Volume 234, Issue 5 pp. 7292-7300

ORIGINAL RESEARCH ARTICLE

Full Access

DGCR5 attenuates neuropathic pain through sponging miR-330-3p and regulating PDCD4 in CCI rat models

Chengwei Peng,

Chengwei Peng

orcid.org/0000-0002-9890-4926

Department of Anesthesiology, Tongji Hospital affiliated Tongji University, Shanghai, China

Chengwei Peng and Chuanqing Zhang are co-first authors.

Search for more papers by this author

Chuanqing Zhang,

Chuanqing Zhang

Department of Anesthesiology, Gongli Hospital, The Second Military Medical University, Shanghai, China

Chengwei Peng and Chuanqing Zhang are co-first authors.

Search for more papers by this author

Zhe Su,

Corresponding Author

Zhe Su

[email protected]

Department of Anesthesiology, Tongren Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China

Correspondence Zhe Su and Dongyang Lin, Department of Anesthesiology, Tongren Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China. Email: [email protected]; [email protected]

Search for more papers by this author

Dongyang Lin,

Corresponding Author

Dongyang Lin

[email protected]

Department of Anesthesiology, Tongren Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China

Search for more papers by this author

Chengwei Peng,

Chengwei Peng

orcid.org/0000-0002-9890-4926

Department of Anesthesiology, Tongji Hospital affiliated Tongji University, Shanghai, China

Chengwei Peng and Chuanqing Zhang are co-first authors.

Search for more papers by this author

Chuanqing Zhang,

Chuanqing Zhang

Department of Anesthesiology, Gongli Hospital, The Second Military Medical University, Shanghai, China

Chengwei Peng and Chuanqing Zhang are co-first authors.

Search for more papers by this author

Zhe Su,

Corresponding Author

Zhe Su

[email protected]

Department of Anesthesiology, Tongren Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China

Search for more papers by this author

Dongyang Lin,

Corresponding Author

Dongyang Lin

[email protected]

Department of Anesthesiology, Tongren Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China

Search for more papers by this author

First published: 14 October 2018

https://doi.org/10.1002/jcp.27487

Citations: 32

Share a link

Email
Wechat
Bluesky

Abstract

Neuropathic pain caused by somatosensory nervous system dysfunction is a serious public health problem. Some long noncoding RNAs (lncRNAs) can participate in physiological processes involved in neuropathic pain. However, the effects of lncRNA DGCR5 in neuropathic pain have not been explored. Therefore, in our current study, we concentrated on the biological roles of DGCR5 in neuropathic pain. Here, it was observed that DGCR5 was significantly decreased in chronic sciatic nerve injury (CCI) rat models. DGCR5 overexpression was able to alleviate neuropathic pain development including mechanical and thermal hyperalgesia. In addition, the current understanding of miR-330-3p function in neuropathic pain remains largely incomplete. Here, we found that miR-330-3p was greatly increased in CCI rats and DGCR5 can modulate miR-330-3p expression negatively. Upregulation of DGCR5 repressed inflammation-correlated biomarkers including interleukin 6 (IL-6), tumor necrosis factor α, and IL-1β in CCI rats by sponging miR-330-3p. The negative correlation between DGCR5 and miR-330-3p was confirmed in our current study. Inhibition of miR-330-3p suppressed neuropathic pain progression by restraining neuroinflammation in vivo. In addition, PDCD4 was predicted as a downstream target of miR-330-3p. Furthermore, PDCD4 was significantly increased in CCI rats and DGCR5 regulated PDCD4 expression through sponging miR-330-3p in CCI rat models. Taken these together, it was implied that DGCR5/miR-330-3p/PDCD4 axis participated in neuropathic pain treatment.

1 INTRODUCTION

Neuropathic pain due to nerve lesions or dysfunction is one of the most challenging neurological diseases. The prevalence of neuropathic pain in the gross population is about 7–10% (Bouhassira, Lantéri-Minet, Attal, Laurent, & Touboul, 2008; de Moraes Vieira, Garcia, da Silva, Mualem araújo, & Jansen, 2012). Therefore, it is crucial to focus on the underlying mechanisms of neuropathic pain.

Long noncoding RNA (lncRNA) belongs to a family of RNAs characterized with transcripts with more than 200 nucleotides in molecular length (Batista & Chang, 2013). Many lncRNAs are involved in neuropathic pain. NONRATT021972 is correlated with neuropathic pain scoring in type 2 diabetes patients (Yu, Zhao, Cao, Zhu, & Li, 2017). X-inactive specific transcript (XIST) is able to accelerate neuropathic pain progression through regulating miR-150 and ZEB1 in chronic sciatic nerve injury (CCI) rat models (T. Yan, Zhang, et al., 2018; X. T. Yan, Lu, et al., 2018). LncRNA MRAK009713 is able to regulate neuropathic pain in rats (Li et al., 2017). LncRNA DGCR5 is decreased in Huntington's disease (Johnson, 2012). However, the function of DGCR5 in neuropathic pain remains uninvestigated.

MicroRNAs are small noncoding RNAs, which can function through targeting the 3′-untranslated regions (3′-UTRs) of target genes (Lai, 2002). Emerging studies have reported that miRNAs are responsible for many biological processes (Pandey et al., 2015; Xu et al., 2016). Recently, miRNAs exert a critical role in neuroinflammation and neuropathic pain. miR-32-5p contributes to neuropathic pain by targeting Dusp5 (T. Yan, Zhang, et al., 2018; X. T. Yan, Lu, et al., 2018). MiR-142-3p can relieve neuropathic pain by targeting HMGB1 (Y. Zhang et al., 2018). MiR-200b/miR-429 inhibition leads to neuropathic pain by targeting ZEB1 (H. Yan, Rao et al., 2017; X. T. Yan, Zhao et al., 2017).

Currently, we observed that DGCR5 was dramatically decreased while miR-330-3p was increased in CCI rat models. Overexpression of DGCR5 inhibited neuropathic pain progression by targeting miR-330-3p. PDCD4 was predicted as a downstream target of miR-330-3p. Hence, it was hypothesized that DGCR5 played an inhibitory role in neuropathic pain progression by targeting miR-330-3p/PDCD4.

2 MATERIALS AND METHODS

2.1 Animal studies

Sprague–Dawley rats (adult, female, weighed 190–210 g) were obtained from Shanghai Animal Laboratory Center (Shanghai, China). They were maintained in cages with an indoor-constant temperature of 25°C. Rats were administered at 9:00 every morning, which lasted for 10 days. CCI animal model was established as according to the previously reported method (Bennett & Xie, 1988). Based on the previous method (Richner, Jager, Siupka, & Vaegter, 2017), the dorsal spinal cords of L4–L6 were isolated and kept in liquid nitrogen tank (−80°C) for further research. The experimental procedures were strictly carried out under the requirements in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health.

2.2 Cell culture

Rat microglial cells and HEK-293T cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA). Cells were grown in Dulbecco's modified Eagle medium (Lonza Inc., Walkersville, MD) added with 10% heat-inactivated fetal bovine serum (Invitrogen, Carlsbad, CA) and 1% penicillin/streptomycin.

2.3 Intrathecal injection

PE-10 polyethylene catheter was inserted. Paralysis of bilateral hind limbs was carried out using an injection of lidocaine and after that, the intrathecal implantation was used. Then the catheter was fixed and the incision was sealed. For gene delivery, LV-DGCR5 (RiboBio, Guangzhou, China) and anti-miR-330-3p (RiboBio) or their corresponding scrambled controls at a multiplicity of infection of 20 were injected through a microinjection syringe linked with the intrathecal catheter 3 days before CCI surgery daily. MiR-330-3p mimics, inhibitors or their negative controls (NCs; RiboBio, Guangzhou, China) were transfected into the rat microglial cells.

2.4 Quantitative real-time polymerase chain reaction (PCR)

Total RNA were extracted by using the RNAiso Plus (Takara Biotechnology, Dalian, China). RNA reverse-transcribed by the Prime Script™ RT Master Mix and quantitative PCR was carried out by SYBR Premix Ex Taq II (Takara Biotechnology). The primers used in this study were manifested in Table 1. The 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA) was used.

Table 1. Primers used for real-time polymerase chain reaction

Genes	Forward (5′~3′)	Reverse (5′~3′)
GAPDH	CAAGGTCATCCATGACAACTTTG	GTCCACCACCCTGTTGCTGTAG
U6	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT
DGCR5	CACGAGTGTAGTGCCCAGTT	GGTCAGGGACCTTTGTCGTT
PDCD4	TATGATGTGGAGGAGGTGGATGTGA	CCTTTCATCCAAAGGAAAAACTACAC

2.5 Pain threshold assessment

Paw withdrawal threshold (PWT) was used to evaluate mechanical allodynia. The plantar surface of the left hind paw was exposed to pressure created by the calibrated Electronic Von Frey Filament (Electronic Von Frey 2393; IITC, Woodland Hills, CA). The time of paw withdrawal responding to the pressure was observed. Paw withdrawal latency (PWL) was used to assess thermal hyperalgesia responding to radiant heat. The duration between stimuli starting and paw withdrawal was recorded.

2.6 Enzyme-linked immunosorbent assay (ELISA)

The protein expression of tumor necrosis factor α (TNF-α), interleukin 6 (IL-6), and IL-1β was tested using ELISA kits (R&D Systems, Minneapolis, MN).

2.7 Luciferase activity assay

The wild type (WT) or mutant (MUT) DGCR5-binding miR-330-3p was subcloned into a pGL3 Basic Vector (Promega, Madison, WI). MiR-330-3p mimics (RiboBio) were cotransfected with 10 μg pLUC-WT-DGCR5 or pLUC-MUT-DGCR5 into HEK-293T cells. The WT or MUT-PDCD4 binding miR-330-3p was subcloned into the pGL3 Basic Vector in a similar way.

2.8 RNA immunoprecipitation (RIP) assay

RIP assay was carried out using Magna RIP Kit (EMD Millipore, Billerica, MA). Cells were lysed with RIP lysis buffer and magnetic beads conjugated to human anti-Ago2 antibody (Millipore) or isotype-matched control antibody (normal mouse IgG; Millipore) was used to incubate the cell lysis.

2.9 RNA pull-down assay

RNAs were labeled using biotin using Pierce RNA 3′ End Desthiobiotinylation Kit (Thermo Fisher Scientific, Waltham, MA). Cell lysates were indicated with the positive control (biotin-labeled WT miR-330-3p and miR-330-3p-Bio), NC (mutant miR-330-3p and miR-330-3p-Bio-mut), and biotinylated RNAs (NC-Bio).

2.10 Western blot analysis

Proteins were separated on 10% sodium dodecyl sulfate gels. Polyvinylidene difluoride membrane was used to transfer the proteins on. After incubated in 5% defatted milk for 1 hr, primary antibodies were used to incubate the membrane. Next day, after membranes were washed by TBST, secondary antibodies conjugated with horseradish peroxidase were used. The primary antibodies: anti-PDCD4 and anti-GAPDH (Abcam, Cambridge, UK) were used.

2.11 Statistical analysis

All data were indicated as the mean ± standard deviation. Comparisons between quantitative variables were conducted using Student's t test and one-way analysis of variance. Differences were significant when p < 0.05. The SPSS 19.0 (SPSS Inc., Chicago, IL) was used in our study.

3 RESULTS

3.1 DGCR5 was decreased and miR-330-3p was increased in CCI rats

To investigate the role of DGCR5 and miR-330-3p in neuropathic pain development, DGCR5 and miR-330-3p in the spinal cords were measured. DGCR5 was significantly downregulated in CCI rats (Figure 1a). In addition, miR-330-3p was greatly overexpressed in CCI rats (Figure 1b). These manifested that DGCR5 and miR-330-3p played crucial roles in neuropathic pain progression in vivo.

Details are in the caption following the image — **Figure 1**
Open in figure viewer PowerPoint

Expression of DGCR5 and miR-330-3p. (a) DGCR5 expression in the L4–L6 dorsal spinal cord of rats was detected by quantitative real-time polymerase chain reaction at postoperative Days 0, 3, 7, 14, and 21. (b) Expression of miR-330-3p in the L4–L6 dorsal spinal cord of rats. n = 8 for each group. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *p < 0.05. CCI: chronic sciatic nerve injury [Color figure can be viewed at wileyonlinelibrary.com]

3.2 DGCR5 inhibited neuropathic pain behaviors in CCI rats

To explore whether DGCR5 can affect neuropathic pain development in vivo, DGCR5 was overexpressed in CCI rats. As exhibited in Figure 2a,b, both mechanical allodynia and thermal hyperalgesia were strongly restrained by DGCR5 overexpression. These indicated that DGCR5 demonstrated a suppressive role in neuropathic pain progression in CCI rats.

3.3 Overexpression of DGCR5 repressed neuroinflammation in vivo by targeting miR-330-3p

Next, to explore whether DGCR5 can influence miR-330-3p, DGCR5 was upregulated in CCI rats. In Figure 3a, it was shown that DGCR5 was greatly increased in CCI rats by LV-DGCR5. Besides these, we can observe that miR-330-3p was decreased by LV-DGCR5 in Figure 3b. Since neuroinflammation has been reported to participate in neuropathic pain, the expression of TNF-α, IL-6, and IL-1β were tested. ELISA results exhibited that DGCR5 overexpression significantly decreased the expression of TNF-α, IL-6, and IL-1β in CCI rats (Figure 3c–e). These indicated that DGCR5 restrained neuroinflammation in vivo through regulating miR-330-3p.

3.4 DGCR5 served as a sponge of miR-330-3p

The association between lncRNAs and microRNAs has drawn increasing attention in neuropathic pain. In our current study, ChipBase, LncRNAdb, and StarBase were used to predict the correlation between DGCR5 and miR-330-3p (Figure 4a). Dual-luciferase reporter assay was conducted to validate that miR-330-3p was a target of DGCR5 (Figure 4b). The luciferase reporter plasmid containing the wild type of DGCR5 with miR-330-3p mimics were cotransfected into HEK-293T cells and significantly decreased reporter activity was exhibited (Figure 4c). Next, to assess whether DGCR5 can sponge miR-330-3p directly, RIP assay was carried out. DGCR5 and miR-330-3p were much more enriched in Ago2 pellet compared with IgG pellet (Figure 4d). Additionally, RNA pull-down assay using biotinylated miR-330-3p (miR-330-3p-Bio) probe increased the level of DGCR5 than control (NC-Bio) or miR-330-3p probes (Figure 4e) in rat microglial cells. These results implied that DGCR5 can serve as a sponge of miR-330-3p in neuropathic pain.

3.5 Silence of miR-330-3p inhibited neuropathic pain development in vivo

Next, to investigate whether miR-330-3p can influence neuropathic pain development, miR-330-3p was downregulated in CCI rats. In Figure 5a, it was indicated that miR-330-3p was greatly decreased in CCI rats by anti-miR-330-3p. Meanwhile, DGCR5 was upregulated by anti-miR-330-3p in CCI rats (Figure 5b). Both mechanical allodynia and thermal hyperalgesia were repressed by miR-330-3p inhibition (Figure 5c,d). In addition, IL-6, TNF-α, and IL-1β were significantly inhibited by downregulation of miR-330-3p (Figure 5e–g). These data indicated that the silence of miR-330-3p repressed neuropathic pain development in vivo.

3.6 PDCD4 was a direct target of miR-330-3p

To find out the direct target gene of miR-330-3p, bioinformatic analysis including TargetScan, Starbase, miRanda, and miRDB database was performed. Interestingly, it was observed that PDCD4 3′-UTR had a conserved binding region of miR-330-3p (Figure 6a). The 3′-UTR of PDCD4 harboring the WT-PDCD4 or MUT-PDCD4 was designed (Figure 6b). Cotransfection of miR-330-3p mimics with the luciferase vector containing WT-PDCD4 repressed the luciferase activity in HEK-293T cells (Figure 6c). In addition, PDCD4 expression was significantly downregulated by miR-330-3p mimics while upregulated by miR-330-3p inhibitors (Figure 6d,e). These implied that miR-330-3p directly targeted PDCD4.

3.7 PDCD4 was modulated by DGCR5 in CCI rats

Furthermore, PDCD4 expression in CCI rats was increased significantly in a time-dependent course (Figure 7a,b). In addition, it was exhibited that PDCD4 expression was greatly inhibited by LV-DGCR5 in CCI rats infected with LV-DGCR5 (Figure 7c,d). These results suggested that PDCD4 was elevated in CCI rats and it can be regulated by DGCR5.

4 DISCUSSION

Recently, increasing roles of noncoding RNAs have been revealed in neuropathic pain development. Here, it was observed that DGCR5/miR-330-3p/PDCD4 axis was involved in neuropathic pain of CCI rats. DGCR5 was downregulated in CCI rat models and its overexpression can inhibit neuropathic pain progression through targeting miR-330-3p. In addition, miR-330-3p was upregulated and knockdown of miR-330-3p restrained neuroinflammation. Moreover, PDCD4 was predicted as a downstream target of miR-330-3p and miR-330-3p regulated Zeb1 PDCD4 expression negatively. Subsequently, DGCR5 can serve as a sponge of miR-330-3p and modulate PDCD4 levels in neuropathic pain.

DGCR5 is downregulated in Huntington's disease (Johnson, 2012). Increasing papers indicate that DGCR5 is closely related with several cancers. For example, downregulation of DGCR5 suggests poor prognosis of hepatocellular carcinoma (Huang et al., 2016). DGCR5 is reduced in pancreatic ductal adenocarcinoma tissues and cell lines and its downregulation can predict poor prognosis (Yong et al., 2017). In addition, DGCR5 can promote LUAD progression by inhibiting hsa-mir-22-3p (Dong, Wang, Jin, Zeng, & Pan, 2017). DGCR5 is involved in lung cancer progression by sponging miR-1180 (Chen, Zhang, Xu, Zhu, & Hu, 2017). Here, in our study, we focused on the biological role of DGCR5 in neuropathic pain progression. It was indicated that DGCR5 was strongly decreased in CCI rats and overexpression of DGCR5 significantly inhibited neuropathic pain behaviors. In addition, neuroinflammation was also repressed by DGCR5 upregulation since we observed that DGCR5 restrained NF-α, IL-6, and IL-1β protein levels obviously.

MiR-330-3p exerts oncogenic roles in various cancers. For instance it is greatly upregulated in prostate cancer patients and primary plasma cell leukemia (Lionetti et al., 2013; Medina-Villaamil et al., 2014). In addition, miR-330-3p is increased in non–small-cell lung cancer (NSCLC) patient tissues (Arora et al., 2011). MiR-330-3p promotes NSCLC cell invasion and metastasis by activating MAPK/ERK (Wei et al., 2017). MiR-330-3p is elevated in plasma samples from patients with gestational diabetes mellitus (Sebastiani et al., 2017). MiR-330-3p was predicted as a target of DGCR5 by using bioinformatics analysis. MiR-330-3p was increased in CCI rats in a time-dependent manner. DGCR5 can modulate miR-330-3p expression negatively and we confirmed the reverse interaction between them. It was indicated in our study that DGCR5 can inhibit neuropathic pain development through sponging miR-330-3p in vivo.

PDCD4 is a translation factor binding to eIF4A (Goke et al., 2002; Yang et al., 2003). It has been reported that PDCD4 deficiency can aggravate colitis and colorectal cancer through IL-6/STAT3 (Wang et al., 2016). Lipopolysaccharide can promote IL-10 production by inducing the degradation of PDCD4 (van den Bosch, Palsson-Mcdermott, Johnson, & O'Neill, 2014). PDCD4 stabilization can provide a target for tumors (Schmid et al., 2011). In addition, XIST can regulate PDCD4 by interacting with miR-21-5p in osteosarcoma (R. Zhang & Xia, 2017). MiR-155 can regulate inflammation response through SOCS1–STAT3–PDCD4 in atherogenesis (Ye et al., 2016). LncRNA MEG3 can regulate ischemic neuronal death via targeting miR-21/PDCD4 (H. Yan, Rao et al., 2017; X. T. Yan, Zhao et al., 2017). MiR-499 can protect endothelial cells against inflammatory damage by inhibiting NF-κB/TNF-α by targeting PDCD4 in coronary artery disease (Y. H. Zhang, He, & Shi, 2017). MiR-21/PDCD4 axis can act as a promising strategy for some neurological diseases (Su et al., 2017). PDCD4 was predicted as a downstream target of miR-330-3p and we found that PDCD4 was decreased in CCI rats. MiR-330-3p can regulate PDCD4 levels negatively. In addition, DGCR5 can modulate PDCD4 expression by sponging miR-330-3p in vivo.

In conclusion, a significant role of DGCR5/miR-330-3p/PDCD4 axis was exhibited in neuropathic pain progression. It was indicated that DGCR5 was able to alleviate neuropathic pain development in CCI rats via sponging miR-330-3p and regulating Zeb1. Apart from these, we observed that DGCR5 can inhibit neuroinflammation by reducing TNF-α, IL-6, and IL-1β by targeting miR-330-3p. MiR-330-3p was validated as a target of DGCR5 and PDCD4 was predicted as a downstream target of miR-330-3p, respectively. Overexpression of DGCR5 elevated PDCD4 levels via sponging miR-330-3p in vivo.

CONFLICTS OF INTEREST

The authors declare that there are no conflicts of interest.

REFERENCES

Arora, S., Ranade, A. R., Tran, N. L., Nasser, S., Sridhar, S., Korn, R. L., … Weiss, G. J. (2011). MicroRNA-328 is associated with (non-small) cell lung cancer (NSCLC) brain metastasis and mediates NSCLC migration. International Journal of Cancer, 129(11), 2621–2631.
10.1002/ijc.25939
CAS PubMed Web of Science® Google Scholar
Batista, P. J., & Chang, H. Y. (2013). Long noncoding RNAs: Cellular address codes in development and disease. Cell, 152(6), 1298–1307.
10.1016/j.cell.2013.02.012
CAS PubMed Web of Science® Google Scholar
Bennett, G. J., & Xie, Y. K. (1988). A peripheral mononeuropathy in rat that produces disorders of pain sensation like those seen in man. Pain, 33(1), 87–107.
10.1016/0304-3959(88)90209-6
CAS PubMed Web of Science® Google Scholar
van den Bosch, M. W. M., Palsson-Mcdermott, E., Johnson, D. S., & O'Neill, L. A. J. (2014). LPS induces the degradation of programmed cell death protein 4 (PDCD4) to release Twist2, activating c-Maf transcription to promote interleukin-10 production. The Journal of Biological Chemistry, 289(33), 22980–22990.
10.1074/jbc.M114.573089
PubMed Web of Science® Google Scholar
Bouhassira, D., Lantéri-Minet, M., Attal, N., Laurent, B., & Touboul, C. (2008). Prevalence of chronic pain with neuropathic characteristics in the general population. Pain, 136(3), 380–387.
10.1016/j.pain.2007.08.013
PubMed Web of Science® Google Scholar
Chen, E. G., Zhang, J. S., Xu, S., Zhu, X. J., & Hu, H. H. (2017). Long non-coding RNA DGCR5 is involved in the regulation of proliferation, migration and invasion of lung cancer by targeting miR-1180. American Journal of Cancer Research, 7(7), 1463–1475.
CAS PubMed Web of Science® Google Scholar
Dong, H. X., Wang, R., Jin, X. Y., Zeng, J., & Pan, J. (2017). LncRNA DGCR5 promotes lung adenocarcinoma (LUAD) progression via inhibiting hsa-mir-22-3p. Journal of Cellular Physiology, 233, 4126–4136.
10.1002/jcp.26215
PubMed Web of Science® Google Scholar
Göke, A., Göke, R., Knolle, A., Trusheim, H., Schmidt, H., Wilmen, A., … Chen, Y. H. (2002). DUG is a novel homologue of translation initiation factor 4G that binds eIF4A. Biochemical and Biophysical Research Communications, 297(1), 78–82.
10.1016/S0006-291X(02)02129-0
CAS PubMed Web of Science® Google Scholar
Huang, R., Wang, X., Zhang, W., Zhangyuan, G., Jin, K., Yu, W., … Sun, B. (2016). Down-Regulation of LncRNA DGCR5 Correlates with Poor Prognosis in Hepatocellular Carcinoma. Cellular Physiology and Biochemistry, 40(3-4), 707–715.
10.1159/000452582
CAS PubMed Web of Science® Google Scholar
Johnson, R. (2012). Long non-coding RNAs in Huntington's disease neurodegeneration. Neurobiology of Disease, 46(2), 245–254.
10.1016/j.nbd.2011.12.006
CAS PubMed Web of Science® Google Scholar
Lai, E. C. (2002). Micro RNAs are complementary to 3′ UTR sequence motifs that mediate negative post-transcriptional regulation. Nature Genetics, 30(4), 363–364.
10.1038/ng865
CAS PubMed Web of Science® Google Scholar
Li, G., Jiang, H., Zheng, C., Zhu, G., Xu, Y., Sheng, X., … Liang, S. (2017). Long noncoding RNA MRAK009713 is a novel regulator of neuropathic pain in rats. Pain, 158(10), 2042–2052.
10.1097/j.pain.0000000000001013
CAS PubMed Web of Science® Google Scholar
Lionetti, M., Musto, P., Di Martino, M. T., Fabris, S., Agnelli, L., Todoerti, K., … Neri, A. (2013). Biological and clinical relevance of miRNA expression signatures in primary plasma cell leukemia. Clinical Cancer Research, 19(12), 3130–3142.
10.1158/1078-0432.CCR-12-2043
CAS PubMed Web of Science® Google Scholar
Medina-Villaamil, V., Martínez-Breijo, S., Portela-Pereira, P., Quindós-Varela, M., Santamarina-Caínzos, I., Antón-Aparicio, L. M., & Gómez-Veiga, F. (2014). Circulating MicroRNAs in blood of patients with prostate cancer. Actas Urologicas Espanolas, 38(10), 633–639.
CAS PubMed Web of Science® Google Scholar
de Moraes Vieira, É. B., Garcia, J. B. S., da Silva, A. A. M., Mualem araújo, R. L. T., & Jansen, R. C. S. (2012). Prevalence, characteristics, and factors associated with chronic pain with and without neuropathic characteristics in Sao Luis, Brazil. Journal of Pain and Symptom Management, 44(2), 239–251.
10.1016/j.jpainsymman.2011.08.014
PubMed Web of Science® Google Scholar
Pandey, A., Singh, P., Jauhari, A., Singh, T., Khan, F., Pant, A. B., … Yadav, S. (2015). Critical role of the miR-200 family in regulating differentiation and proliferation of neurons. Journal of Neurochemistry, 133(5), 640–652.
10.1111/jnc.13089
CAS PubMed Web of Science® Google Scholar
Richner, M., Jager, S. B., Siupka, P., & Vaegter, C. B. (2017). Hydraulic extrusion of the spinal cord and isolation of dorsal root ganglia in rodents. Journal of Visualized Experiments, (119). https://doi.org/10.3791/55226
10.3791/55226
PubMed Web of Science® Google Scholar
Schmid, T., Bajer, M. M., Blees, J. S., Eifler, L. K., Milke, L., Rübsamen, D., … Brüne, B. (2011). Inflammation-induced loss of Pdcd4 is mediated by phosphorylation-dependent degradation. Carcinogenesis, 32(10), 1427–1433.
10.1093/carcin/bgr131
CAS PubMed Web of Science® Google Scholar
Sebastiani, G., Guarino, E., Grieco, G. E., Formichi, C., Delli Poggi, C., Ceccarelli, E., & Dotta, F. (2017). Circulating microRNA (miRNA) expression profiling in plasma of patients with gestational diabetes mellitus reveals upregulation of miRNA miR-330-3p. Frontiers in Endocrinology, 8, 345.
10.3389/fendo.2017.00345
PubMed Web of Science® Google Scholar
Su, W., Li, Z., Jia, Y., Zhu, Y., Cai, W., Wan, P., … Zhuo, Y. (2017). MicroRNA-21a-5p/PDCD4 axis regulates mesenchymal stem cell-induced neuroprotection in acute glaucoma. Journal of Molecular Cell Biology, 9(4), 289–301.
10.1093/jmcb/mjx022
CAS PubMed Web of Science® Google Scholar
Wang, L., Zhao, M., Guo, C., Wang, G., Zhu, F., Wang, J., … Zhang, L. (2016). PDCD4 deficiency aggravated colitis and colitis-associated colorectal cancer via promoting IL-6/STAT3 pathway in mice. Inflammatory Bowel Diseases, 22(5), 1107–1118.
10.1097/MIB.0000000000000729
PubMed Web of Science® Google Scholar
Wei, C. H., Wu, G., Cai, Q., Gao, X. C., Tong, F., Zhou, R., … Dong, X. R. (2017). MicroRNA-330-3p promotes cell invasion and metastasis in non-small cell lung cancer through GRIA3 by activating MAPK/ERK signaling pathway. Journal of Hematology & Oncology, 10(1), 125.
10.1186/s13045-017-0493-0
PubMed Web of Science® Google Scholar
Xu, S., Tao, Z., Hai, B., Liang, H., Shi, Y., Wang, T., … Chen, K. (2016). MiR-424(322) reverses chemoresistance via T-cell immune response activation by blocking the PD-L1 immune checkpoint. Nature Communications, 7, 11406.
10.1038/ncomms11406
CAS PubMed Web of Science® Google Scholar
Yan, H., Rao, J., Yuan, J., Gao, L., Huang, W., Zhao, L., & Ren, J. (2017). Long non-coding RNA MEG3 functions as a competing endogenous RNA to regulate ischemic neuronal death by targeting miR-21/PDCD4 signaling pathway. Cell Death & Disease, 8(12), 3211.
10.1038/s41419-017-0047-y
PubMed Web of Science® Google Scholar
Yan, T., Zhang, F., Sun, C., Sun, J., Wang, Y., Xu, X., … Shi, G. (2018). MiR-32-5p-mediated Dusp5 downregulation contributes to neuropathic pain. Biochemical and Biophysical Research Communications, 495(1), 506–511.
10.1016/j.bbrc.2017.11.013
CAS PubMed Web of Science® Google Scholar
Yan, X. T., Lu, J. M., Wang, Y., Cheng, X. L., He, X. H., Zheng, W. Z., … Wang, Y. L. (2018). XIST accelerates neuropathic pain progression through regulation of miR-150 and ZEB1 in CCI rat models. Journal of Cellular Physiology, 233, 6098–6106.
10.1002/jcp.26453
CAS PubMed Web of Science® Google Scholar
Yan, X. T., Zhao, Y., Cheng, X. L., He, X. H., Wang, Y., Zheng, W. Z., … Wang, Y. L. (2017). Inhibition of miR-200b/miR-429 contributes to neuropathic pain development through targeting zinc finger E box binding protein-1. Journal of Cellular Physiology, 233(6), 4815–4824. https://doi.org/10.1002/jcp.26284
10.1002/jcp.26284
Web of Science® Google Scholar
Yang, H. S., Jansen, A. P., Komar, A. A., Zheng, X., Merrick, W. C., Costes, S., … Colburn, N. H. (2003). The transformation suppressor Pdcd4 is a novel eukaryotic translation initiation factor 4A binding protein that inhibits translation. Molecular and Cellular Biology, 23(1), 26–37.
10.1128/MCB.23.1.26-37.2003
PubMed Web of Science® Google Scholar
Ye, J., Guo, R., Shi, Y., Qi, F., Guo, C., & Yang, L. (2016). MiR-155 regulated inflammation response by the SOCS1-STAT3-PDCD4 axis in atherogenesis. Mediators of Inflammation, 2016, 8060182.
10.1155/2016/8060182
PubMed Web of Science® Google Scholar
Yong, S., Yabin, Y., Bing, Z., Chuanrong, Z., Dianhua, G., Jianhuai, Z., … Ling, L. (2017). Reciprocal regulation of DGCR5 and miR-320a affects the cellular malignant phenotype and 5-FU response in pancreatic ductal adenocarcinoma. Oncotarget, 8(53), 90868–90878.
10.18632/oncotarget.18377
PubMed Google Scholar
Yu, W., Zhao, G., Cao, R., Zhu, Z., & Li, K. (2017). LncRNA NONRATT021972 was associated with neuropathic pain scoring in patients with type 2 diabetes. Behavioural Neurology, 2017, 6.
10.1155/2017/2941297
Web of Science® Google Scholar
Zhang, R., & Xia, T. (2017). Long non-coding RNA XIST regulates PDCD4 expression by interacting with miR-21-5p and inhibits osteosarcoma cell growth and metastasis. International Journal of Oncology, 51(5), 1460–1470.
10.3892/ijo.2017.4127
CAS PubMed Web of Science® Google Scholar
Zhang, Y., Mou, J., Cao, L., Zhen, S., Huang, H., & Bao, H. (2018). MicroRNA-142-3p relieves neuropathic pain by targeting high mobility group box 1. International Journal of Molecular Medicine, 41(1), 501–510.
CAS PubMed Web of Science® Google Scholar
Zhang, Y. H., He, K., & Shi, G. (2017). Effects of microRNA-499 on the inflammatory damage of endothelial cells during coronary artery disease via the targeting of PDCD4 through the NF-Kappabeta/TNF-alpha signaling pathway. Cellular Physiology and Biochemistry, 44(1), 110–124.
10.1159/000484588
CAS PubMed Web of Science® Google Scholar

Citing Literature

Volume234, Issue5

May 2019

Pages 7292-7300

DGCR5 attenuates neuropathic pain through sponging miR-330-3p and regulating PDCD4 in CCI rat models

Abstract

1 INTRODUCTION