cocultivation with cyanobacteria. Note: 6h_ck, control sample at 6h; 6h_T, treatment sample at 6 hr; 12h_ck, control sample at 12 hr; 12h_T, treatment sample at 12 hr; 24h_ck, control sample at 24 hr; 24h_T, treatment sample at 24 hr; 48h_ck, control sample at 48 hr; 48h_T, treatment sample at 48 hr

4 DISCUSSION

Although several fungi showed a strong algicidal activity (Han et al., 2011), the underlying molecular mechanisms for algicidal capacities are largely less investigated. Interestingly, a few fungi from the Polyporales order of Basidiomycota exhibited a strong algicidal activity (Han et al., 2011). Comparative genome analyses found that the genomes of white rot fungi contain more genes encoding plant cell wall degrading enzymes than that of brown rot and mycorrhizal fungi (Kohler et al., 2015; Tisserant et al., 2013). White rot fungi including the order Polyporales can degrade lignin as well as cellulose (Kohler et al., 2015). In the present study, we observed that the number of CAZyme genes and expressed CAZyme genes of B. adusta T1 was great than that of T. versicolor F21a. However, the algicidal effects of B. adusta T1 were slightly less efficient than that of T. versicolor F21a (Han et al., 2011). More genome sequences of fungi with diverse algicidal abilities are available now, and we also compared the number of CAZyme genes in the genome of different algicidal fungi. No direct correlation was found between algicidal efficiency and several CAZyme genes (Data not shown). A similar result was observed in the study of Pilgaard et al., 2019. This suggested that the high efficiencies of algicidal fungi are not attributed to the number of genes encoding CAZyme in the fungal genome. High lignocellulose degradation ability of white rot fungi, in comparison with that of brown rot fungi and mycorrhizal fungi, can be attributed to the number of genes encoding plant cell wall degrading enzymes in fungal genomes as a result of long term natural selection (Kohler et al., 2015). The numbers of CAZyme genes were not directly correlated with algicidal abilities, which might be due to the fact that most algicidal fungi were isolated from terrestrial environments and lacked evolution selection pressure in the water system (Han et al., 2011).

Direct contact between fungal mycelia and cyanobacterial cells was required for eliminating cyanobacterial cells by fungi (Han et al., 2011; Jia et al., 2010). Previous studies showed that a few decomposition enzymes might play important roles in eliminating cyanobacterial cells by T. versicolor F21a. In particular, cellulase, β-glucanase, and protease were supposed to efficiently disrupt cyanobacterial cells by T. versicolor F21a (Dai et al., 2018; Gao et al., 2017). In the present study, a large number of decomposition enzymes belonging to 37 modules were observed during the algicidal process of B. adusta T1. Among them, GH128, AA7, AA6, and GH109 were the highest accumulated expression module. However, the enzymes of GH128, AA7, AA6, and GH109 were not able to efficiently disrupt the macromolecules (Ekstrom, Taujale, McGinn, & Yin, 2014; Yin et al., 2012), such as cellulose in the cell wall of cyanobacterial cells. This suggested that lignocellulose-active proteins of B. adusta T1 might not be the key enzymes for the breakdown of cyanobacterial cells.

Previous studies showed that chondroitin ABC lyase (EC4.2.2.1) of PL8 and alginate lyase (EC4.2.2.3) of PL14 were able to decompose peptidoglycan and alginate (Lombard, Golaconda Ramulu, Drula, Coutinho, & Henrissat, 2014), and the expression level was also significantly up-regulated during the algicidal process of T. versicolor F21a (Dai et al., 2018; Gao et al., 2017). Chondroitin AC lyase (chondroitin sulfate) and alginate lyase were unique to a known saprophytic marine fungus Paradendryphiella salina in the breakdown of dried brown algae in the medium compared with its terrestrial counterparts (Pilgaard et al., 2019). Recombinant expression of Chondroitin AC lyase of the marine fungus P.salina reveals that alginate lyase can degrade several types of brown algae polysaccharides (Pilgaard et al., 2019). A putative PL8 of P.salina with a similar sequence should also decompose brown macroalgae (Pilgaard et al., 2019). Proteomic analysis of the secretome of P. salina grown on three species of brown algae and under carbon limitation implied that the basic CAZyme repertoire of saprobic fungi belongs to ascomycetes, with the addition of PL7 alginate lyases, provide P. salina with sufficient enzymatic capabilities to degrade several types of brown algae polysaccharides (Pilgaard et al., 2019). In the present study, the total expression level of PL14 was down-regulated during the algicidal process of B. adusta T1, while no gene, belonging to PL7, was detected in the genome of B. adusta. The accumulated expression level of PL8 was highly up-regulated in the later stage of the algicidal process of B. adusta T1, which was much delayed when compared with T. versicolor F21a (Dai et al., 2018). All the evidence indicated that enzymes of PL8 with strong peptidoglycan and alginate decomposition abilities might be a vital genetic factor for the determination of the algicidal ability of T. versicolor F21a as well as B. adusta T1.

Analysis of the enriched GO terms and KEGG pathways showed that several types of peptidases were enriched during the algicidal process of B. adusta T1. In particular, proteases (protein ID jgi|Bjead1_1|36244|fgenesh1_kg.4_#_443_#_Locus8459v1_medCvg1568.9s, jgi|Bjead1_1|342083|CE153752_10262, and jgi|Bjead1_1|110676|e_gw1.8.836.1) were highly up-regulated during the later stages of cocultivation. Proteomic analysis of P. salina also implied that the PL7 and PL8 enzymes, abundantly secreted together with enzymes of P.salina, were necessary for degradation of laminarin, cellulose, lipids, and peptides of brown algae (Pilgaard et al., 2019). Different types of peptides were detected in P. salina grown on three species of brown algae (Pilgaard et al., 2019). Additionally, several fungal proteins belonging to peptidase were also up-regulated during the algicidal process of T. versicolor F21a (Gao et al., 2017). Besides, four homologous decomposition enzymes of other species with endo-glycosidase and endopeptidase activities were selected to investigate their effects on cyanobacterial cells, and one type of protease was found to effectively disrupt cyanobacterial cells (Dai et al., 2018). Comparison of the gene expression during the algicidal process of B. adusta T1 and T. versicolor F21a demonstrated that majority of decomposition genes with endopeptidase and endo-glycosidase activities in B. adusta T1 were expressed in the later stage of cocultivation, while the similar genes in T. versicolor F21a were induced in the early stage (Dai et al., 2018). Thus, protease together with enzymes of PL8 might play a key role in the elimination of cyanobacterial cells both by B. adusta T1 and T. versicolor F21a. The expression of enzymes of PL8 and peptidases in B. adusta T1 was little delayed compared with that of T. versicolor F21a, which should be the reason why the algicidal efficiency of T. versicolor F21a is better than that of B. adusta T1.

The production of microcystins (MC) by cyanobacterial blooms often severely threatens human and ecosystems health (Li, Li, & Li, 2017). Biodegradation is an efficient and sustainable biological strategy for MC removal (Li et al., 2017). A large number of bacteria and several fungi were reported with MC removal or degrading capabilities (Dziga, Wasylewski, Wladyka, Nybom, & Meriluoto, 2013; Jia, Du, Song, Zhao, & Tian, 2012; Li et al., 2017; Mohamed, Hashem, & Alamri, 2014; Qin et al., 2019). Four mlr genes (i.e., mlrC, A, D, and B) located sequentially in a gene cluster in the genome of Sphingomonas sp. ACM-3962 strain were identified for MC biodegradation (Bourne et al., 1996; Bourne, Riddles, Jones, Smith, & Blakeley, 2001). The enzymatic pathway involves at least three intracellular enzymes and two intermediate products (Li et al., 2017). Heterologous expression of the mlrA gene originated from Novosphingobium sp. THN1 showed that the recombinant MlrA hydrolyzed microcystin-RR into a linear intermediate product by cleaving the peptide bond between Adda and arginine residue, which is also the first step involved in MC degradation pathway (Wang et al., 2017). Site-directed mutants of MlrA suggested that MlrA is likely not a metalloprotease but a glutamate protease belonging to type II CAAX prenyl endopeptidases (Xu et al., 2019). A few fungi, for example, T. abietinum 1302BG, T.citrinoviride, and Mucor hiemalis were reported with MC removal or degrading capability (Esterhuizen-Londt, Hertel, & Pflugmacher, 2017; Jia et al., 2012; Mohamed et al., 2014; Stephan, 2015); however, the enzymatic pathway was poorly understood compared with that of bacteria. In our study, many genes with endopeptidase activities were enriched during the algicidal process, and a gene encoding aflatoxin-detoxifizyme with peptidase activity (Protein ID: jgi|Bjead1_1|37717|fgenesh1_kg.7_#_39_#_Locus4370v1_medCvg2101.1s) was up-regulated during the algicidal process of B. adusta T1. Further mining the gene expression during the algicidal process of T. versicolor F21a identified a homolog gene (Protein ID: jgi|Trave1|56726|estExt_fgenesh1_pm.C_3_t10209) that was slightly up-regulated in the later stage. In consideration bacterial MlrA encoding a protease, fungal aflatoxin-detoxifizyme could be a possible candidate enzyme involving in MC degradation. In order to investigate the mechanism for MC degradation in fungi, there is more work need to be done.

5 CONCLUSIONS

In this study, the algicidal process of B. adusta T1 was investigated by a time-serial transcriptomic analysis, and the results were compared with these from T. versicolor F21a, reported in our previous study. The identified DEGs were enriched in endopeptidase activity, cellulose catabolic process, and transmembrane transporter activity. Endopeptidases together with enzymes of PL8 might play a key role in the elimination of cyanobacterial cells by both algicidal fungi, B. adusta T1 and T. versicolor F21a.

ACKNOWLEDGMENTS

This study was financially supported by the National Natural Science Foundation of China (Project Nos. 31601289, 31470465, and 51309003).

    CONFLICTS OF INTEREST

    None declared.

    AUTHOR CONTRIBUTION

    Guomin Han: Conceptualization (equal); Software (lead); Writing-original draft (equal). Hui Ma: Investigation (equal). Shenrong Ren: Investigation (supporting). Xueyan Gao: Investigation (supporting). Xiaolong He: Investigation (supporting). Suwen Zhu: Resources (equal); Validation (supporting). Ruining Deng: Validation (supporting). Shihua Zhang: Conceptualization (equal); Writing-review & editing (equal).

    ETHICS STATEMENT

    None required.

    APPENDIX 1

    TABLE A1. Primers used in this study
    Protein ID Annotation Primer
    jgi|Bjead1_1|459664|MIX10988_17319_14 Radical oxidase GTCGAAGCGGGTGGTCTTAA
    CCTCTCCTCGTTGCCGTTT
    jgi|Bjead1_1|34143|fgenesh1_kg.1_#_945_#_Locus732v1_medCvg1115.6s Esterase family 1 protein CCTCCCTGCAAACATCTCACA
    GGAGACGTGTCGGGAAAGAG
    jgi|Bjead1_1|172436|gm1.8875_g Hydrolase family 5 protein TACGAGGGCGACGATTGG
    CTCACCGGACACGTAAACCA
    jgi|Bjead1_1|35099|fgenesh1_kg.2_#_711_#_Locus118v3_medCvg9284.2s Hydrolase family 5 protein CTCGTTGACCCGCACAACTT
    GGGAATATCGTGAGGCTCGTT
    jgi|Bjead1_1|355947|CE167616_517 Hydrolase family 128 protein AGCGCGGTGTGTCATACAAC
    TGTGTCCGGCATCGGTATT
    jgi|Bjead1_1|38229|fgenesh1_kg.7_#_551_#_Locus8080v1_medCvg1578.8s Hydrolase family 13 protein CACGCCCGACTATTCGAAGT
    GTCGGGTTTTCCGTGTCAAG
    TABLE A2. Statistics of RNA-Seq reads mapping results
    Sample Raw reads Number of input reads Cleaned length Uniquely mapped reads number Uniquely mapped reads (%)
    6h_ck1 3,713,910 3,531,468 129.69 2,491,981 70.57
    6h_ck2 3,618,291 3,416,852 129.055 2,205,290 64.54
    6h_T1 3,644,390 3,577,152 128.745 2,802,466 78.34
    6h_T2 4,379,858 4,280,639 128.835 3,282,569 76.68
    12h_ck1 3,832,620 3,691,873 129.505 2,706,111 73.30
    12h_ck2 3,806,801 3,651,869 129.09 2,603,461 71.29
    12h_T1 3,493,777 3,325,461 125.865 2,458,201 73.92
    12h_T2 4,020,571 3,899,676 128.9 2,967,516 76.10
    24h_ck1 3,609,635 3,388,118 128.875 2,326,955 68.68
    24h_ck2 3,684,973 3,497,767 129.655 2,466,212 70.51
    24h_T1 4,831,627 4,684,474 128.62 3,554,342 75.87
    24h_T2 4,567,295 4,436,833 128.9 3,395,508 76.53
    48h_ck1 3,638,776 3,456,573 129.255 2,500,095 72.33
    48h_ck2 3,594,592 3,405,731 128.51 2,473,909 72.64
    48h_T1 4,499,718 4,347,471 128.275 3,264,957 75.10
    48h_T2 4,500,181 4,353,762 128.58 3,277,084 75.27

    Note

    • The number of reads were expressed in pairs.
    TABLE A3. Sublocation of CAZyme proteins of B. adusta
    Protein ID Len mTP SP Other Loc RC
    39948 1,041 0.095 0.093 0.844 _ 2
    170203 646 0.083 0.105 0.872 _ 2
    229483 319 0.049 0.917 0.053 S 1
    113359 295 0.045 0.95 0.032 S 1
    40021 320 0.081 0.908 0.028 S 1
    40040 465 0.053 0.942 0.029 S 1
    230253 1,024 0.014 0.966 0.07 S 1
    230354 1,005 0.342 0.705 0.024 S 4
    183239 385 0.671 0.027 0.355 M 4
    62585 305 0.147 0.104 0.761 _ 2
    113961 604 0.534 0.055 0.439 M 5
    452849 310 0.077 0.037 0.944 _ 1
    170455 322 0.091 0.068 0.894 _ 1
    237378 316 0.042 0.949 0.058 S 1
    40461 244 0.054 0.954 0.043 S 1
    183509 612 0.558 0.024 0.588 _ 5
    240122 301 0.092 0.873 0.031 S 2
    40615 587 0.037 0.159 0.919 _ 2
    241975 605 0.068 0.073 0.901 _ 1
    52811 537 0.063 0.913 0.03 S 1
    40743 377 0.103 0.892 0.017 S 2
    170929 704 0.088 0.048 0.937 _ 1
    170934 551 0.063 0.897 0.086 S 1
    244200 674 0.027 0.93 0.065 S 1
    244246 669 0.018 0.971 0.054 S 1
    62986 499 0.058 0.906 0.041 S 1
    71431 617 0.491 0.658 0.014 S 5
    245049 604 0.442 0.655 0.01 S 4
    40812 611 0.087 0.044 0.906 _ 1
    245297 598 0.061 0.81 0.11 S 2
    171002 606 0.196 0.68 0.028 S 3
    84503 373 0.101 0.05 0.922 _ 1
    171059 593 0.14 0.872 0.019 S 2
    156054 596 0.044 0.887 0.074 S 1
    114954 574 0.084 0.115 0.897 _ 2
    40886 614 0.079 0.052 0.904 _ 1
    136631 614 0.123 0.045 0.86 _ 2
    114902 593 0.423 0.556 0.029 S 5
    52983 613 0.052 0.044 0.95 _ 1
    52991 597 0.044 0.914 0.052 S 1
    183896 599 0.014 0.93 0.089 S 1
    53087 1,011 0.036 0.969 0.05 S 1
    41108 696 0.159 0.081 0.841 _ 2
    41113 573 0.093 0.207 0.634 _ 3
    171368 478 0.069 0.079 0.9 _ 1
    41241 396 0.274 0.84 0.018 S 3
    454703 402 0.63 0.021 0.452 M 5
    41251 337 0.075 0.736 0.21 S 3
    41305 371 0.11 0.094 0.754 _ 2
    41306 538 0.094 0.099 0.816 _ 2
    256509 423 0.468 0.891 0.004 S 3
    184224 600 0.103 0.101 0.838 _ 2
    41490 303 0.052 0.147 0.93 _ 2
    260893 199 0.086 0.089 0.914 _ 1
    184394 582 0.803 0.053 0.115 M 2
    157149 768 0.029 0.956 0.036 S 1
    41596 266 0.069 0.929 0.046 S 1
    171769 774 0.021 0.96 0.057 S 1
    261859 808 0.085 0.06 0.922 _ 1
    116111 281 0.069 0.143 0.873 _ 2
    263236 400 0.054 0.958 0.066 S 1
    29758 400 0.043 0.995 0.011 S 1
    263252 398 0.053 0.98 0.022 S 1
    41686 427 0.307 0.369 0.337 S 5
    41708 649 0.18 0.862 0.014 S 2
    41754 647 0.053 0.182 0.858 _ 2
    41763 404 0.094 0.768 0.13 S 2
    53682 693 0.255 0.759 0.029 S 3
    41854 517 0.021 0.968 0.058 S 1
    41863 491 0.11 0.913 0.016 S 1
    41869 336 0.222 0.908 0.016 S 2
    41896 447 0.713 0.025 0.412 M 4
    138203 774 0.05 0.127 0.857 _ 2
    184697 372 0.085 0.874 0.045 S 2
    116816 362 0.078 0.863 0.061 S 2
    172102 377 0.068 0.887 0.051 S 1
    41961 329 0.044 0.92 0.064 S 1
    456042 328 0.038 0.942 0.045 S 1
    268970 386 0.025 0.953 0.056 S 1
    29957 283 0.019 0.958 0.067 S 1
    116945 203 0.143 0.062 0.889 _ 2
    157771 401 0.037 0.944 0.045 S 1
    157775 304 0.039 0.933 0.056 S 1
    63838 343 0.015 0.974 0.051 S 1
    41982 373 0.156 0.807 0.026 S 2
    172152 362 0.046 0.927 0.051 S 1
    269481 367 0.124 0.787 0.049 S 2
    269524 373 0.13 0.823 0.028 S 2
    41997 618 0.09 0.958 0.02 S 1
    172246 372 0.117 0.854 0.028 S 2
    157924 374 0.155 0.857 0.027 S 2
    117149 396 0.013 0.496 0.863 _ 4
    184935 309 0.034 0.944 0.061 S 1
    138704 475 0.096 0.071 0.887 _ 2
    172436 486 0.083 0.049 0.928 _ 1
    42291 347 0.056 0.938 0.021 S 1
    81341 141 0.059 0.274 0.852 _ 3
    158334 414 0.237 0.054 0.674 _ 3
    42434 421 0.05 0.914 0.051 S 1
    54172 363 0.017 0.977 0.039 S 1
    185179 452 0.09 0.805 0.059 S 2
    117666 259 0.056 0.913 0.05 S 1
    42534 327 0.084 0.883 0.031 S 2
    42539 270 0.19 0.044 0.855 _ 2
    296151 848 0.178 0.112 0.76 _ 3
    185311 397 0.037 0.706 0.59 S 5
    42617 504 0.024 0.239 0.872 _ 2
    42631 975 0.141 0.86 0.023 S 2
    117772 330 0.454 0.018 0.718 _ 4
    54399 313 0.027 0.948 0.043 S 1
    172925 348 0.068 0.979 0.031 S 1
    172926 355 0.031 0.968 0.045 S 1
    158817 338 0.037 0.936 0.087 S 1
    158842 1,102 0.131 0.059 0.88 _ 2
    185485 287 0.099 0.149 0.826 _ 2
    118319 648 0.118 0.832 0.057 S 2
    139564 387 0.947 0.041 0.047 M 1
    42889 285 0.055 0.192 0.895 _ 2
    302552 344 0.191 0.044 0.811 _ 2
    305292 253 0.084 0.889 0.033 S 1
    43095 366 0.129 0.816 0.031 S 2
    306404 366 0.113 0.849 0.032 S 2
    43114 348 0.099 0.818 0.057 S 2
    306863 366 0.041 0.901 0.056 S 1
    118718 363 0.052 0.884 0.049 S 1
    119037 314 0.05 0.91 0.069 S 1
    43329 364 0.143 0.843 0.03 S 2
    173495 364 0.337 0.782 0.013 S 3
    311850 437 0.082 0.904 0.031 S 1
    54893 416 0.149 0.835 0.047 S 2
    185921 568 0.19 0.847 0.046 S 2
    459664 777 0.052 0.777 0.257 S 3
    43446 386 0.099 0.882 0.061 S 2
    313682 859 0.047 0.95 0.031 S 1
    173673 260 0.015 0.968 0.041 S 1
    119350 399 0.033 0.941 0.062 S 1
    119522 575 0.905 0.042 0.13 M 2
    119593 1,000 0.12 0.864 0.027 S 2
    43812 1,034 0.027 0.834 0.427 S 3
    43892 615 0.019 0.971 0.047 S 1
    323280 369 0.239 0.763 0.019 S 3
    43929 258 0.026 0.965 0.084 S 1
    186344 320 0.122 0.849 0.039 S 2
    120002 362 0.08 0.87 0.048 S 2
    55334 249 0.034 0.907 0.075 S 1
    43966 742 0.024 0.946 0.05 S 1
    324420 819 0.032 0.934 0.049 S 1
    186388 434 0.136 0.879 0.039 S 2
    44047 495 0.025 0.966 0.045 S 1
    44072 557 0.412 0.595 0.018 S 5
    326659 470 0.38 0.617 0.062 S 4
    141290 460 0.062 0.147 0.889 _ 2
    120399 298 0.117 0.362 0.535 _ 5
    344867 663 0.092 0.927 0.021 S 1
    141539 663 0.101 0.904 0.022 S 1
    345914 804 0.294 0.842 0.009 S 3
    44370 571 0.236 0.777 0.041 S 3
    44376 532 0.037 0.964 0.029 S 1
    44391 385 0.022 0.964 0.048 S 1
    141648 466 0.369 0.686 0.046 S 4
    55696 466 0.59 0.689 0.03 S 5
    462628 730 0.223 0.087 0.657 _ 3
    120968 1,020 0.018 0.966 0.057 S 1
    161363 452 0.052 0.912 0.047 S 1
    174734 531 0.054 0.857 0.206 S 2
    161500 326 0.05 0.927 0.032 S 1
    353490 284 0.807 0.044 0.166 M 2
    353489 254 0.422 0.051 0.632 _ 4
    44803 1,134 0.105 0.028 0.928 _ 1
    355947 264 0.021 0.946 0.08 S 1
    73811 287 0.489 0.745 0.016 S 4
    121664 369 0.079 0.874 0.033 S 2
    31936 332 0.211 0.783 0.03 S 3
    73869 357 0.123 0.12 0.842 _ 2
    463744 931 0.029 0.972 0.025 S 1
    45029 958 0.016 0.969 0.057 S 1
    187270 615 0.044 0.957 0.029 S 1
    56225 960 0.166 0.202 0.582 _ 4
    32051 406 0.186 0.073 0.732 _ 3
    361367 713 0.08 0.063 0.949 _ 1
    73972 481 0.159 0.698 0.092 S 3
    175283 521 0.208 0.945 0.004 S 2
    45135 778 0.166 0.895 0.011 S 2
    121936 537 0.043 0.918 0.053 S 1
    45153 588 0.043 0.845 0.111 S 2
    122105 500 0.097 0.128 0.838 _ 2
    56307 208 0.323 0.115 0.412 _ 5
    45281 340 0.341 0.59 0.036 S 4
    45314 601 0.082 0.12 0.844 _ 2
    465711 611 0.071 0.279 0.729 _ 3
    175513 700 0.052 0.367 0.644 _ 4
    143000 604 0.101 0.128 0.746 _ 2
    56449 403 0.04 0.96 0.034 S 1
    175536 379 0.127 0.872 0.031 S 2
    74164 587 0.144 0.145 0.649 _ 3
    162505 587 0.081 0.165 0.796 _ 2
    56499 798 0.368 0.808 0.011 S 3
    56525 330 0.449 0.653 0.023 S 4
    45516 850 0.067 0.891 0.081 S 1
    162602 215 0.09 0.086 0.866 _ 2
    384658 698 0.142 0.879 0.033 S 2
    45570 1,468 0.018 0.965 0.042 S 1
    187728 605 0.116 0.157 0.718 _ 3
    45647 404 0.1 0.692 0.179 S 3
    66377 626 0.158 0.64 0.062 S 3
    66400 890 0.144 0.023 0.921 _ 2
    122937 361 0.08 0.919 0.03 S 1
    66493 204 0.046 0.304 0.687 _ 4
    143585 374 0.045 0.094 0.947 _ 1
    123323 650 0.114 0.295 0.801 _ 3
    45905 313 0.127 0.925 0.028 S 2
    403554 339 0.262 0.075 0.74 _ 3
    56859 320 0.081 0.863 0.059 S 2
    176420 458 0.019 0.972 0.037 S 1
    46260 847 0.035 0.189 0.908 _ 2
    188241 862 0.038 0.161 0.94 _ 2
    33215 801 0.067 0.777 0.182 S 3
    101267 513 0.022 0.946 0.089 S 1
    33263 449 0.021 0.9 0.099 S 1
    102985 338 0.067 0.974 0.027 S 1
    448899 540 0.413 0.042 0.616 _ 4
    177450 748 0.043 0.939 0.031 S 1
    196330 544 0.05 0.961 0.019 S 1
    33636 717 0.168 0.175 0.701 _ 3
    125362 239 0.358 0.042 0.545 _ 5
    100935 396 0.091 0.352 0.583 _ 4
    164180 836 0.303 0.845 0.012 S 3
    102479 750 0.243 0.06 0.721 _ 3
    199563 388 0.678 0.27 0.052 M 3
    145317 557 0.044 0.799 0.201 S 3
    95645 99 0.09 0.193 0.743 _ 3
    33906 312 0.19 0.087 0.732 _ 3
    201958 607 0.826 0.018 0.328 M 3
    33959 594 0.708 0.032 0.35 M 4
    33963 340 0.025 0.921 0.133 S 2
    203296 422 0.12 0.923 0.024 S 1
    34143 292 0.061 0.079 0.934 _ 1
    47402 390 0.028 0.942 0.071 S 1
    164550 682 0.506 0.434 0.072 M 5
    126363 785 0.226 0.14 0.716 _ 3
    34175 506 0.937 0.026 0.099 M 1
    126440 419 0.058 0.137 0.91 _ 2
    207338 523 0.042 0.926 0.053 S 1
    34226 479 0.071 0.086 0.922 _ 1
    207890 208 0.042 0.926 0.053 S 1
    24753 992 0.257 0.036 0.723 _ 3
    101242 366 0.165 0.049 0.851 _ 2
    209426 255 0.073 0.226 0.761 _ 3
    47558 367 0.035 0.916 0.062 S 1
    164740 337 0.048 0.798 0.118 S 2
    47647 744 0.034 0.946 0.075 S 1
    103882 413 0.153 0.052 0.854 _ 2
    24940 781 0.104 0.077 0.907 _ 1
    34577 474 0.223 0.03 0.844 _ 2
    24950 374 0.049 0.978 0.015 S 1
    275330 650 0.465 0.629 0.023 S 5
    34622 607 0.147 0.12 0.719 _ 3
    34651 526 0.127 0.039 0.875 _ 2
    34705 653 0.061 0.067 0.905 _ 1
    165147 577 0.063 0.086 0.896 _ 1
    34805 391 0.914 0.035 0.118 M 2
    280856 545 0.204 0.073 0.755 _ 3
    104675 505 0.097 0.869 0.039 S 2
    282706 466 0.089 0.952 0.038 S 1
    34945 466 0.261 0.722 0.022 S 3
    35099 397 0.034 0.957 0.044 S 1
    35123 603 0.73 0.055 0.209 M 3
    35255 335 0.09 0.869 0.039 S 2
    128174 279 0.124 0.95 0.01 S 1
    331356 251 0.066 0.79 0.195 S 3
    35327 233 0.037 0.887 0.112 S 2
    35330 235 0.04 0.881 0.096 S 2
    104983 435 0.365 0.084 0.512 _ 5
    165879 280 0.063 0.095 0.909 _ 1
    165993 546 0.072 0.707 0.106 S 2
    338580 678 0.048 0.947 0.019 S 1
    35711 528 0.089 0.177 0.79 _ 2
    105145 362 0.361 0.72 0.031 S 4
    48723 546 0.07 0.964 0.021 S 1
    35742 516 0.053 0.457 0.796 _ 4
    340063 377 0.193 0.176 0.709 _ 3
    105469 346 0.204 0.051 0.772 _ 3
    105723 203 0.124 0.097 0.841 _ 2
    48765 461 0.582 0.076 0.307 M 4
    105560 432 0.053 0.904 0.049 S 1
    68408 564 0.03 0.956 0.04 S 1
    25772 321 0.025 0.966 0.043 S 1
    106998 404 0.052 0.172 0.887 _ 2
    35876 325 0.046 0.921 0.085 S 1
    35880 488 0.054 0.182 0.909 _ 2
    106046 321 0.103 0.937 0.018 S 1
    106351 275 0.118 0.059 0.875 _ 2
    59360 863 0.079 0.83 0.127 S 2
    25843 321 0.303 0.882 0.013 S 3
    166233 323 0.181 0.857 0.033 S 2
    35905 325 0.061 0.937 0.04 S 1
    129150 325 0.167 0.909 0.032 S 2
    364963 340 0.055 0.899 0.036 S 1
    365447 826 0.077 0.893 0.039 S 1
    365822 509 0.036 0.921 0.071 S 1
    106230 542 0.345 0.068 0.679 _ 4
    464718 327 0.1 0.856 0.041 S 2
    49096 474 0.051 0.961 0.044 S 1
    129655 389 0.274 0.187 0.411 _ 5
    49205 779 0.028 0.954 0.046 S 1
    166629 301 0.351 0.134 0.447 _ 5
    180053 292 0.4 0.1 0.395 M 5
    107081 1,018 0.021 0.962 0.059 S 1
    106859 396 0.04 0.484 0.631 _ 5
    387673 192 0.127 0.115 0.864 _ 2
    107229 219 0.14 0.06 0.876 _ 2
    107188 503 0.053 0.868 0.154 S 2
    108447 882 0.021 0.947 0.069 S 1
    36572 867 0.082 0.087 0.879 _ 2
    389256 583 0.057 0.958 0.017 S 1
    49473 238 0.019 0.964 0.071 S 1
    180279 701 0.433 0.747 0.012 S 4
    107702 742 0.189 0.042 0.841 _ 2
    150151 257 0.413 0.059 0.588 _ 5
    49748 386 0.015 0.906 0.209 S 2
    150399 588 0.123 0.817 0.031 S 2
    36985 453 0.051 0.294 0.694 _ 4
    36994 589 0.045 0.917 0.036 S 1
    130948 590 0.038 0.942 0.053 S 1
    36996 588 0.066 0.925 0.036 S 1
    37005 203 0.044 0.261 0.726 _ 3
    37023 753 0.068 0.477 0.496 _ 5
    396825 410 0.022 0.966 0.049 S 1
    37051 681 0.056 0.101 0.905 _ 1
    167339 723 0.081 0.047 0.918 _ 1
    108031 840 0.039 0.298 0.854 _ 3
    60306 510 0.96 0.018 0.089 M 1
    94900 199 0.349 0.054 0.575 _ 4
    150787 929 0.174 0.491 0.328 S 5
    108631 254 0.7 0.029 0.417 M 4
    151004 587 0.056 0.645 0.36 S 4
    408988 1,119 0.13 0.887 0.023 S 2
    37467 467 0.03 0.984 0.031 S 1
    131760 370 0.03 0.705 0.316 S 4
    412878 510 0.049 0.888 0.057 S 1
    109222 337 0.086 0.929 0.02 S 1
    420841 296 0.43 0.109 0.29 M 5
    167984 273 0.256 0.065 0.614 _ 4
    37832 314 0.294 0.736 0.057 S 3
    181255 402 0.021 0.96 0.068 S 1
    37882 458 0.034 0.945 0.064 S 1
    168122 772 0.03 0.949 0.05 S 1
    132435 597 0.138 0.364 0.28 S 5
    424941 446 0.025 0.965 0.038 S 1
    69748 2,350 0.114 0.907 0.026 S 2
    38169 565 0.021 0.958 0.058 S 1
    38189 796 0.115 0.147 0.695 _ 3
    109757 566 0.908 0.033 0.094 M 1
    38208 806 0.057 0.966 0.015 S 1
    50823 892 0.053 0.066 0.95 _ 1
    38229 528 0.123 0.923 0.014 S 2
    69931 375 0.044 0.99 0.027 S 1
    61232 400 0.265 0.256 0.365 _ 5
    38397 558 0.019 0.947 0.08 S 1
    133171 563 0.194 0.78 0.019 S 3
    38406 253 0.17 0.863 0.026 S 2
    38407 253 0.12 0.822 0.058 S 2
    110758 322 0.172 0.383 0.274 S 5
    152728 384 0.062 0.798 0.143 S 2
    110978 740 0.279 0.141 0.526 _ 4
    168656 547 0.041 0.97 0.032 S 1
    111162 528 0.041 0.316 0.851 _ 3
    434943 523 0.146 0.921 0.011 S 2
    61366 344 0.068 0.951 0.018 S 1
    38562 579 0.048 0.961 0.032 S 1
    61437 560 0.053 0.951 0.021 S 1
    111196 150 0.118 0.118 0.85 _ 2
    38632 752 0.11 0.714 0.134 S 3
    38673 589 0.045 0.9 0.09 S 1
    38796 890 0.051 0.889 0.068 S 1
    111761 408 0.065 0.959 0.023 S 1
    441800 339 0.362 0.212 0.32 M 5
    169026 714 0.062 0.987 0.015 S 1
    153331 307 0.041 0.53 0.552 _ 5
    153350 869 0.293 0.063 0.66 _ 4
    111954 463 0.02 0.981 0.054 S 1
    61758 254 0.03 0.337 0.811 _ 3
    51514 257 0.043 0.288 0.734 _ 3
    111348 534 0.03 0.978 0.038 S 1
    169283 531 0.071 0.944 0.017 S 1
    39120 460 0.039 0.139 0.91 _ 2
    153798 467 0.061 0.158 0.896 _ 2
    182393 468 0.038 0.133 0.935 _ 1
    112304 545 0.154 0.113 0.64 _ 3
    39290 605 0.079 0.129 0.844 _ 2
    214618 503 0.081 0.056 0.926 _ 1
    39296 269 0.061 0.915 0.031 S 1
    39375 890 0.055 0.865 0.069 S 2
    51842 588 0.112 0.122 0.793 _ 2
    51888 475 0.314 0.663 0.039 S 4
    182705 511 0.053 0.883 0.083 S 1
    219817 369 0.317 0.328 0.142 S 5
    219843 336 0.45 0.866 0.004 S 3
    182872 668 0.034 0.956 0.057 S 1
    39816 471 0.021 0.96 0.064 S 1
    227734 617 0.118 0.049 0.865 _ 2
    • Abbreviation: cTP, chloroplast transit peptide; Len, Sequence length; Loc, prediction of localization; M, Mitochondrion; RC, Reliability class; S, secretory pathway; SP, signal peptide.
    Details are in the caption following the image
    Total RNAs extracted from mycelia co-cultivated with cyanobacterial cells (Treatment) and without cyanobacterial cells (Control) of 6, 12, 24, and 48 hr samples
    Details are in the caption following the image
    Boxplots showing the distribution of the FPKM values of each sample. Note: 6h_ck, control sample at 6 hr; 6h_T, treatment sample at 6 hr; 12h_ck, control sample at 12 hr; 12h_T, treatment sample at 12 hr; 24h_ck, control sample at 24 hr; 24h_T, treatment sample at 24 hr; 48h_ck, control sample at 48 hr; 48h_T, treatment sample at 48 hr. “_0” and “_1” represent repeat samples
    Details are in the caption following the image
    Comparison of expression changes between Real-time PCR and RNA-Sequencing. Note: A, jgi|Bjead1_1|34143|fgenesh1_kg.1_#_945_#_Locus732v1_medCvg1115.6s (a protein of esterase family 1); B, jgi|Bjead1_1|35099|fgenesh1_kg.2_#_711_#_Locus118v3_medCvg9284.2s (a protein of hydrolase family 5); C, jgi|Bjead1_1|172436|gm1.8875_g (a protein of hydrolase family 5); D, jgi|Bjead1_1|459664|MIX10988_17319_14 (a radical oxidase); E, jgi|Bjead1_1|355947|CE167616_517 (a protein of hydrolase family 128); F, jgi|Bjead1_1|38229|fgenesh1_kg.7_#_551_#_Locus8080v1_medCvg1578.8s (a protein of hydrolase family 13)

    DATA AVAILABILITY STATEMENT

    The raw paired-end sequences from the Bjerkandera adusta isolate T1 are available at https://www.ncbi.nlm.nih.gov/bioproject/PRJNA543936. The genome annotations of Bjerkandera adusta and Trametes versicolor can be found at the JGI MycoCosm: https://mycocosm.jgi.doe.gov/Bjead1_1/Bjead1_1.home.html and https://mycocosm.jgi.doe.gov/Trave1/Trave1.home.html, respectively.

      The full text of this article hosted at iucr.org is unavailable due to technical difficulties.