Tanshinone IIA Combined With Rutin and Squalene Improves Hyperlipidemia to Alleviate Atherosclerosis in New Zealand Rabbits Through Upregulation of the SREBP2/LDLR Pathway
This study investigated the effects of tanshinone IIA combined with rutin and squalene (RTS) on atherosclerosis (AS) associated with hyperlipidemia and the underlying mechanisms. Female New Zealand rabbits were subjected to a hyperlipidemia and AS model. Treatment with RTS for 4 weeks reduced the weight, and some serum lipid levels include serum TC, serum TG, serum LDL-C. RTS also improved lesions of the liver and aorta. In vitro analyses showed that RTS significantly activated LDLR-mediated hepatic lipid endocytosis, but blocking LDLR activation with si-SREBP2 attenuated the therapeutic effect, which demonstrated that RTS can activate the SREBP2/LDLR pathway mediating liver clearance of blood lipids. This study highlights the therapeutic potential of RTS in hyperlipidemia and AS. As a convenient form of a combination drug, RTS has shown considerable potential in the improvement of hyperlipidemia combined with AS.
1. Introduction
Cardiovascular diseases (CVDs), the leading cause of death worldwide, have been increasing over the past few decades [1]. According to the latest data from the World Heart Federation (WHF), CVDs represented approximately 30% of all global deaths in 2021 [2]. In particular, in China, the number of patients with CVD exceeded 330 million until 2022, becoming the most serious killer threatening national health [3]. AS is a chronic vascular inflammatory disease characterized by lipid metabolism disorder, combined with oxidative stress and endothelial dysfunction, which is the basic syndrome of most CVDs [4]. Numerous studies have demonstrated that low-density lipoprotein (LDL) is an independent risk factor for atherosclerosis (AS), which can generate LDL-C to aggravate atherosclerotic lesions [5]. Therefore, lipid-lowering therapies that reduce LDL-C with statins have been recommended as the cornerstone of the medical treatment of AS. However, in view of the increasing number of CVDs worldwide and the varying levels of individual tolerance to single drugs, the development of a stable and multi-pathway compound preparation AS drug is of great significance.
Many ingredients derived from food have shown good potential for improving CVDs. Tanshinone IIA, the main lipid-soluble active component in the rhizome of Salvia miltiorrhiza [6], relieves AS in ApoE(−/−) mice by inhibiting ox-LDL-induced macrophage proliferation and migration [7]. Tanshinone IIA is also considered to have pharmacological effects such as protecting cardiomyocytes and lowering blood lipids and anti-oxidative stress [8].
Rutin is a flavonoid glycoside widely found in plants that reduces the cytotoxicity of ox-LDL in the AS process [9]. It was delineated that rutin can improve lipid metabolism by regulating the PI3K/AKT pathway [10]. Consistent with the findings from Guo, rutin treatment significantly inhibited foam cell formation by declining P62 expression but increased the LC3II/LC3I ratio in RAW 264.7 cells, which indirectly regulates the PI3K/AKT pathway [11].
Squalene, composed of six isoprene connections of unsaturated terpenoids, mainly exists in shark liver oil, olive oil, and rice bran oil and has extensive biological activity [12]. A previous study showed that squalene can exist as a natural peroxisome proliferation receptors (PPARs) ligand in lipid metabolism, promote the transcription of the PPAR coactivator, increase the expression of fatty acid β oxidation and cholesterol reverse transport-related genes, and inhibit the expression of fatty acid synthesis-related genes to regulate intracellular triglyceride (TG) and cholesterol levels in HepG2 cells [13].
To investigate the efficiency and mechanisms by which tanshinone IIA combined with rutin and squalene treatment improves the lipid profile and protects against atherogenesis, we innovatively used a chitosan embedding technology to combine tanshinone IIA, rutin, and squalene in sodium alginate–chitosan to make RTS chitosan sustained-release microcapsules. The embedding rate of three monomers in sustained-release microcapsules was determined by high-performance liquid chromatography (HPLC). We systematically measured the blood biochemical indices of New Zealand rabbits and observed the degree of liver and aortic arch lesions in pathological sections to explore the therapeutic effect of RTS on hyperlipidemia AS. Furthermore, previous transcriptomic studies have revealed that RTS activates sterol regulatory element-binding protein 2 (SREBP2) and sterol regulatory element-binding protein cleavage activating protein (SCAP) to increase the expression of LDL receptor (LDLR) in the liver. In this study, we employed an innovative and convenient sustained-release chitosan microcapsule for the first time to demonstrate that the combination of tanshinone IIA, rutin, and squalene can regulate multiple pathways to improve lipid metabolism and alleviate AS.
2. Methods
2.1. Drugs and Reagents
Tanshinone IIA (CAS: 568-72-9; purity greater than 95% by HPLC), rutin (CAS: 153-18-4; purity greater than 95% by HPLC), and squalene (CAS: 111-02-4; purity greater than 98% by HPLC) were purchased from Yuanye Biotechnology Co., Ltd. (Shanghai, China); simvastatin, chitosan, and anhydrous calcium chloride were purchased from Macklin (CN, S831014, C804726, C804726); and sodium alginate was purchased from Aladdin (CN, S278630).
2.2. Preparation and Detection of RTS Chitosan Sustained-Release Capsules
Chitosan solution was obtained by analyzing 20 mL of pure glacial acetic acid, 10 g of anhydrous calcium chloride, and 10 g of pharmaceutical chitosan in 2 L of distilled water. Tanshinone IIA 5 g, rutin 5 g, and squalene 100 g were placed in the prepared 1.5% sodium alginate that was obtained by mixing 30 g of pharmaceutical-grade sodium alginate in 2-L distilled water. Subsequently, the mixture was injected into the chitosan solution through a centrifugal sieve granulator, cured for 30 min, washed twice in distilled water, and then dried in a drying oven at 56°C to obtain RTS chitosan sustained-release microcapsules. Finally, we collected 30 g of RTS sustained-release capsules.
After crushing the appropriate RTS chitosan sustained-release capsules, 200 mg of RTS powder was weighed and dissolved in 10 mL of chromatographic grade methanol and then passed through a 0.22-μm filter membrane to remove impurities. The contents were identified by HPLC, and the embedding efficiency of the three drugs was calculated for subsequent animal administration.
2.3. Model of HFD New Zealand Rabbits
All experiments involving New Zealand rabbits were approved by the Animal Experiment Ethics Committee of Zhejiang Chinese Medicine University (approval number: I ACUC-20210816-03). One New Zealand rabbit in each cage was raised separately and adapted to standard laboratory conditions (controlled temperature 20 ± 2°C, humidity 50%–60%, light and dark cycles 12 h:12 h). The normal group of New Zealand rabbits (n = 7) was fed a 120-g standard diet (16% kcal from protein, 5.5% kcal from fat, 78.5% kcal from carbohydrate, LAD2006, Trophic Animal Feed, Jiang Su, China) every day, and the remaining New Zealand rabbits (n = 35) were fed a 120-g high-fat diet (HFD) (14.7% kcal from protein, 13% kcal from fat, and 72.3% kcal from carbohydrate and 1% cholesterol, TP2R118, Trophic, Animal Feed, Jiang Su, China). After 8 weeks of modeling, the HFD was stopped and replaced with a standard diet, and the rabbits were divided into five groups (n = 7 for each group) for 4 weeks: (1) HFD vehicle model, sodium alginate chitosan capsules 100 mg/kg, (2) simvastatin 5 mg/kg, (3) low dose of RTS (RTS L) 50 mg/kg, (4) mid-dose of RTS (RTS M) 100 mg/kg, and (5) high dose of RTS (RTS H) 200 mg/kg. The weight was measured weekly during molding and administration. At the end of treatment, New Zealand rabbits were fasted for 12 h and then euthanized. The aorta and liver tissues were cleaned with phosphate-buffered saline (PBS) and then snap-frozen in liquid N2 before storage at −80°C.
2.4. Biochemical Analysis of Serum and Liver
Blood samples were obtained from the carotid artery and placed in a 5-mL centrifuge tube with anticoagulant, followed by incubation at room temperature for 30 min and then centrifuging at 4000 g for 10 min at 4°C to obtain serum. Serum total TGs, total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) were measured using an automatic biochemical analyzer (TK-40FR, Toshiba, Japan). The liver TG and TC contents were determined using commercial kits (Jiancheng Biotechnology Inc., Nanjing, China) following the manufacturer’s instructions.
2.5. Cell Culture
Human hepatoma HepG2 cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA), cultured in DMEM with 10% (v/v) fetal bovine serum, 1% penicillin, 1% streptomycin, and 500-μmol/L oleic acid (Sigma-Aldrich, St. Louis, MO) at 37°C in a humidified atmosphere of 5% CO2.
2.6. Histopathology
The liver and aortic tissue samples were rinsed with PBS and then immersed in 4% paraformaldehyde. Liver and aorta tissues were separately embedded in paraffin and Tissue-Tek OCT compound (Sakura, Tokyo, Japan). Paraffin tissues were sliced into 4-μm-thick sections for H&E staining. Serial 10-μm-thick frozen sections were cut and stained with ORO to detect lipid deposition. Images were captured using a Zeiss Axio Observer A1 inverted microscope (Oberkochen, Germany).
2.7. Liver Transcriptome Sequencing
Total RNA was isolated with TRIzol Reagent (Invitrogen, USA). RNA purification, reverse transcription, library construction, and sequencing were performed at Majorbio Bio-pharm Biotechnology Co., Ltd. (Shanghai, China). Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) functional enrichment analysis were based on differentially expressed genes (DEGs), which were defined as a ± 2-fold change of or more and padjust < 0.05.
2.8. Dil-LDL Staining
HepG2 cells growing to 70%–80% were inoculated into 24-well plates, and five groups were set up: vehicle group, normal group, RTS 55, RTS 82.5 and RTS 110 group. After the cells successfully adhered to the wall, the vehicle group and normal group were cultured with conventional medium, and the RTS groups were cultured with the corresponding concentration of RTS for 24 h. The medium of all groups was then removed, except for the vehicle group, which was still cultured with ordinary medium, and the other groups were cultured with medium containing 25 μg/mL of Dil-LDL for 4 h; then, the medium was discarded, cleaned with PBS three times, and fixed with 4% paraformaldehyde. After 30 min of fixation, the nucleus was stained with DAPI staining solution and then observed under fluorescence microscope, and the fluorescence intensity was quantified by ImageJ.
2.9. Oil Red O Staining
HepG2 cells were digested after growth to 70%–80% density and inoculated into 24-well plates and six groups were set up: Vehicle group, model group, tanshinone group, rutin group, squalene group and RTS group. Each group was co-cultured with 500 μmol/L of oleic acid and corresponding drugs for 24 h. Then, the medium was discarded, washed three times with PBS, and fixed with 4% paraformaldehyde for 30 min. After washing with PBS, oil red dyeing solution was added for 30 min, and then the dyeing solution was discarded, isopropyl alcohol was washed for 10 s, then washed with PBS again, and the nucleus was re-dyed with hematoxylin; after the re-dyeing was completed, cells were washed with PBS and finally observed under the microscope.
2.10. Small Interfering RNA (siRNA) Assay
SREBP2 knockout in HepG2 cells was accomplished by transfecting specific SREBP2 siRNA (sc-36559, Santa Cruz, USA) following the manufacturer’s instructions. Cells plated in 6-well plates were transfected with each siRNA in serum-free DMEM medium for 24 h. Finally, the cells were cultured for 24 h with vehicle or RTS to perform western blot and qRT-PCR analyses.
Total RNA was isolated from cells or tissues using the MiniBEST Universal RNA Extraction Kit (Takara, Beijing, China). Purified RNA was quantified by ultraviolet spectrophotometry (Quawell, USA) and transcribed into cDNA using reverse transcription reagent kits (Takara, Beijing, China). Real-time PCR was performed using the Faststart Universal SYBR Green Master reagent (Roche, Switzerland) in a light cycler 480 II (Roche, Switzerland). The primers used in this study were synthesized by Qingke Biotech Co., Ltd. (Beijing, China) and are listed in Table 1. The resulting data of target genes were quantified using β-actin as the standard.
Table 1.
Primer information.
Gene
Identification
Sequence (5′–3′)
SREBP2
Forward
GCCCACGACACCGACCAG
Reverse
ACGAAGACGCTCAGGACGATG
LDLR
Forward
GTCCGTCGTCCTGCCCATC
Reverse
CTCGTCCTCCGTGGTCTTCTG
INSIG2
Forward
GGTCCAGTGTAATGCGATGTGTAG
Reverse
TAGATAGTGCAGCCAGTGTGAGAG
SCAP
Forward
TGGCTGCTCGGCTCAATGG
Reverse
CACTGTGTCACTGCTGCTGTAC
PCSK9
Forward
GATGCTGCTGCTGCTGCTG
Reverse
CTTGATTACTTCCTGGCTCCTG
β-actin
Forward
GCAAGCGTGGCATCCTGAC
Reverse
CCTCGTAGTCGCCGTCCTC
2.12. Western Blotting
Total protein isolated from cells and tissues was prepared with RIPA buffer (Boster Biological Technology, Wuhan, China) supplemented with protease inhibitors (Sigma-Aldrich, St. Louis, MO). Protein samples were separated by SDS-PAGE followed by electroblotting onto PVDF membranes (Millipore, Bedford, MA). The membranes were blocked with 1% BSA (Sigma-Aldrich, St. Louis, MO) in TBST (Servicebio, Wuhan, China) and incubated overnight at 4°C with the following primary antibodies: anti-SREBP2 (#28212-1-AP), anti-LDLR (#66414-1-Ig), anti-INSIG2 (#24766-1-AP), all from Proteintech Technology (Wuhan, China); anti-SCAP (#13102S), anti-PCSK9 (#85813S), anti-β actin (#3700S), all from Cell Signaling Technology (Danvers, MA, USA). After washing with TBST, the blots were reacted with horseradish peroxidase (HRP)-conjugated secondary antibodies (SA00001-1, SA00001-2) for 1–2 h at room temperature. After washing again with TBST, the immunoreactivity of protein expression was visualized using an electrogenerated chemiluminescence kit (Thermo Fisher, USA). Finally, the target proteins were quantified using ImageJ software.
2.13. Statistical Analysis
Data were reproduced three times and presented as the mean ± SD. Comparisons between the two groups were performed using an unpaired two-tailed Student′s t-test. Differences between groups were determined by one- or two-way ANOVA, with p values < 0.05 considered statistically significant. All analyses were performed using GraphPad Prism (9.0.0) software.
3. Results
3.1. RTS Chitosan Sustained-Release Capsule Has a Remarkable Embedding Rate
To ensure the accuracy of drug administration in animal experiments, the embedding rates of the three drugs were determined using HPLC chromatographic conditions (Figure 1(a)). The HPLC results showed obvious absorption peaks of the three drugs under the optimum conditions (Figures 1(b), 1(c), and 1(d)). According to the standard concentration calculation, the average contents of tanshinone IIA, rutin, and squalene in each sample were 1.81614, 1.10529, and 9.55049 mg/mL, respectively. Accordingly, the embedding rates were 54.4842%, 33.1587%, and 71.62868%. This indicates that the RTS chitosan sustained-release capsule had a relatively efficient embedding rate for tanshinone IIA, rutin, and squalene.
Efficiency of RTS sustained-release capsules for coating tanshinone IIA, rutin, and squalene. (a) Molecular structure diagram of tanshinone IIA, rutin, and squalene. (b) The content of tanshinone IIA in RTS sustained-release capsules was determined by HPLC. (c) The content of rutin in RTS sustained-release capsules was determined by HPLC. (d) The content of squalene in RTS sustained-release capsules was determined by HPLC.
Efficiency of RTS sustained-release capsules for coating tanshinone IIA, rutin, and squalene. (a) Molecular structure diagram of tanshinone IIA, rutin, and squalene. (b) The content of tanshinone IIA in RTS sustained-release capsules was determined by HPLC. (c) The content of rutin in RTS sustained-release capsules was determined by HPLC. (d) The content of squalene in RTS sustained-release capsules was determined by HPLC.
Efficiency of RTS sustained-release capsules for coating tanshinone IIA, rutin, and squalene. (a) Molecular structure diagram of tanshinone IIA, rutin, and squalene. (b) The content of tanshinone IIA in RTS sustained-release capsules was determined by HPLC. (c) The content of rutin in RTS sustained-release capsules was determined by HPLC. (d) The content of squalene in RTS sustained-release capsules was determined by HPLC.
Efficiency of RTS sustained-release capsules for coating tanshinone IIA, rutin, and squalene. (a) Molecular structure diagram of tanshinone IIA, rutin, and squalene. (b) The content of tanshinone IIA in RTS sustained-release capsules was determined by HPLC. (c) The content of rutin in RTS sustained-release capsules was determined by HPLC. (d) The content of squalene in RTS sustained-release capsules was determined by HPLC.
3.2. RTS Improves Serum and Liver Lipid Indices in New Zealand Rabbits
Next, to explore the potential lipid-lowering effects of RTS, New Zealand rabbits were fed a high-fat high-cholesterol diet (HFD) for 8 weeks and then administered RTS (Figure 2(a)). The results showed no significant difference in body weight among the groups before the treatment; however, at the end of the course of administration, all three doses of RTS and simvastatin led to significantly reduced body weight in the treated rabbits (Figures 2(b) and 2(c)). The serum biochemical indices of New Zealand rabbits were also examined after administration, the results of which demonstrated significantly higher serum TG, TC, and LDL-C levels in the HFD group but with significant decreases in the beneficial factor, serum HDL-C. However, all dose groups of RTS reduced serum TG, TC, and LDL-C but showed no significant effects on the serum levels of HDL-C (Figures 2(d), 2(e), 2(f), and 2(g)). In addition, the levels of liver TG and TC changed in each group were similar to those in serum (Figures 2(h) and 2(i)). In conclusion, the serum and liver lipid results demonstrated that RTS could significantly improve lipid metabolism in New Zealand rabbits.
RTS ameliorated HFD-induced dyslipidemia in HFD New Zealand rabbits. (a) Animal experimental flowchart. (b) and (c) RTS administration affects body weight in New Zealand rabbits (n = 5). (d)–(g) Total cholesterol (TC), total triglycerides (TGs), LDL-cholesterol, and HDL-cholesterol serum levels in New Zealand rabbits (n = 5). (e) and (f) TC and TG levels in the liver of New Zealand rabbits (n = 5). RTS L: RTS low-dose group, RTS M: RTS mid-dose group, RTS H: RTS high-dose group. Results are presented as mean ± SD. #represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS ameliorated HFD-induced dyslipidemia in HFD New Zealand rabbits. (a) Animal experimental flowchart. (b) and (c) RTS administration affects body weight in New Zealand rabbits (n = 5). (d)–(g) Total cholesterol (TC), total triglycerides (TGs), LDL-cholesterol, and HDL-cholesterol serum levels in New Zealand rabbits (n = 5). (e) and (f) TC and TG levels in the liver of New Zealand rabbits (n = 5). RTS L: RTS low-dose group, RTS M: RTS mid-dose group, RTS H: RTS high-dose group. Results are presented as mean ± SD. #represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS ameliorated HFD-induced dyslipidemia in HFD New Zealand rabbits. (a) Animal experimental flowchart. (b) and (c) RTS administration affects body weight in New Zealand rabbits (n = 5). (d)–(g) Total cholesterol (TC), total triglycerides (TGs), LDL-cholesterol, and HDL-cholesterol serum levels in New Zealand rabbits (n = 5). (e) and (f) TC and TG levels in the liver of New Zealand rabbits (n = 5). RTS L: RTS low-dose group, RTS M: RTS mid-dose group, RTS H: RTS high-dose group. Results are presented as mean ± SD. #represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS ameliorated HFD-induced dyslipidemia in HFD New Zealand rabbits. (a) Animal experimental flowchart. (b) and (c) RTS administration affects body weight in New Zealand rabbits (n = 5). (d)–(g) Total cholesterol (TC), total triglycerides (TGs), LDL-cholesterol, and HDL-cholesterol serum levels in New Zealand rabbits (n = 5). (e) and (f) TC and TG levels in the liver of New Zealand rabbits (n = 5). RTS L: RTS low-dose group, RTS M: RTS mid-dose group, RTS H: RTS high-dose group. Results are presented as mean ± SD. #represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS ameliorated HFD-induced dyslipidemia in HFD New Zealand rabbits. (a) Animal experimental flowchart. (b) and (c) RTS administration affects body weight in New Zealand rabbits (n = 5). (d)–(g) Total cholesterol (TC), total triglycerides (TGs), LDL-cholesterol, and HDL-cholesterol serum levels in New Zealand rabbits (n = 5). (e) and (f) TC and TG levels in the liver of New Zealand rabbits (n = 5). RTS L: RTS low-dose group, RTS M: RTS mid-dose group, RTS H: RTS high-dose group. Results are presented as mean ± SD. #represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS ameliorated HFD-induced dyslipidemia in HFD New Zealand rabbits. (a) Animal experimental flowchart. (b) and (c) RTS administration affects body weight in New Zealand rabbits (n = 5). (d)–(g) Total cholesterol (TC), total triglycerides (TGs), LDL-cholesterol, and HDL-cholesterol serum levels in New Zealand rabbits (n = 5). (e) and (f) TC and TG levels in the liver of New Zealand rabbits (n = 5). RTS L: RTS low-dose group, RTS M: RTS mid-dose group, RTS H: RTS high-dose group. Results are presented as mean ± SD. #represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS ameliorated HFD-induced dyslipidemia in HFD New Zealand rabbits. (a) Animal experimental flowchart. (b) and (c) RTS administration affects body weight in New Zealand rabbits (n = 5). (d)–(g) Total cholesterol (TC), total triglycerides (TGs), LDL-cholesterol, and HDL-cholesterol serum levels in New Zealand rabbits (n = 5). (e) and (f) TC and TG levels in the liver of New Zealand rabbits (n = 5). RTS L: RTS low-dose group, RTS M: RTS mid-dose group, RTS H: RTS high-dose group. Results are presented as mean ± SD. #represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS ameliorated HFD-induced dyslipidemia in HFD New Zealand rabbits. (a) Animal experimental flowchart. (b) and (c) RTS administration affects body weight in New Zealand rabbits (n = 5). (d)–(g) Total cholesterol (TC), total triglycerides (TGs), LDL-cholesterol, and HDL-cholesterol serum levels in New Zealand rabbits (n = 5). (e) and (f) TC and TG levels in the liver of New Zealand rabbits (n = 5). RTS L: RTS low-dose group, RTS M: RTS mid-dose group, RTS H: RTS high-dose group. Results are presented as mean ± SD. #represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS ameliorated HFD-induced dyslipidemia in HFD New Zealand rabbits. (a) Animal experimental flowchart. (b) and (c) RTS administration affects body weight in New Zealand rabbits (n = 5). (d)–(g) Total cholesterol (TC), total triglycerides (TGs), LDL-cholesterol, and HDL-cholesterol serum levels in New Zealand rabbits (n = 5). (e) and (f) TC and TG levels in the liver of New Zealand rabbits (n = 5). RTS L: RTS low-dose group, RTS M: RTS mid-dose group, RTS H: RTS high-dose group. Results are presented as mean ± SD. #represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
3.3. RTS Reduced Hepatic Lipid Lesions and Aortic Foam Formation
We further investigated the effects of RTS on liver and aortic lesions in New Zealand rabbits through H&E and ORO staining, which showed that the untreated rabbits had extensive vacuolar steatosis and intracellular fat accumulation in the liver. As expected, all dose groups of rabbits treated with simvastatin and RTS showed significant improvement in hepatic steatosis and intracellular fat accumulation (Figures 3(a) and 3(b)). Quantitative analysis showed that the effect of low dose of RTS (RTS L) treatment on liver lipid accumulation was similar to that in the simvastatin group, and higher doses of RTS (RTS H) treatment showed better therapeutic effects (Figure 3(e)). We also found severe foam cells and lipid accumulation in the aorta of the HFD group (Figures 3(c) and 3(d)). Correspondingly, the extent of lesions was alleviated in each administration group, especially the treatment with simvastatin, which significantly improved foam formation and lipid accumulation in the aorta (Figure 3(f)). In summary, RTS administration can effectively inhibit hepatic steatosis and alleviate aortic lesions in New Zealand rabbits.
RTS treatment improved the development of atherosclerotic and liver steatosis in HFD New Zealand rabbits. (a, b) Representative photomicrographs of oil red O and H&E staining of the liver from New Zealand rabbits. (c, d) Representative photomicrographs of oil red O and H&E staining of the aortic from New Zealand rabbits. (e, f) Oil red O staining area of liver and aortic (n = 5). Results are presented as mean ± SD. #represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS treatment improved the development of atherosclerotic and liver steatosis in HFD New Zealand rabbits. (a, b) Representative photomicrographs of oil red O and H&E staining of the liver from New Zealand rabbits. (c, d) Representative photomicrographs of oil red O and H&E staining of the aortic from New Zealand rabbits. (e, f) Oil red O staining area of liver and aortic (n = 5). Results are presented as mean ± SD. #represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS treatment improved the development of atherosclerotic and liver steatosis in HFD New Zealand rabbits. (a, b) Representative photomicrographs of oil red O and H&E staining of the liver from New Zealand rabbits. (c, d) Representative photomicrographs of oil red O and H&E staining of the aortic from New Zealand rabbits. (e, f) Oil red O staining area of liver and aortic (n = 5). Results are presented as mean ± SD. #represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS treatment improved the development of atherosclerotic and liver steatosis in HFD New Zealand rabbits. (a, b) Representative photomicrographs of oil red O and H&E staining of the liver from New Zealand rabbits. (c, d) Representative photomicrographs of oil red O and H&E staining of the aortic from New Zealand rabbits. (e, f) Oil red O staining area of liver and aortic (n = 5). Results are presented as mean ± SD. #represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS treatment improved the development of atherosclerotic and liver steatosis in HFD New Zealand rabbits. (a, b) Representative photomicrographs of oil red O and H&E staining of the liver from New Zealand rabbits. (c, d) Representative photomicrographs of oil red O and H&E staining of the aortic from New Zealand rabbits. (e, f) Oil red O staining area of liver and aortic (n = 5). Results are presented as mean ± SD. #represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS treatment improved the development of atherosclerotic and liver steatosis in HFD New Zealand rabbits. (a, b) Representative photomicrographs of oil red O and H&E staining of the liver from New Zealand rabbits. (c, d) Representative photomicrographs of oil red O and H&E staining of the aortic from New Zealand rabbits. (e, f) Oil red O staining area of liver and aortic (n = 5). Results are presented as mean ± SD. #represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
3.4. Transcriptome Analysis Revealed That RTS Induced Changes in Lipid Metabolism-Related Genes in the Liver
The liver is the center of lipid metabolism regulation in the body [14], and RTS ameliorated serum lipid levels in HFD New Zealand rabbits (Figures 2(d), 2(e), 2(g), and 2(h)). Next, we performed transcriptome analysis to reveal the RTS-induced gene alterations that may affect the process of hyperlipidemia and AS. The principal component analysis (PCA) results showed that compared with the HFD group, the changes in the RTS H group were similar to those in the normal group (Figure 4(a)). Then, the Veen map showed 11,805 genes in common between the model group and the RTS H group (Figure 4(b)). As illustrated, 2602 DEGs were identified between the normal and HFD groups (1082 up-regulated and 1520 down-regulated; Figure 4(d)). Meanwhile, 457 DEGs were identified between the HFD and RTS H groups (246 up-regulated and 211 down-regulated; Figures 4(c) and 4(d)). Accordingly, the changes in the DEGs are shown in a heatmap (Figure 4(e)). Then, the gene set that included 457 DEGs was applied to GO annotation analysis, which showed significant differences in lipid and carbohydrate metabolism (Figure 4(f)). The same gene set was then substituted for KEGG enrichment analysis, which revealed that cholesterol regulates signaling in significantly enrichment pathways (Figure 4(g)). Summarizing the results obtained by transcriptome analysis, RTS may improve hyperlipidemia and alleviate AS by regulating the cholesterol metabolism pathway.
The effects of RTS on lipid metabolism in New Zealand rabbits analyzed with hepatic transcriptomics. (a) The principal component analysis (PCA) among normal, HFD, and RTS H groups. (b) Venn diagram of HFD and RTS H groups. (c) Volcano plot of differential gene expression analysis of the hepatic transcriptome between HFD and RTS H groups. (d) The number of differentially expressed genes (DEGs) identified between groups, fold change (FC) > 2, padjust < 0.05. (e) Heatmap analysis of differential genes among normal, HFD, and RTS H groups. (f) Enrichment analysis of Gene Ontology (GO) metabolic pathway in liver tissues. (g) Enrichment analysis of Kyoto Encyclopedia of Genes and Genome (KEGG) metabolic pathway in liver tissues. Data are presented as mean ± SD (n = 3). #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
The effects of RTS on lipid metabolism in New Zealand rabbits analyzed with hepatic transcriptomics. (a) The principal component analysis (PCA) among normal, HFD, and RTS H groups. (b) Venn diagram of HFD and RTS H groups. (c) Volcano plot of differential gene expression analysis of the hepatic transcriptome between HFD and RTS H groups. (d) The number of differentially expressed genes (DEGs) identified between groups, fold change (FC) > 2, padjust < 0.05. (e) Heatmap analysis of differential genes among normal, HFD, and RTS H groups. (f) Enrichment analysis of Gene Ontology (GO) metabolic pathway in liver tissues. (g) Enrichment analysis of Kyoto Encyclopedia of Genes and Genome (KEGG) metabolic pathway in liver tissues. Data are presented as mean ± SD (n = 3). #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
The effects of RTS on lipid metabolism in New Zealand rabbits analyzed with hepatic transcriptomics. (a) The principal component analysis (PCA) among normal, HFD, and RTS H groups. (b) Venn diagram of HFD and RTS H groups. (c) Volcano plot of differential gene expression analysis of the hepatic transcriptome between HFD and RTS H groups. (d) The number of differentially expressed genes (DEGs) identified between groups, fold change (FC) > 2, padjust < 0.05. (e) Heatmap analysis of differential genes among normal, HFD, and RTS H groups. (f) Enrichment analysis of Gene Ontology (GO) metabolic pathway in liver tissues. (g) Enrichment analysis of Kyoto Encyclopedia of Genes and Genome (KEGG) metabolic pathway in liver tissues. Data are presented as mean ± SD (n = 3). #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
The effects of RTS on lipid metabolism in New Zealand rabbits analyzed with hepatic transcriptomics. (a) The principal component analysis (PCA) among normal, HFD, and RTS H groups. (b) Venn diagram of HFD and RTS H groups. (c) Volcano plot of differential gene expression analysis of the hepatic transcriptome between HFD and RTS H groups. (d) The number of differentially expressed genes (DEGs) identified between groups, fold change (FC) > 2, padjust < 0.05. (e) Heatmap analysis of differential genes among normal, HFD, and RTS H groups. (f) Enrichment analysis of Gene Ontology (GO) metabolic pathway in liver tissues. (g) Enrichment analysis of Kyoto Encyclopedia of Genes and Genome (KEGG) metabolic pathway in liver tissues. Data are presented as mean ± SD (n = 3). #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
The effects of RTS on lipid metabolism in New Zealand rabbits analyzed with hepatic transcriptomics. (a) The principal component analysis (PCA) among normal, HFD, and RTS H groups. (b) Venn diagram of HFD and RTS H groups. (c) Volcano plot of differential gene expression analysis of the hepatic transcriptome between HFD and RTS H groups. (d) The number of differentially expressed genes (DEGs) identified between groups, fold change (FC) > 2, padjust < 0.05. (e) Heatmap analysis of differential genes among normal, HFD, and RTS H groups. (f) Enrichment analysis of Gene Ontology (GO) metabolic pathway in liver tissues. (g) Enrichment analysis of Kyoto Encyclopedia of Genes and Genome (KEGG) metabolic pathway in liver tissues. Data are presented as mean ± SD (n = 3). #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
The effects of RTS on lipid metabolism in New Zealand rabbits analyzed with hepatic transcriptomics. (a) The principal component analysis (PCA) among normal, HFD, and RTS H groups. (b) Venn diagram of HFD and RTS H groups. (c) Volcano plot of differential gene expression analysis of the hepatic transcriptome between HFD and RTS H groups. (d) The number of differentially expressed genes (DEGs) identified between groups, fold change (FC) > 2, padjust < 0.05. (e) Heatmap analysis of differential genes among normal, HFD, and RTS H groups. (f) Enrichment analysis of Gene Ontology (GO) metabolic pathway in liver tissues. (g) Enrichment analysis of Kyoto Encyclopedia of Genes and Genome (KEGG) metabolic pathway in liver tissues. Data are presented as mean ± SD (n = 3). #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
The effects of RTS on lipid metabolism in New Zealand rabbits analyzed with hepatic transcriptomics. (a) The principal component analysis (PCA) among normal, HFD, and RTS H groups. (b) Venn diagram of HFD and RTS H groups. (c) Volcano plot of differential gene expression analysis of the hepatic transcriptome between HFD and RTS H groups. (d) The number of differentially expressed genes (DEGs) identified between groups, fold change (FC) > 2, padjust < 0.05. (e) Heatmap analysis of differential genes among normal, HFD, and RTS H groups. (f) Enrichment analysis of Gene Ontology (GO) metabolic pathway in liver tissues. (g) Enrichment analysis of Kyoto Encyclopedia of Genes and Genome (KEGG) metabolic pathway in liver tissues. Data are presented as mean ± SD (n = 3). #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
3.5. RTS Activates the SREBP2/LDLR Signaling Pathway in the Liver
To investigate the possible mechanism of RTS in improving hepatic cholesterol metabolism, we next determined the transcriptional regulation of LDLR, which is primarily responsible for maintaining cholesterol homeostasis and plays a pivotal role in AS [15]. The protein and gene expression of LDLR were significantly decreased in the HFD group and increased after treatment with simvastatin or RTS H (Figures 5(a), 5(b), and 5(c)). Considering that SREBP2 is an upstream regulatory factor of LDLR, the related target genes of the SREBP2/LDLR signaling pathway were examined by western blotting and qRT-PCR. The results showed that RTS treatment enhanced the mRNA expression of SREBP2, SCAP, and LDLR (Figures 5(c), 5(d), and 5(f)), but the expression of INSIG2 was not affected (Figure 5(g)); the corresponding proteins showed the same trend (Figure 5(b)). However, with PCSK9 as a counterregulatory factor, the changes in mRNA and protein expression between the HFD and RTS H groups were not significant (Figures 5(b) and 5(e)). These results suggest that RTS activates the upstream transcription factors SREBP2 and SCAP to enhance the expression of LDLR. Meanwhile, as a factor positively regulated by SREBP2, the protein level of PCSK9 implies that RTS partly inhibits its expression.
RTS administration improves liver LDLR expression in New Zealand rabbits. (a) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in the liver of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (b) Quantification of SREBP2, LDLR, SCAP, PCSK9, and INSIG2 protein levels (n = 3). (c)–(g) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS administration improves liver LDLR expression in New Zealand rabbits. (a) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in the liver of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (b) Quantification of SREBP2, LDLR, SCAP, PCSK9, and INSIG2 protein levels (n = 3). (c)–(g) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS administration improves liver LDLR expression in New Zealand rabbits. (a) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in the liver of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (b) Quantification of SREBP2, LDLR, SCAP, PCSK9, and INSIG2 protein levels (n = 3). (c)–(g) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS administration improves liver LDLR expression in New Zealand rabbits. (a) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in the liver of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (b) Quantification of SREBP2, LDLR, SCAP, PCSK9, and INSIG2 protein levels (n = 3). (c)–(g) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS administration improves liver LDLR expression in New Zealand rabbits. (a) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in the liver of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (b) Quantification of SREBP2, LDLR, SCAP, PCSK9, and INSIG2 protein levels (n = 3). (c)–(g) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS administration improves liver LDLR expression in New Zealand rabbits. (a) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in the liver of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (b) Quantification of SREBP2, LDLR, SCAP, PCSK9, and INSIG2 protein levels (n = 3). (c)–(g) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS administration improves liver LDLR expression in New Zealand rabbits. (a) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in the liver of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (b) Quantification of SREBP2, LDLR, SCAP, PCSK9, and INSIG2 protein levels (n = 3). (c)–(g) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus normal, ∗represents significance versus HFD. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
3.6. RTS Increased LDL Endocytosis in HepG2 Cells by Activating the SREBP2/LDLR Pathway
As confirmed by transcriptomic and animal data analyses, we further verified RTS-mediated LDL endocytosis in HepG2 cells. Consistently, the 50% inhibitory concentration reached 550 μM (tanshinone IIA:rutin:squalene = 1:2:8) in the cell viability assays (Figures 6(a) and 6(b)). It was observed under a fluorescence microscope that RTS significantly up-regulated Dil-labeled LDL endocytosis from 55 to 110 μM (Figures 6(c) and 6(d)). We subsequently determined the LDLR protein expression level of HepG2 cells, which was consistent with the results shown by fluorescence. RTS treatment at both 55- and 82.5-μM doses significantly increased the protein level of LDLR, but 110-μM RTS treatment had no significant effect (Figures 6(e) and 6(f)). Considering that SREBP2 is a direct upstream regulator of LDLR, we next examined the changes in protein and gene expression levels of SREBP2/LDLR pathway-related factors. In agreement with the data from the New Zealand rabbit liver, RTS treatment increased the protein and gene expression levels of SREBP2 and SCAP (Figures 6(e), 6(f), 6(g), 6(h), and 6(i)) but significantly decreased the expression of INSIG2 (Figures 6(f) and 6(k)), which can inhibit the transfer of the SREBP2/SCAP complex from the endoplasmic reticulum (ER) to the Golgi [16]. Interestingly, the administration of the three doses did not significantly change PCSK9 expression (Figures 6(e), 6(f), and 6(j)). Taken together, these results confirm that RTS enhanced cellular LDLR expression and mediated LDL uptake.
RTS administration increased LDL uptake in HepG2 cells. (a) The cytotoxicity of RTS administration detected by CCK-8 (n = 3). (b) The cell inhibition rate of each administration group (n = 3). (d) Fluorescence microscopy showed that RTS increased the Dil-LDL uptake in HepG2 cells and (c) quantification of the mean fluorescence intensity (MFI) of Dil-LDL (n = 3). (e) and (f) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (g)–(k) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #represents significance versus vehicle, ∗represents significance versus model. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS administration increased LDL uptake in HepG2 cells. (a) The cytotoxicity of RTS administration detected by CCK-8 (n = 3). (b) The cell inhibition rate of each administration group (n = 3). (d) Fluorescence microscopy showed that RTS increased the Dil-LDL uptake in HepG2 cells and (c) quantification of the mean fluorescence intensity (MFI) of Dil-LDL (n = 3). (e) and (f) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (g)–(k) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #represents significance versus vehicle, ∗represents significance versus model. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS administration increased LDL uptake in HepG2 cells. (a) The cytotoxicity of RTS administration detected by CCK-8 (n = 3). (b) The cell inhibition rate of each administration group (n = 3). (d) Fluorescence microscopy showed that RTS increased the Dil-LDL uptake in HepG2 cells and (c) quantification of the mean fluorescence intensity (MFI) of Dil-LDL (n = 3). (e) and (f) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (g)–(k) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #represents significance versus vehicle, ∗represents significance versus model. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS administration increased LDL uptake in HepG2 cells. (a) The cytotoxicity of RTS administration detected by CCK-8 (n = 3). (b) The cell inhibition rate of each administration group (n = 3). (d) Fluorescence microscopy showed that RTS increased the Dil-LDL uptake in HepG2 cells and (c) quantification of the mean fluorescence intensity (MFI) of Dil-LDL (n = 3). (e) and (f) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (g)–(k) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #represents significance versus vehicle, ∗represents significance versus model. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS administration increased LDL uptake in HepG2 cells. (a) The cytotoxicity of RTS administration detected by CCK-8 (n = 3). (b) The cell inhibition rate of each administration group (n = 3). (d) Fluorescence microscopy showed that RTS increased the Dil-LDL uptake in HepG2 cells and (c) quantification of the mean fluorescence intensity (MFI) of Dil-LDL (n = 3). (e) and (f) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (g)–(k) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #represents significance versus vehicle, ∗represents significance versus model. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS administration increased LDL uptake in HepG2 cells. (a) The cytotoxicity of RTS administration detected by CCK-8 (n = 3). (b) The cell inhibition rate of each administration group (n = 3). (d) Fluorescence microscopy showed that RTS increased the Dil-LDL uptake in HepG2 cells and (c) quantification of the mean fluorescence intensity (MFI) of Dil-LDL (n = 3). (e) and (f) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (g)–(k) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #represents significance versus vehicle, ∗represents significance versus model. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS administration increased LDL uptake in HepG2 cells. (a) The cytotoxicity of RTS administration detected by CCK-8 (n = 3). (b) The cell inhibition rate of each administration group (n = 3). (d) Fluorescence microscopy showed that RTS increased the Dil-LDL uptake in HepG2 cells and (c) quantification of the mean fluorescence intensity (MFI) of Dil-LDL (n = 3). (e) and (f) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (g)–(k) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #represents significance versus vehicle, ∗represents significance versus model. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS administration increased LDL uptake in HepG2 cells. (a) The cytotoxicity of RTS administration detected by CCK-8 (n = 3). (b) The cell inhibition rate of each administration group (n = 3). (d) Fluorescence microscopy showed that RTS increased the Dil-LDL uptake in HepG2 cells and (c) quantification of the mean fluorescence intensity (MFI) of Dil-LDL (n = 3). (e) and (f) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (g)–(k) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #represents significance versus vehicle, ∗represents significance versus model. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS administration increased LDL uptake in HepG2 cells. (a) The cytotoxicity of RTS administration detected by CCK-8 (n = 3). (b) The cell inhibition rate of each administration group (n = 3). (d) Fluorescence microscopy showed that RTS increased the Dil-LDL uptake in HepG2 cells and (c) quantification of the mean fluorescence intensity (MFI) of Dil-LDL (n = 3). (e) and (f) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (g)–(k) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #represents significance versus vehicle, ∗represents significance versus model. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS administration increased LDL uptake in HepG2 cells. (a) The cytotoxicity of RTS administration detected by CCK-8 (n = 3). (b) The cell inhibition rate of each administration group (n = 3). (d) Fluorescence microscopy showed that RTS increased the Dil-LDL uptake in HepG2 cells and (c) quantification of the mean fluorescence intensity (MFI) of Dil-LDL (n = 3). (e) and (f) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (g)–(k) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #represents significance versus vehicle, ∗represents significance versus model. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS administration increased LDL uptake in HepG2 cells. (a) The cytotoxicity of RTS administration detected by CCK-8 (n = 3). (b) The cell inhibition rate of each administration group (n = 3). (d) Fluorescence microscopy showed that RTS increased the Dil-LDL uptake in HepG2 cells and (c) quantification of the mean fluorescence intensity (MFI) of Dil-LDL (n = 3). (e) and (f) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (g)–(k) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #represents significance versus vehicle, ∗represents significance versus model. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
3.7. RTS Increases the Expression of LDLR by Activating SREBP2
To further confirm whether LDLR elevation was induced by SREBP2 activation, HepG2 cells were transfected with SREBP2 siRNA or negative control siRNA. Transfection with the negative control siRNA showed no significant change in the expression of SREBP2. The SREBP2 knockdown group was successfully validated and showed a significant reduction in LDLR, but treatment with RTS for 24 h failed to restore the expression of SREBP2 and LDLR (Figures 7(a) and 7(b)). Consistently, the protein expression of INSIG2 was not significantly changed after transfection with SREBP2 siRNA but decreased after RTS administration. However, the protein expression of LDLR was not upregulated, which suggest that inhibiting the INSIG2 expression did not promote SREBP2 to activate the expression of LDLR (Figure 7(a)). In general, the gene expression levels of LDLR, SREBP2, SCAP, PCSK9, and INSIG2 also showed a trend of consistency with proteins (Figures 7(c), 7(d), 7(e), 7(f), and 7(g)). This highlights the importance of the SREBP2/LDLR pathway and confirms that RTS targets the activation of SREBP2 to increase LDLR expression.
RTS increases the expression of LDLR by activating SREBP2. (a, b) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (c)–(g) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus normal, ∗represents significance versus vehicle. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS increases the expression of LDLR by activating SREBP2. (a, b) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (c)–(g) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus normal, ∗represents significance versus vehicle. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS increases the expression of LDLR by activating SREBP2. (a, b) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (c)–(g) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus normal, ∗represents significance versus vehicle. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS increases the expression of LDLR by activating SREBP2. (a, b) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (c)–(g) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus normal, ∗represents significance versus vehicle. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS increases the expression of LDLR by activating SREBP2. (a, b) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (c)–(g) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus normal, ∗represents significance versus vehicle. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS increases the expression of LDLR by activating SREBP2. (a, b) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (c)–(g) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus normal, ∗represents significance versus vehicle. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS increases the expression of LDLR by activating SREBP2. (a, b) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (c)–(g) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus normal, ∗represents significance versus vehicle. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
3.8. RTS Combined Administration Synergically Enhanced Lipid Metabolism in HepG2 Cells Compared With Single Component
Previous in vivo and in vitro experiments have demonstrated that RTS can enhance liver lipid absorption and metabolism by activating the SREBP2/LDLR signaling pathway. In order to further demonstrate the advantages of RTS synergistic administration, HepG2 cells were used for high lipid modeling and administration, and then the expression of related proteins and genes was observed and characterized. Oil Red O staining showed that lipid accumulation was the most serious in the model group, and lipid accumulation in the other single-administration groups was alleviated, but the decrease of lipid droplets in the RTS group was the most obvious (Figures 8(a), 8(b)). Accordingly, it was observed that rutin and squalene both increased the expression of SREBP2, SCAP, and LDLR proteins when administered alone, while RTS had a more significant effect after administration (Figures 8(c) and 8(d)). Consistent with the results of previous experiments, there was no significant effect on the expression of PCSK9 in all administration groups (Figures 8(c) and 8(d)). The expression of each gene was consistent with the trend of protein expression (Figures 8(e), 8(f), 8(g), 8(h), and 8(i)).
RTS combined administration synergically enhanced lipid metabolism in HepG2 cells compared with single component (tanshinone IIA 7.5 μM, rutin 15 μM, squalene 60 μM, RTS 82.5 μM). (a) Oil red O staining (b) and lipid drop quantification of HepG2 cells. (c, d) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (e)–(i) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus vehicle, ∗represents significance versus model. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS combined administration synergically enhanced lipid metabolism in HepG2 cells compared with single component (tanshinone IIA 7.5 μM, rutin 15 μM, squalene 60 μM, RTS 82.5 μM). (a) Oil red O staining (b) and lipid drop quantification of HepG2 cells. (c, d) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (e)–(i) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus vehicle, ∗represents significance versus model. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS combined administration synergically enhanced lipid metabolism in HepG2 cells compared with single component (tanshinone IIA 7.5 μM, rutin 15 μM, squalene 60 μM, RTS 82.5 μM). (a) Oil red O staining (b) and lipid drop quantification of HepG2 cells. (c, d) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (e)–(i) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus vehicle, ∗represents significance versus model. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS combined administration synergically enhanced lipid metabolism in HepG2 cells compared with single component (tanshinone IIA 7.5 μM, rutin 15 μM, squalene 60 μM, RTS 82.5 μM). (a) Oil red O staining (b) and lipid drop quantification of HepG2 cells. (c, d) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (e)–(i) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus vehicle, ∗represents significance versus model. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS combined administration synergically enhanced lipid metabolism in HepG2 cells compared with single component (tanshinone IIA 7.5 μM, rutin 15 μM, squalene 60 μM, RTS 82.5 μM). (a) Oil red O staining (b) and lipid drop quantification of HepG2 cells. (c, d) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (e)–(i) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus vehicle, ∗represents significance versus model. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS combined administration synergically enhanced lipid metabolism in HepG2 cells compared with single component (tanshinone IIA 7.5 μM, rutin 15 μM, squalene 60 μM, RTS 82.5 μM). (a) Oil red O staining (b) and lipid drop quantification of HepG2 cells. (c, d) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (e)–(i) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus vehicle, ∗represents significance versus model. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS combined administration synergically enhanced lipid metabolism in HepG2 cells compared with single component (tanshinone IIA 7.5 μM, rutin 15 μM, squalene 60 μM, RTS 82.5 μM). (a) Oil red O staining (b) and lipid drop quantification of HepG2 cells. (c, d) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (e)–(i) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus vehicle, ∗represents significance versus model. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS combined administration synergically enhanced lipid metabolism in HepG2 cells compared with single component (tanshinone IIA 7.5 μM, rutin 15 μM, squalene 60 μM, RTS 82.5 μM). (a) Oil red O staining (b) and lipid drop quantification of HepG2 cells. (c, d) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (e)–(i) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus vehicle, ∗represents significance versus model. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
RTS combined administration synergically enhanced lipid metabolism in HepG2 cells compared with single component (tanshinone IIA 7.5 μM, rutin 15 μM, squalene 60 μM, RTS 82.5 μM). (a) Oil red O staining (b) and lipid drop quantification of HepG2 cells. (c, d) LDLR, SREBP2, SCAP, PCSK9, and INSIG2 protein levels in HepG2 cells of each group were detected by western blotting, with β-actin used as a loading control (n = 3). (e)–(i) SREBP2, LDLR, SCAP, PCSK9, and INSIG2 mRNA levels were detected by qRT-PCR. Data are presented as mean ± SD (n = 3). #Represents significance versus vehicle, ∗represents significance versus model. #p < 0.05, ##p < 0.01, ∗p < 0.05, and ∗∗p < 0.01.
4. Discussion
Tanshinone IIA and rutin, as mature monomers in traditional Chinese medicine, have been shown to mediate a variety of signaling pathways to improve lipid metabolism and vascular inflammation [17]. As an intermediate product of lipid metabolism, squalene intervenes and regulates the process of lipid metabolism. However, research on the improvement of lipid metabolism and AS by the three drugs is not comprehensive. New Zealand rabbits, as a classic animal model of AS, benefited the discovery of statins [18]. In this study, we established an oxLDL-induced model of HepG2 cells and an AS model of HFD-induced New Zealand rabbits, in which the anti-atherosclerotic effect of RTS was analyzed, as well as its potential mechanism. Our investigation conclusively revealed that RTS reduced TG, TC, and LDL-C levels in HFD New Zealand rabbits (Figures 2(d), 2(e), and 2(f)). RTS also improved lipid accumulation in the aorta, thus alleviating atherogenic foam formation (Figures 3(c) and 3(d)). These effects were attributed to the activation of the SREBP2/LDLR pathway, which can increase the degradation of cholesterol in the liver and reduce the accumulation of cholesterol in the aorta to alleviate AS progression.
The liver is an essential metabolic organ involved in lipid homeostasis [19]. In a high-fat state, excess LDL is converted into LDL-C in the blood, which becomes an independent risk factor for AS [20]. Enhancing hepatic LDLR-mediated LDL endocytosis and degradation in the liver plays an important role in clearing blood cholesterol accumulation [21]. PCSK9 inhibitors also improve hyperlipidemia by reducing LDLR degradation [22]. However, as a common upstream regulator of PCSK9 and LDLR, SREBP2 regulates the homeostasis of hepatic cholesterol metabolism [23]. Consistently, this study demonstrated an RTS-induced increase in the SREBP2 protein level, along with enhanced expression of LDLR. Consequently, this inhibited the process of vascular foam formation. Notably, siRNA-mediated SREBP2 knockdown significantly reversed RTS-mediated LDLR upregulation and reduced LDL endocytosis in HepG2 cells. These results underscore the pivotal role of RTS in improving AS through the activation of the SREBP2/LDLR pathway (Figure 9).
RTS improves lipid metabolism and alleviates atherosclerosis by activating the SREBP2/LDLR pathway.
The mechanisms of hepatic lipid homeostasis are complex, and the expression of LDLR is mainly regulated by the transcription factor SREBP2 [24]. The SREBP2/INSIG2 complex anchored in the ER is replaced by the SREBP2/SCAP complex when the intracellular cholesterol content decreases [25], and the complex is then translocated from the ER to the Golgi apparatus, Finally, mature SREBP2 binds to the corresponding target genes to activate the pathway [26]. Therefore, we investigated the effect of RTS on the mRNA and protein levels of SREBP2 and its target genes, confirming its ability to activate SREBP2 and LDLR in New Zealand rabbits (Figures 5(a), 5(b), 5(c), and 5(d)), with consistent results obtained in HepG2 cells (Figures 6(e), 6(f), 6(g), and 6(h)). Transfection with SREBP2 siRNA decreased SREBP2 and LDLR expression, which is difficult to recover even after RTS treatment (Figures 7(c), 7(d), 7(e), and 7(f)). The significant difference in SCAP expression may be due to the increased expression of the ligand SREBP2 (Figures 5(a), 5(b), and 5(e)).
We also found that RTS activated SREBP2 and related target genes but did not promote PCSK9-mediated LDLR degradation (Figures 5(a) and 5(b), and 6E and F). As a negative regulator of LDLR, PCSK9 is regulated by SREBP2 and binds LDLR into lysosomes to promote its degradation and maintain cholesterol metabolic homeostasis [27]. In addition, RTS reduced the mRNA and protein levels of INSIG2, which facilitated the binding of SREBP2 and SCAP to promote its nuclear translocation and target gene activation [28]. However, this phenotype has not been found in New Zealand rabbits, and the specific effects of RTS on INSIG2 need to be further studied.
Another interesting point is that RTS activation of SREBP2 enhanced LDLR-mediated LDL endocytosis but decreased hepatic TG and TC levels, suggesting that RTS may interact with other pathways to promote lipid degradation in the liver (Figures 2(h) and 2(i)). The results of H&E and Oil Red O staining also demonstrated that RTS-induced LDL endocytosis did not lead to lipid accumulation in the liver (Figures 3(a) and 3(b)). Combined with liver transcriptomics, these phenomena suggest that RTS may also ameliorate hyperlipidemia and AS by regulating other fatty acid synthesis and metabolic pathways such as PPARs [29], which need to be further explored.
Tanshinone IIA, rutin, and squalene have various applications in treating lipid metabolism and CVDs as mature monomers. The chitosan sustained-release capsule delivery method described in our experiments can be efficiently coated with various forms of drugs and greatly facilitate the drug delivery process. On this basis, all of the above results showed that RTS could significantly regulate the SREBP2/LDLR pathway to improve blood cholesterol levels without triggering PCSK9-mediated LDLR degradation. By describing a capsule administration method, we further explored the effects of RTS on dyslipidemia, which provided a theoretical basis for the combination therapy of RTS to improve lipid metabolism disorders and inhibit AS.
5. Conclusion
In conclusion, we described a capsule delivery modality that integrates tanshinone IIA, rutin, and squalene. RTS reduced blood lipid levels and inhibited aortic foam formation and hepatic steatosis in New Zealand rabbits. The results of transcriptome analysis revealed that RTS activated SREBP2 to enhance LDLR-mediated LDL endocytosis in the liver and thus accelerated LDL clearance in the blood. In summary, this study provides evidence that RTS improves lipid metabolism and lays the foundation for the potential application of RTS for treating hyperlipidemia and AS.
Nomenclature
AS
Atherosclerosis
β-actin
Beta-actin
CVD
Cardiovascular diseases
DEGs
Differentially expressed genes
FBS
Fetal bovine serum
GO
Gene ontology
HDL-C
HDL cholesterol
HFD
High-fat diet
HPLC
High-performance liquid chromatography
INSIG2
Insulin-induced gene 2
KEGG
Kyoto Encyclopedia of Genes and Genomes
LDL-C
LDL cholesterol
LDLR
Low-density lipoprotein receptor
ox-LDL
Oxidized LDL
PCA
Principal component analysis
PCSK9
Proprotein convertase subtilisin/kexin type 9
PPARs
Peroxisome proliferation receptors
RTS
Tanshinone IIA combined rutin and squalene
SCAP
SREBP cleavage activating protein
SREBP2
Sterol regulatory element-binding protein 2
TC
Total cholesterol
TG
Total triglycerides
Conflicts of Interest
The authors declare no conflicts of interest.
Author Contributions
Yunajie Wu: conceptualization, investigation, formal analysis, visualization, writing – original draft, writing – review and editing. Yuntian Zhang: investigation and validation. Xike Wu: investigation and validation. Ziyan Zhang: investigation and validation. Junhui Shen: investigation and validation. Chunlei Fan: conceptualization, funding acquisition, and writing – review and editing. Nan Tian: conceptualization and writing – review and editing.
Funding
This work was supported by grants from Hangzhou Mulder Biotechnology Co., LTD.
2Wang Z.,
Ma L.,
Liu M.,
Fan J., and
Hu S., Summary of the 2022 Report on Cardiovascular Health and Diseases in China, Chinese Medical Journal. (2023) 136, no. 24, 2899–2908, https://doi.org/10.1097/cm9.0000000000002927.
4Michos E. D.,
McEvoy J. W., and
Blumenthal R. S., Lipid Management for the Prevention of Atherosclerotic Cardiovascular Disease, New England Journal of Medicine. (2019) 381, no. 16, 1557–1567, https://doi.org/10.1056/NEJMra1806939, 2-s2.0-85073423371.
5Tang F. T.,
Cao Y.,
Wang T. Q. et al., Tanshinone IIA Attenuates Atherosclerosis in ApoE(-/-) Mice Through Down-Regulation of Scavenger Receptor Expression, European Journal of Pharmacology. (2011) 650, no. 1, 275–284, https://doi.org/10.1016/j.ejphar.2010.07.038, 2-s2.0-78649725643.
6Ma X.,
Zhang L.,
Gao F.,
Jia W., and
Li C., Salvia Miltiorrhiza and Tanshinone IIA Reduce Endothelial Inflammation and Atherosclerotic Plaque Formation Through Inhibiting COX-2, Biomedicine and Pharmacotherapy. (2023) 167, https://doi.org/10.1016/j.biopha.2023.115501.
7Wang N.,
Zhang X.,
Ma Z. et al., Combination of Tanshinone IIA and Astragaloside IV Attenuate Atherosclerotic Plaque Vulnerability in ApoE(-/-) Mice by Activating PI3K/AKT Signaling and Suppressing TRL4/NF-Κb Signaling, Biomedicine & Pharmacotherapy. (2020) 123, https://doi.org/10.1016/j.biopha.2019.109729.
8Yang C.,
Mu Y.,
Li S.,
Zhang Y.,
Liu X., and
Li J., Tanshinone IIA: A Chinese Herbal Ingredient for the Treatment of Atherosclerosis, Frontiers in Pharmacology. (2023) 14, https://doi.org/10.3389/fphar.2023.1321880.
9Niture N. T.,
Ansari A. A., and
Naik S. R., Anti-Hyperglycemic Activity of Rutin in Streptozotocin-Induced Diabetic Rats: An Effect Mediated Through Cytokines, Antioxidants and Lipid Biomarkers, Indian Journal of Experimental Biology. (2014) 52, no. 7, 720–727.
10Guo H.,
Cui B. D.,
Gong M. et al., An Ethanolic Extract of Arctium Lappa L. Leaves Ameliorates Experimental Atherosclerosis by Modulating Lipid Metabolism and Inflammatory Responses Through PI3K/Akt and NF-Κb Singnaling Pathways, Journal of Ethnopharmacology. (2024) 325, https://doi.org/10.1016/j.jep.2024.117768.
11Li B.,
Ji Y.,
Yi C. et al., Rutin Inhibits Ox-LDL-Mediated Macrophage Inflammation and Foam Cell Formation by Inducing Autophagy and Modulating PI3K/ATK Signaling, Molecules. (2022) 27, no. 13, https://doi.org/10.3390/molecules27134201.
12Ning Y.,
Liu M.,
Ru Z.,
Zeng W.,
Liu S., and
Zhou J., Efficient Synthesis of Squalene by Cytoplasmic-Peroxisomal Engineering and Regulating Lipid Metabolism in Yarrowia Lipolytica, Bioresource Technology. (2024) 395, https://doi.org/10.1016/j.biortech.2024.130379.
13Hoang T. M.,
Nguyen C. H.,
Le T. T. et al., Squalene Isolated From Schizochytrium Mangrovei Is a Peroxisome Proliferator-Activated Receptor-α Agonist that Regulates Lipid Metabolism in HepG2 Cells, Biotechnology Letters. (2016) 38, no. 7, 1065–1071, https://doi.org/10.1007/s10529-016-2071-x, 2-s2.0-84960114776.
14Pei K.,
Gui T.,
Kan D. et al., An Overview of Lipid Metabolism and Nonalcoholic Fatty Liver Disease, BioMed Research International. (2020) 2020, no. 1, https://doi.org/10.1155/2020/4020249.
16Yue Y.,
Liu Z.,
Zhang K. et al., Functional and miRNA Regulatory Characteristics of INSIG Genes Highlight the Key Role of Lipid Synthesis in the Liver of Chicken (Gallus gallus), Poultry Science. (2023) 102, no. 2, https://doi.org/10.1016/j.psj.2022.102380.
17Liu Q.,
Pan R.,
Ding L. et al., Rutin Exhibits Hepatoprotective Effects in a Mouse Model of Non-Alcoholic Fatty Liver Disease by Reducing Hepatic Lipid Levels and Mitigating Lipid-Induced Oxidative Injuries, International Immunopharmacology. (2017) 49, 132–141, https://doi.org/10.1016/j.intimp.2017.05.026, 2-s2.0-85020000084.
18Shiomi M.,
Koike T., and
Ito T., Contribution of the WHHL Rabbit, an Animal Model of Familial Hypercholesterolemia, to Elucidation of the Anti-Atherosclerotic Effects of Statins, Atherosclerosis. (2013) 231, no. 1, 39–47, https://doi.org/10.1016/j.atherosclerosis.2013.08.030, 2-s2.0-84885401447.
19Shen W.,
Anwaier G.,
Cao Y. et al., Atheroprotective Mechanisms of Tilianin by Inhibiting Inflammation Through Down-Regulating NF-Κb Pathway and Foam Cells Formation, Frontiers in Physiology. (2019) 10, https://doi.org/10.3389/fphys.2019.00825.
20Zhi X.,
Sun Y.,
Cai F. et al., Oxidized Low-Density Lipoprotein (Ox-Ldl)-Triggered Double-Lock Probe for Spatiotemporal Lipoprotein Oxidation and Atherosclerotic Plaque Imaging, Advanced Healthcare Materials. (2023) 12, no. 29, https://doi.org/10.1002/adhm.202301595.
21Kim J.,
Lee H.,
An J. et al., Alterations in Gut Microbiota by Statin Therapy and Possible Intermediate Effects on Hyperglycemia and Hyperlipidemia, Frontiers in Microbiology. (2019) 10, https://doi.org/10.3389/fmicb.2019.01947, 2-s2.0-85072845106.
22Ahmad P.,
Alvi S. S.,
Waiz M.,
Khan M. S.,
Ahmad S., and
Khan M. S., Naturally Occurring Organosulfur Compounds Effectively Inhibits PCSK-9 Activity and Restrict PCSK-9-LDL-Receptor Interaction via In-Silico and In-Vitro Approach, Natural Product Research. (2023) 38, no. 22, 3924–3933, https://doi.org/10.1080/14786419.2023.2269465.
23Dong B.,
Singh A. B.,
Fung C.,
Kan K., and
Liu J., CETP Inhibitors Downregulate Hepatic LDL Receptor and PCSK9 Expression In Vitro and In Vivo Through a SREBP2 Dependent Mechanism, Atherosclerosis. (2014) 235, no. 2, 449–462, https://doi.org/10.1016/j.atherosclerosis.2014.05.931, 2-s2.0-84920513669.
24Soyal S. M.,
Nofziger C.,
Dossena S.,
Paulmichl M., and
Patsch W., Targeting SREBPs for Treatment of the Metabolic Syndrome, Trends in Pharmacological Sciences. (2015) 36, no. 6, 406–416, https://doi.org/10.1016/j.tips.2015.04.010, 2-s2.0-84934928977.
25Du Y.,
Xi M.,
Li Y. et al., Tilianin Improves Lipid Profile and Alleviates Atherosclerosis in ApoE-/- Mice Through Up-Regulation of SREBP2-Mediated LDLR Expression, Phytomedicine. (2023) 109, https://doi.org/10.1016/j.phymed.2022.154577.
27Lin X. L.,
Xiao L. L.,
Tang Z. H.,
Jiang Z. S., and
Liu M. H., Role of PCSK9 in Lipid Metabolism and Atherosclerosis, Biomedicine and Pharmacotherapy. (2018) 104, 36–44, https://doi.org/10.1016/j.biopha.2018.05.024, 2-s2.0-85047094557.
28Kim J. Y.,
Wang L. Q.,
Sladky V. C. et al., PIDDosome-SCAP Crosstalk Controls High-Fructose-Diet-Dependent Transition From Simple Steatosis to Steatohepatitis, Cell Metabolism. (2022) 34, no. 10, 1548–1560.e6, https://doi.org/10.1016/j.cmet.2022.08.005.
29Mao Z.,
Feng M.,
Li Z. et al., ETV5 Regulates Hepatic Fatty Acid Metabolism Through PPAR Signaling Pathway, Diabetes. (2021) 70, no. 1, 214–226, https://doi.org/10.2337/db20-0619.
Please check your email for instructions on resetting your password.
If you do not receive an email within 10 minutes, your email address may not be registered,
and you may need to create a new Wiley Online Library account.
Request Username
Can't sign in? Forgot your username?
Enter your email address below and we will send you your username
If the address matches an existing account you will receive an email with instructions to retrieve your username
The full text of this article hosted at iucr.org is unavailable due to technical difficulties.
