Volume 2025, Issue 1 5013608

Research Article

Open Access

Marine Diatom Skeletonema costatum Dietary Supplementation Improves Growth, Immunological Responses, Antioxidant Activities, Gene Expressions, and Digestive Enzymes of Shrimp Litopenaeus vannamei

Mohamed Ashour,

Corresponding Author

Mohamed Ashour

[email protected]

orcid.org/0000-0002-1595-1197

Aquaculture Division , National Institute of Oceanography and Fisheries (NIOF) , Cairo , 11516 , Egypt , azhar.edu.eg

Search for more papers by this author

Einar Ringø,

Einar Ringø

orcid.org/0000-0002-4940-5688

Faculty of Biosciences, Fisheries and Economics , Norwegian College of Fishery Science , UiT The Arctic University of Norway , Tromsø , Norway , uit.no

Search for more papers by this author

Mohamed M. Mabrouk,

Mohamed M. Mabrouk

Fish Production Department , Faculty of Agriculture , Al-Azhar University , Cairo , 11823 , Egypt , azhar.edu.eg

Search for more papers by this author

Ahmed I. A. Mansour,

Ahmed I. A. Mansour

Aquaculture Division , National Institute of Oceanography and Fisheries (NIOF) , Cairo , 11516 , Egypt , azhar.edu.eg

Search for more papers by this author

Mohammed A. E. Naiel,

Mohammed A. E. Naiel

Department of Animal Production , Faculty of Agriculture , Zagazig University , Zagazig , Egypt , zu.edu.eg

Search for more papers by this author

Abdallah Tageldein Mansour,

Corresponding Author

Abdallah Tageldein Mansour

[email protected]

orcid.org/0000-0002-5963-5276

Animal and Fish Production Department , College of Agricultural and Food Sciences , King Faisal University , Al-Ahsa , Saudi Arabia , kfu.edu.sa

Search for more papers by this author

Rabee M. A. Gheetas,

Rabee M. A. Gheetas

Animal Production , Faculty of Agriculture , Al-Azhar University , Cairo , 11823 , Egypt , azhar.edu.eg

Search for more papers by this author

Ehab Mohamed,

Corresponding Author

Ehab Mohamed

[email protected]

orcid.org/0000-0002-2848-2561

Department of Integrative Agriculture , College of Agriculture and Veterinary Medicine , United Arab Emirates University , Al Ain , P.O. Box 15551 , Abu Dhabi , UAE , uaeu.ac.ae

Search for more papers by this author

Ahmed F. Abdelhamid,

Ahmed F. Abdelhamid

Fish Production Department , Faculty of Agriculture , Al-Azhar University , Cairo , 11823 , Egypt , azhar.edu.eg

Search for more papers by this author

Mohamed Ashour,

Corresponding Author

Mohamed Ashour

[email protected]

orcid.org/0000-0002-1595-1197

Aquaculture Division , National Institute of Oceanography and Fisheries (NIOF) , Cairo , 11516 , Egypt , azhar.edu.eg

Search for more papers by this author

Einar Ringø,

Einar Ringø

orcid.org/0000-0002-4940-5688

Faculty of Biosciences, Fisheries and Economics , Norwegian College of Fishery Science , UiT The Arctic University of Norway , Tromsø , Norway , uit.no

Search for more papers by this author

Mohamed M. Mabrouk,

Mohamed M. Mabrouk

Fish Production Department , Faculty of Agriculture , Al-Azhar University , Cairo , 11823 , Egypt , azhar.edu.eg

Search for more papers by this author

Ahmed I. A. Mansour,

Ahmed I. A. Mansour

Aquaculture Division , National Institute of Oceanography and Fisheries (NIOF) , Cairo , 11516 , Egypt , azhar.edu.eg

Search for more papers by this author

Mohammed A. E. Naiel,

Mohammed A. E. Naiel

Department of Animal Production , Faculty of Agriculture , Zagazig University , Zagazig , Egypt , zu.edu.eg

Search for more papers by this author

Abdallah Tageldein Mansour,

Corresponding Author

Abdallah Tageldein Mansour

[email protected]

orcid.org/0000-0002-5963-5276

Animal and Fish Production Department , College of Agricultural and Food Sciences , King Faisal University , Al-Ahsa , Saudi Arabia , kfu.edu.sa

Search for more papers by this author

Rabee M. A. Gheetas,

Rabee M. A. Gheetas

Animal Production , Faculty of Agriculture , Al-Azhar University , Cairo , 11823 , Egypt , azhar.edu.eg

Search for more papers by this author

Ehab Mohamed,

Corresponding Author

Ehab Mohamed

[email protected]

orcid.org/0000-0002-2848-2561

Department of Integrative Agriculture , College of Agriculture and Veterinary Medicine , United Arab Emirates University , Al Ain , P.O. Box 15551 , Abu Dhabi , UAE , uaeu.ac.ae

Search for more papers by this author

Ahmed F. Abdelhamid,

Ahmed F. Abdelhamid

Fish Production Department , Faculty of Agriculture , Al-Azhar University , Cairo , 11823 , Egypt , azhar.edu.eg

Search for more papers by this author

First published: 09 July 2025

https://doi.org/10.1155/anu/5013608

Academic Editor: Lee Seong Wei

Share a link

Email
Wechat
Bluesky

Abstract

This work highlighted the impact of dry concentrations (0, 1, 2, and 4 g/kg diet) of the marine diatom species Skeletonema costatum (SK_0%, SK_0.1%, SK_0.2%, and SK_0.4%, respectively) as an aquafeed additive on the postlarvae of Pacific whiteleg shrimp (Litopenaeus vannamei). During an 8-week feeding trial, the impact of S. costatum on growth, digestive enzymes, antioxidant activities, immunity-associated gene expressions, and immunological responses of Pacific white shrimp was investigated. The protein, lipid, and carbohydrates of S. costatum were 33.50%, 35.95%, and 11.87%, respectively. Shrimp reared in group SK_0.4% exhibited a significant improvement in growth performance indicators, compared to the other groups. The results showed that, compared to the control group (SK_0%), shrimp-fed S. costatum supplemented groups (SK_0.1%, SK_0.2%, and SK_0.4%) showed significantly (p < 0.05) higher amylase activities. Compared to the control group (SK_0%), shrimp-fed S. costatum groups (SK_0.1%, SK_0.2%, and SK_0.4%) demonstrated major significant (p < 0.05) improvement in catalase and superoxide dismutase values. Shrimp reared in group SK_0.4% showed a significant (p < 0.05) improvement in lipase and lysozyme activities. The increasing levels of S. costatum dietary supplementation significantly (p < 0.05) increase the relative gene expression of the p53-like protein isoform delta (p53) gene. SK_0.4% revealed a major significant (p < 0.05) increase in the relative gene expression of the prophenoloxidase (PPO1) and peroxiredoxin (Prx) genes. This study highlights the potential of S. costatum as a promising aquafeed additive enhancing growth performance and immunity of Pacific whiteleg shrimp health, opening the way for more sustainable shrimp aquaculture practices.

1. Introduction

The global aquaculture industry has significantly grown in recent decades as a result of the increasing global demand for seafood products, particularly Pacific whiteleg shrimp (Litopenaeus vannamei) [1]. Among the various marine species cultivated, whiteleg shrimp L. vannamei comes as the most economically important and widely farmed shrimp species [2]. Its rapid growth rate, high feed conversion efficiency, and adaptability to a wide range of environmental conditions make Pacific whiteleg shrimp an ideal candidate for marine aquaculture production [3].

However, despite its commercial importance, the sustainability and profitability of Pacific whiteleg shrimp farming are often threatened by factors including low quality of water quality, low survivability, reduced growth performance, and suboptimal immune responses, which can all negatively impact the Pacific whiteleg shrimp health, growth, and overall productivity [4, 5]. In response to these challenges, researchers and aquaculturists have increasingly focused on improving Pacific whiteleg shrimp aquafeed additives to enhance their growth performance, immune responses, high survivability, and overall productivity [6].

Using natural feed additives in shrimp diets is one viable strategy because they are known to enhance shrimp health while reducing the environmental effect of aquaculture operations. Microalgae are one of the many natural feed additives that have shown great promise as a nutritional supplement to improve the performance and well-being of cultured shrimp. Microalgae have prominent fatty acids, vitamins, amino acids, and other bioactive substances that might improve aquatic animals’ immune response, feed utilization, and growth performance [7].

Diatom, particularly marine diatom, is rich in bioactive materials such as polysaccharides, proteins, vitamins, and minerals, which are beneficial for aquatic organisms [8]. Skeletonema costatum, a filamentous marine diatom species, has been identified as a significant diatom species with high nutritional value and various potential health benefits for aquatic organisms [9]. The unique chemical and biochemical composition of S. costatum, including its high level of antioxidants, polysaccharides, and pigments [10], makes it an attractive supplement for enhancing shrimp performance, especially in marine hatcheries. Recent studies have highlighted the potential of S. costatum to develop metamorphosis, improve growth, enhance feed utilization, improve immune responses, and improve resistance to environmental stress in several marine species, such as Pacific whiteleg shrimp [11] and giant tiger prawn (Penaeus monodon) [12, 13].

Until now, the application of S. costatum as a dietary supplement for Pacific whiteleg shrimp is still relatively underexplored, and there is a need for research to assess its impact on various aspects of shrimp nutrition. While S. costatum is extensively utilized in shrimp hatcheries as live feed for shrimp larvae and crustaceans, there is no comprehensive work investigating the impact of S. costatum as a feed additive in Pacific whiteleg shrimp cultivation. This study examines how a supplement of S. costatum to Pacific whiteleg shrimp diet affects its growth, nutritional consumption, carcass structure, digestive enzymes efficiency, antioxidant levels, immunological response, and gene expression.

2. Materials and Methods

2.1. Marine Diatom, S. costatum

2.1.1. Isolation and Culture Conditions

S. costatum is a diatom strain that was previously isolated from the Mediterranean Coast (31°130 4800 N; 29°530 1200 E), at the location of NIOF, Alexandria Branch of Egypt. After isolation, the pure strain was identified [14–16]. S. costatum has cell sizes ranging from 2 to 7 µm [17]. The isolate was cultivated indoors at the Microalgae Room, Invertebrate Aquaculture Lab. at the Alexandria Branch of NIOF. Using F/2 standard Guillard media [18], S. costatum was cultivated in a batch culture system using conical flasks (2 L) under standard growth parameters, including temperature, salinity, and regular illumination (24 ± 2°C, 34 ± 1 ppt, and 3500 ± 500 Lux/24 h, respectively), under constant aeration. To obtain the S. costatum biomass, at a late exponential phase (LEP), after 5 days of starting culture, the cells of microalgae were then harvested via centrifugation (3000 × g, 10 min), and then, collected, dried (45°C/48 h), and subsequently kept at −20°C for future utilization.

2.1.2. Biochemical Composition and Phytochemical Content

At the LEP, 10 mL of culture was centrifuged (3000 × g, 10 min) to determine the biochemical analysis of protein, carbohydrate, and lipid. The quantification of total protein and total carbohydrates was analyzed as described by Rausch [19] and Myklestad and Haug [20], respectively. The determination of total protein and total carbohydrates was conducted as described by Vautherin and Brink [21] and DuBois et al. [22], respectively. Total lipid was determined by the method described by Bligh and Dyer [23]. The phytochemical content profile of S. costatum was determined by gas chromatography–mass spectrometry analysis (GC–Mass) as described by Ashour et al. [24]. Peak identifications were based on comparing the acquired mass spectra to those available in the NIST Library.

2.2. Pacific Whiteleg Shrimp

2.2.1. Experimental Techniques

Pacific whiteleg shrimp postlarvae (PL) (0.052 ± 0.001 g and 0.907 ± 0.010 cm) were obtained from a commercial hatchery and transferred to Baltim Research Station, Kafr El-Sheikh, NIOF. For 15 days, the PL were adapted to the experimental conditions and fed a commercial shrimp basal diet, the control diet (four times daily). 600 PL were allocated into four groups. Each group consisted of 50 PL, three replicates per group. The PL were set in net hapas (70 × 70 × 100 cm) secured in a concrete pond (400 × 200 × 100 cm). The hapa was cleaned daily, and 10% of the total water culture was exchanged daily. Water quality parameters, salinity, dissolved oxygen, and temperature (27 ± 1 ppt, 5.5 ± 0.5 mg/L, and 27.5 ± 1.5°C, respectively) were daily measured following the guidelines of APHA [25]. Moreover, ammonia (NH₃), nitrite (NO₂), and nitrate (NO₃) were weekly determined, and the values were in the recommended ranges of shrimp aquaculture (0.09 ± 0.02, 0.08 ± 0.07, and 0.15 ± 0.06 mg/L, respectively), according to [26].

2.2.2. Experimental Diet and Procedures

Throughout the feeding experiment (8-weeks), the PL were divided into four dietary groups. Group one (SK_0%) received a standard commercial shrimp diet as a control (Aller-Aqua, Giza Governorate, Egypt) and contains protein, carbohydrate, lipid, fiber, and ash at levels of 45%, 34%, 7.9%, 3.65%, and 9.1%, respectively. The remaining three groups (SK_0.1%, SK_0.2%, and SK_0.4%) were enriched with 1, 2, and 4 g of dried marine diatom S. costatum, respectively. The procedure for incorporating S. costatum into each diet group was carried out as described by [1]. In brief, the standard shrimp diet was ground finely and divided into four equal parts. Subsequently, each part was supplemented with its appropriate quantity of S. costatum and carefully blended until a uniform mixture was achieved. After homogenization, a pellet mill was used to pelletize each food group to the appropriate size. After that, these pellets were dried in an oven set to 40°C until their moisture content was below 10%. Subsequently, the pellets were stored (4°C) until required for feeding trial purposes.

2.2.3. Growth Performance Achievement

The weights of PL were measured at the initial (IW, g) and final (FW, g) to calculate shrimp’s growth and nutrient utilization using the following formulas:

2.2.4. Samples Collection

After 24-h fasting period, after the experiment ended, 18 samples were randomly selected, six samples per replicate. The shrimp were killed by overdose of clove oil (450 mg/L) [27] and used for several subsequent analysis, proximate body composition, digestive enzyme activities (amylase and lipase), antioxidant activity indices, and nonspecific immunity. In summary, tissue organs were dissected, weighed, and homogenized in a phosphate buffer solution (pH 7.4) after randomly chosen samples were killed. After centrifuging the tissues for 20 min at 3.500 rpm, the supernatants were carefully obtained.

2.2.5. Shrimp’s Carcass Analysis

Six shrimp samples were randomly selected by the lottery method from each replicate for total protein, ether extract, dry matter, and ash analysis. Before undergoing additional analysis, the samples were mixed, dried, powdered, and stored (−20°C). The chemical constituent of the carcass was examined following AOAC [28] guidelines.

2.2.6. Digestive Enzyme Activities

Following the manufacturer’s instructions, the colorimetric assay was applied to measure the digestive enzymes’ activity. Biodiagnostic Company, Egypt, manufactured specific amylase and lipase kits. The wavelengths at which lipase (580 nm) and amylase (660 nm) were measured according to [29] and [30], respectively.

2.2.7. Antioxidant Activities

Following the manufacturer’s instructions, the colorimetric method was applied to assess the antioxidant activities. Catalase (CAT), malondialdehyde (MDA), and superoxide dismutase (SOD) activities have been investigated. MDA, CAT, and SOD-specific kits were purchased from the Biodiagnostic Company in Egypt. CAT, MDA, and SOD have amusement wavelengths of 510 [31], 534 [32], and 560 nm [33], respectively.

2.2.8. Lysozyme Activities

Based on the manufacturer’s instructions (SunLong Biotech Co., Ltd., China), the colorimetric method was used to assess the lysozyme (LZM) activity using ELISA kits. During the experiment, the lysozyme-containing sample was incubated with Micrococcus lysodeikticus cells. The reaction was monitored following the protocol by Harshbarger et al. [34] by measuring the drop in absorbance at 450 nm to estimate the rate of substrate conversion.

2.2.9. Immunity-Related Genes Expressions

Three whole shrimp samples (five individuals per treatment) were preserved in RNA later reagent (Sigma–Aldrich; 1:5 v/v) at −20°C, following the procedure by Goncalves et al. [35]. RNA extraction was conducted using the TRIzol reagent (TRIzol; Life Technologies). The RT2 First Strand Kit was utilized during the extraction to remove DNA. Following, the primer genes used in this study as well as the housekeeping gene are presented in Table 1. Gene expression was conducted utilizing the 2^−ΔΔCt protocol, as described by Livak and Schmittgen [39].

Table 1. Primers sequences for the shrimp’s qPCR study.

Gene	Nucleotide primers	Accession No.	Amplification length (bp)	References
Prx		GQ995702	139	Liu et al. [36]
PPOI		AY723296	122	Wang et al. [37]
p53		KX827274	190	Nuñez-Hernandez et al. [38]
L5H		KF193065	124	Wang et al. [37]
β − actin	F: ACTGGGACGACATGGAGAAG R : CAGGAATGAGGGCTGGAACA	JF288784	121	Wang et al. [37]

Note: p53, p53-like protein isoform delta; β-actin, A housekeeping gene.
Abbreviations: L5H, hemocyanin subunit L5; PPO1, prophenoloxidase; Prx, peroxiredoxin.

2.3. Statistical Analysis

Before the statistical assessment started, fundamental presumptions of normality and uniformity were conducted using Levene’s test, and the findings (%) were arc-sin transformed [40]. Data were calculated in three replications (mean ± standard division). The statistical assessment was carried out by SPSS Statistics Software, conducting a one-way ANOVA, and Duncan [41] method at a significance level of p ≤ 0.05. The figures were generated by GraphPad (Prism 8) Statistics Software [42]. The polynomial regression was applied by Excel software.

3. Results

3.1. Marine Diatom, S. costatum

3.1.1. Biochemical Composition

The biochemical compositions of protein, lipid, and carbohydrates of S. costatum were 33.50%, 35.95%, and 11.87%, respectively, at LEP (Table 2).

Table 2. Biochemical composition analysis (%) of marine diatom S. costatum.

Biochemical analysis	Values (% of dry weight)
Total protein	33.50 ± 1.12
Total lipid	35.95 ± 0.70
Total carbohydrates	11.87 ± 1.15

3.1.2. Phytochemical Compounds Content

The GC–MS findings of S. costatum showed nine retention times, based on the peak areas (Table 3 and Figure 1). Table 3 shows nine phytochemical compounds belonging to six phytochemical groups. Retention times of less than 1% were neglected. The highest major group was fatty acids (three retention time (RT) with 84.84% of total peak area (PA)) and consisted of three fatty acids: myristic acid (tetradecanoic acid, 29.68%), palmitoleic acid (cis-9-hexadecenoic acid, 16.01%), and palmitic acid (n-hexadecanoic acid, 39.15%). The second major group was fatty acid derivatives (two RT with 5.38% of total PA): tetradecanoic acid, 12-methyl-, methyl ester (fatty acid methyl ester, FAME, 3.59%), and 9-hexadecenoic acid, 9-octadecenyl ester, (Z, Z)- (fatty acid occtadecenyl ester, FAOE, 1.79%). The third major group was saturated tetracyclic steroid (one RT with 3.74% of total PA): cholestan-3-ol, 2-methylene-, (3β, 5 α). The fourth group was triacylglycerol and trilinolein (one RT with 2.75% of total PA). The fifth group was macrocyclic lactones (one RT with 1.43% of total PA) and milbemycin b, 13-chloro-5-demethoxy-28-deoxy-6,28-epoxy-5- (hydroxyimino)-25- (1-methylethyl)-, (6R, 13R, 25R). Finally, the sixth group was carotene (one RT with 1.39% of total PA) and zeaxanthin.

Details are in the caption following the image — **Figure 1 (A)**
Open in figure viewer PowerPoint

GC mass spectra of bioactive compounds identified in diatom isolate *S. costatum*. (A) Zeaxanthin, (B) tetradecanoic acid (myristic acid), (C) cholestan-3-ol, 2-methylene-, (3β, 5α)-, (D) 9-Hexadecenoic acid, 9-octadecenyl ester, (Z, Z)-, (E) trilinolein, (F) milbemycin b, 13-chloro-5-demethoxy-28-deoxy-6,28-epoxy-5- (hydroxyimino)-25- (1-methylethyl)-, (6R, 13R, 25R), (G) tetradecanoic acid, 12-methyl-, methyl ester, (H): cis-9-hexadecenoic acid (palmitoleic acid), and (I) n-hexadecanoic acid (palmitic acid).

Table 3. Phytochemical reported in S. costatum.

RT	PA (%)	Compound name	CF	MW	Nature	Biological activities	Refs
17.35	1.39	Zeaxanthin	C₄₀H₅₆O₂	568	Carotene	Antioxidant, anticancer	[43, 44]
18.13	29.68	Tetradecanoic acid (myristic acid)	C₁₄H₂₈O₂	228	FA	Antioxidant, Antifungal	[45]
19.3	3.74	Cholestan-3-ol, 2-methylene-, (3β, 5α)-	C₂₈H₄₈O	400	Saturated tetracyclic steroid	Anticancer, antiviral (SARS-CoV-2)	[46, 47]
19.83	1.79	9-Hexadecenoic acid, 9-octadecenyl ester, (Z, Z)-	C₃₄H₆₄O₂	504	FAOE	Antimicrobial	[48]
20.07	2.75	Trilinolein	C₅₇H₉₈O₆	878	Triacylglycerol	Antioxidant	[49–51]
20.52	1.43	Milbemycin b, 13-chloro-5-demethoxy-28-deoxy-6,28-epoxy-5- (hydroxyimino)-25- (1-methylethyl)-, (6R, 13R,25R)	C₃₃H₄₆ClNO₇	603	Macrocyclic lactones	Aquatic animals immunity enhancer	[52]
20.85	3.59	Tetradecanoic acid, 12-methyl-, methyl ester	C₁₆H₃₂O₂	256	FAME	Antioxidant, antimicrobial, anti-inflammatory	[53]
21.37	16.01	cis-9-Hexadecenoic acid (Palmitoleic acid)	C₁₆H₃₀O₂	254	FA	Antioxidant, antiviral, anti-inflammatory	[54, 55]
21.74	39.15	n-Hexadecanoic acid (Palmitic acid)	C₁₆H₃₂O₂	256	FA	Antioxidant, anticancer, anti-inflammatory	[56]

Note: Retention times those less than 1% were neglected.
Abbreviations: CF, chemical formula; FA, fatty acid; FAEE, fatty acid ethyl ester; FAME, fatty acid methyl ester; FAOE, fatty acid octadecenyl ester; MW, molecular weight; PA, peak area (%); RT, retention time.

3.2. Pacific Whiteleg Shrimp

3.2.1. Growth Indicators

Table 4 demonstrates the growth and nutrient utilization indicators of Pacific whiteleg shrimp fed the experimental diets. The SK_0.4% group showed a significant improvement (p < 0.05) in FW, WG, survival growth rate (SGR), feed conversion ratio (FCR), feed efficiency ratio (FER), and survival rate (SR), compared to the other groups (SK_0%, SK_0.1%, and SK_0.2%). This improvement was achieved with the increased S. costatum supplementation levels. Moreover, significant achievements were found in FL and LG in groups SK_0.4% and SK_0.2%, compared to SK_0% (control group) and SK_0.1%.

Table 4. Growth and nutrient indicators of Pacific whiteleg shrimp-fed diets supplemented with S. costatum.

Indices	Groups
Indices	SK_0%	SK_0.1%	SK_0.2%	SK_0.4%
IW	0.052 ± 0.001	0.052 ± 0.001	0.052 ± 0.001	0.052 ± 0.001
IL	0.907 ± 0.010	0.897 ± 0.012	0.897 ± 0.012	0.907 ± 0.015
FW	3.897 ± 0.050^b	4.020 ± 0.082^b	4.097 ± 0.055^b	4.413 ± 0.208^a
FL	8.400 ± 0.100^c	8.700 ± 0.200^b	9.133 ± 0.058^a	9.300 ± 0.100^a
WG	3.847 ± 0.050^b	3.970 ± 0.082^b	4.047 ± 0.055^b	4.363 ± 0.208^a
LG	7.480 ± 0.105^c	7.803 ± 0.190^b	8.237 ± 0.064^a	8.393 ± 0.115^a
SGR	3.337 ± 0.021^b	3.370 ± 0.001^b	3.387 ± 0.006^b	3.443 ± 0.049^a
FCR	2.237 ± 0.055^a	2.143 ± 0.031^ab	2.073 ± 0.049^b	1.957 ± 0.097^c
FER	0.447 ± 0.011^c	0.467 ± 0.007^b	0.483 ± 0.011^ab	0.512 ± 0.027^a
SR	84.66 ± 8.02^b	88.45 ± 3.16^ab	87.28 ± 5.03^ab	91.66 ± 2.06^a

Note: SK_0%, SK_0.1%, SK_0.2%, and SK_0.4%: diets supplemented with 0, 1, 2, and 4 g of marine diatom S. costatum/kg diet, respectively. The provided data were means ± SD (n = 3). Significant differences exist between (p < 0.05) letters in the same row. The lack of letters indicates no significant.

Figure 2 displays the polynomial regression between FCR and WG and concludes that with the increase of S. costatum dietary supplementation level, the polynomial regression of WG was increased (r² = 0.9721) while the polynomial regression of FCR was decreased (r² = 0.9941).

3.2.2. Carcass Analysis

Figure 3A–D reveals the biochemical carcass composition of Pacific whiteleg shrimp-fed dietary supplemented with several levels (SK_0%, SK_0.1%, SK_0.2%, and SK_0.4%) of S. costatum. As Figure 3A shows, no significant (p < 0.05) improvement in the ash content of Pacific whiteleg shrimp between all experimented groups (SK_0%, SK_0.1%, SK_0.2%, and SK_0.4%). On the other hand, a significant (p < 0.05) decrease was reported in dry matter content with the increase of S. costatum supplementation levels, as presented in Figure 3B. The percentages of total protein and ether extract significantly (p < 0.05) increased with the increase of S. costatum supplementation levels (Figure 3C,D).

3.2.3. Digestive Enzyme Activities

Figure 4 reveals the amylase and lipase activities of Pacific whiteleg shrimp fed S. costatum. The results showed that, compared to SK_0%, shrimp-fed S. costatum supplemented groups (SK_0.1%, SK_0.2%, and SK_0.4%) showed significantly (p < 0.05) higher amylase activities. Furthermore, in the supplementation groups (SK_0.1%, SK_0.2%, and SK_0.4%), the activities of amylase also showed a nonsignificant increase (p < 0.05) with increasing doses of S. costatum supplementation (Figure 4A). On the other hand, the SK_0.4% group showed a significant (p < 0.05) improvement in lipase (Figure 4B) compared to the other groups (SK_0%, SK_0.1%, and SK_0.2%).

3.2.4. Antioxidant Activities and Nonspecific Immunity Response

Figure 5 reveals the antioxidant activities of Pacific whiteleg shrimp-fed diets supplemented by S. costatum. Figure 5A,B reveal that, compared to the control group (SK_0%), shrimp in S. costatum supplementation groups (SK_0.1%, SK_0.2%, and SK_0.4%) exhibited the highest significant (p < 0.05) CAT and SOD values. While, compared to SK_0%, S. costatum supplementation groups (SK_0.1%, SK_0.2%, and SK_0.4%) exhibited a nonsignificant decrease (p < 0.05) in MDA value (Figure 5C). Figure 5D reveals that the SK_0.4% group exhibited a significant (p < 0.05) improvement in lysozyme value compared to the other groups (SK_0%, SK_0.1%, and SK_0.2%).

3.2.5. Immunity-Related Gene Expressions

Figure 6A–D reveals the relative gene expression levels of immunity-related genes (A: P53, B: Prx, C: PPO1, and D: L5H, respectively) in Pacific whiteleg shrimp fed with dietary supplements containing several levels of S. costatum. The results revealed that increasing levels of S. costatum led to a significant (p < 0.05) increase in the relative gene expression of the P53 gene (Figure 6A). SK_0.4% revealed the highest significant (p < 0.05) increase in the relative gene expression of the Prx gene (Figure 6B), compared to other groups (SK_0%, SK_0.1%, and SK_0.2%). As shown in Figure 6C, SK_0.4% is the highest significant improvement in the relative gene expression of the PPO1 gene, followed by SK_0.2%, and the other groups (SK_0% and SK_0.1%). In contrast, as shown in Figure 6D, there was no significant improvement in the relative gene expression of the L5H gene between Pacific whiteleg shrimp-fed diet supplemented with several levels of S. costatum (SK_0.1%, SK_0.2%, and SK_0.4%) and the control group (SK_0%).

4. Discussion

4.1. S. costatum

The biochemical compositions of Skeletonema species varied based on several conditions, including culture conditions, culture type, culture period, and nutrient limitation [57–59]. The findings of the present study were in accordance with the results by Shang et al. [60] who concluded that, based on culture temperature, the lipid content of S. dohrnii varied between 30.97% and 39.23%. In contrast, our findings are in opposition to the findings achieved by Bastos et al. [61], who reported that based on nutrient concentration, the protein and carbohydrate content (%) of S. costatum varied between 18.80% and 19.70% and 15.80%–26.20%, respectively.

In the current study, S. costatum shows several phytochemical compounds belonging to six phytochemical groups. The study conducted by Javid et al. [62] reported novel applications of myristic acid as an antifungal substrate against A. niger and C. albicans. As investigated by Liu et al. [63], the myristic acid exhibited strong antioxidant activity in vitro and demonstrated significant hepatoprotective impact against CCl₄-induced liver injury in vivo. Palmitoleic acid (16:1n−7) is produced from palmitic acid through the action of stearoyl-CoA desaturase-1 [55]. This fatty acid has been identified as a lipokine capable of regulating various metabolic processes, including enhancing insulin sensitivity in muscles, promoting β cell proliferation, preventing endoplasmic reticulum stress, and stimulating lipogenic activity in white adipocytes [64].

Numerous beneficial impact of palmitoleic acid was observed in cell lines as well as in mouse models [55]. Its exact act in humans remains incompletely understood and is occasionally debated [65]. On the other hand, it is an algicidal bioactive material extensively used against the toxin-producing dinoflagellate Alexandrium tamarense, but its effects on aquatic animals are unclear [66]. Chi et al. [66] study investigated the impacts of PA at concentrations of 20, 40, and 80 mg/L on the immune responses (lysozyme activity, SOD level, MDA level, ACP activity, ROS production, total protein, phagocytic activity) and gene expression of scallop (Argopecten irradians). Their study measured various immune parameters at different time points. The study shows that PA exposure at effective concentrations induces varied effects on immune responses and immune-related gene expression in A. irradians, suggesting both beneficial and adverse impacts depending on the timing and concentration of exposure [67].

Marine seagrass (Thalassodendron ciliatum) is a rich source of bioactive metabolites, exhibiting notable antioxidant, anti-inflammatory, and antimicrobial properties, as demonstrated in several studies. GC–MS analysis of this species revealed both saturated and unsaturated fatty acids, with tetradecanoic acid, 12-methyl-, methyl ester being particularly abundant (6.07%). This acid is recognized for its potent antibacterial, antifungal, and antiinflammatory activities [53]. 9-Octadecenoic acid (Z)-, 2- (9-octadecenyloxy) ethyl ester, (Z)- is a fatty acid Octadecenyl ester (FAOE) reported in the extract of passion fruit (Passiflora edulis) and showed antibacterial activities against several positive- and negative-gram bacterial strains [48].

Bharathi et al. [47] cited that cholestan-3-ol, 2-methylene-, (3β, 5α)-, a saturated tetracyclic steroid that exists in seaweed Corallina officinalis, showed strong antiviral activities against SARS-CoV-2. Moreover, Losso and Bansode [46] reported that Cholestan-3-ol, 2-methylene-, (3β, 5α)- showed anticancer activities. Chan and Tomlinson [68] showed that trilinolein, a triacylglycerol extracted from Sanchi Panax pseudoginseng. This Chinese herb has demonstrated pharmacological properties, including antioxidant properties [50, 68].

Several studies reported that milbemycin is an attractive substrate that enhances the immunity of aquatic animals including Pacific whiteleg shrimp [52] and Nile tilapia (Oreochromis niloticus) [69, 70], as well as the plant immunity including strawberry [24] and hot pepper [71]. Zeaxanthin, a potent carotenoid, plays a significant role in enhancing the immune system of aquatic animals [72]. A study by Tan et al. [73] showed that carotenoids play a key role in invertebrate immunity, especially in shrimp immunity. Carotenoid compounds scavenge harmful radicals, reducing immune costs and regulating immune-related gene expression [74, 75].

4.2. Pacific Whiteleg Shrimp

While S. costatum is extensively utilized in shrimp hatcheries as live feed for the Pacific whiteleg shrimp and the Giant tiger prawn (penaeus monodon) larvae [13, 76], there is no comprehensive study investigating the impact of S. costatum as feed additive aquadiet in Pacific whiteleg shrimp nutrition. According to our best knowledge, the study conducted by Lestari et al. [77] is the only study investigating the impact of the dried form of S. costatum as a fish meal replacement for Pacific whiteleg shrimp formulated diet. The authors concluded that the inclusion of dried S. costatum, as a replacement for fish meal protein, in the Pacific whiteleg shrimp formulated diet at a range of 4.4% to 4.75% exhibited improvement in SR, SGR, FER, and protein efficiency ratio (PER). The current study completely agrees with the results observed by Lestari et al. [77]. Nevertheless, it is widely recognized that many microalgae strains contain significant biologically active components that enhance the growth of Pacific whiteleg shrimp [78] and Nile tilapia [79].

The current study revealed that the percentages of total protein and ether extract have significantly increased with the increase of S. costatum supplementation levels. These findings may be attributed to the high protein and lipid levels of marine diatom S. costatum (33.50% and 5.95%, respectively). These results agreed with the findings previously observed and concluded that diets supplemented with microalgae levels significantly increase the protein and lipid content of Pacific whiteleg shrimp [80].

The current study showed that shrimp-fed S. costatum-supplemented groups showed significantly higher amylase activities, compared to the control group. This outcome could be pointed out to the potential of S. costatum’s bioactive compounds to boost the activities of digestive enzymes, which would enhance feed digestibility and absorption [81]. Microalgae is a natural part of shrimp feeding regime, and their digestive system is well adapted to digest, absorb, and utilization [82]. Microalgae contains some growth regulators, such as polyamines, and released peptides during digestion could stimulate cholecystokinin release, which in turn enhances the release of digestive enzyme enzymes [83, 84]. On the other hand, dietary A. platensis did not significantly affect amylase and lipase activities; however, trypsin and chymotrypsin significantly improved in shrimp-fed diet with 50% microalgae as fishmeal alternative [85]. Therefore, the relation between dietary microalgae and digestive enzymes release and activity still needs more investigation on the molecular levels to understand their activated synthesis pathway.

Antioxidant activities and nonspecific immunity responses have been investigated as potential biomarkers for assessing the health of aquatic animals [75, 86]. Shrimp primarily rely on nonspecific immunological mechanisms due to their lack of innate immunity [87]. Enzymes like SOD and CAT degrade the cell walls of harmful microbes and scavenge free radicals. MDA is generally utilized as a marker for oxidative stress, signaling an escalation in free radical production [88]. These three hormones play a vital role in both specific and nonspecific immunity in shrimp [72]. Our findings agreed with the findings by Akbari et al. [89], Goda et al. [80], and Zhang et al. [90], indicating that the nonspecific immunity and antioxidant capabilities of Pacific whiteleg shrimp experienced notable enhancements when fed diets incorporating microalgae, Dunaliella salina, Arthrospira platensis, and Chlorella vulgaris, respectively. These improvements can be attributed to the potent content of bioactive compounds of these microalgae, which lead to an improvement in antioxidant activities and nonspecific immune response.

In the same line, the current study reported that marine diatom S. costatum contains a significant amount of several bioactive materials that show antioxidant activities, such as zeaxanthin, a rich antioxidant compound that is well-known for its ability to improve the shrimp’s immune response, particularly by influencing key biochemical markers such as CAT, SOD, lysozyme, and MDA [91]. Mabrouk et al. [92] evaluated the effects of the inclusion of the benthic freshwater diatom Amphora coffeaeformis into the dietary supplementation of tilapia broodstock, examining blood chemistry, steroid hormone concentration, and seed production health. The authors concluded that A. coffeaeformis supplementation levels of 4% to 6% led to significant improvements in the studied indicators of Nile tilapia broodstock, suggesting the potential efficacy of the benthic freshwater diatom A. coffeaeformis as a beneficial aquafeed additive during the spawning season. The study by Sandeep et al. [93] assessed the impact of the nutritional value and antimicrobial potential of the marine diatom T. weissflogii and the marine green microalgae Tetraselmis sp. concentrates on Pacific whiteleg shrimp PL. Tetraselmis sp. displayed superior inhibition against Vibrio parahaemolyticus. They concluded that the feeding trials revealed enhanced growth and immunity with Tetraselmis diet inclusion, indicating its promise for early shrimp development [93].

Peroxiredoxin (Prx) is an antioxidant gene that plays a crucial key in protecting cells from oxidative stress by reducing hydrogen peroxide and organic peroxides. In shrimp, Prx is involved in maintaining cellular homeostasis during immune responses to pathogenic bacteria and toxic environmental stressors such as giant tiger r shrimp [94] and Pacific whiteleg shrimp [95]. Prophenoloxidase (PPO1) is a critical gene in the melanization cascade, which is an immune defense mechanism in innate immunity in giant tiger prawn [96] and Pacific whiteleg shrimp [52]. ProPO plays a vital role in the shrimp’s defense system [97]. Therefore, PPO1 is essential for both the immune defense and tissue repair processes in shrimp [98]. The p53-like protein isoform delta (p53) is part of the broader p53 family, which is well-known for its tumor-suppressive properties [99]. In shrimp, the p53 protein is involved in regulating the cell cycle and apoptosis, particularly in response to stressors such as pathogen infection or cellular damage [100]. The shrimp’s immune system relies on this function of p53 to eliminate infected or damaged cells, preventing the spread of pathogens [101]. The significant upregulation of these immune genes could be attributed to the role of S. costatum’s bioactive compounds (e.g., zeaxanthin, palmitoleic acid) on antioxidant status, which subsequently enhances immune responses in Pacific whiteleg shrimp [52]. These findings were confirmed by significant increase in Prx, p53, and PPO1 expression alongside elevated antioxidant enzyme activities (e.g., SOD, CAT) in shrimp fed S. costatum, which in turn reduces cellular stress and induces immune gene activation. However, this pathway still merits molecular investigation.

Hemocyanin subunit (L5H) is a copper-based respiratory protein found in the hemolymph (blood) of many arthropods, including shrimp. The hemocyanin subunit L5 (L5H) plays an important role in both oxygen transport and immune defense in Pacific whiteleg shrimp [102]. In response to immune challenges, the expression of L5H increases, indicating its involvement in the immune response [103]. Increases in the expression of L5H also help in the recognition of pathogens and are thought to play a role in the activation of the shrimp’s immune system [104]. As a part of the innate immune defense, L5H aids in the clearance of pathogens from the hemolymph, thereby preventing systemic infections. Its ability to bind to pathogens and enhance the immune response makes L5H a critical protein in the shrimp’s defense mechanisms [52].

The results found that the increasing levels of S. costatum led to a significant increase in the relative gene expression of the P53, Prx, and PPO1 genes. The current findings agreed with several previous studies indicating that incorporating algal cells (microalgae and/or seaweeds) or their derivatives into the shrimp diet has improved the regulation of immune-related genes in several aquatic animals [52, 105, 106].

5. Conclusion

This study demonstrates the beneficial effects of dietary inclusion of the marine diatom species S. costatum on the growth, antioxidant activities, immunological responses, digestive enzymes, and immunity-associated gene expressions of Pacific whiteleg shrimp PL. The results clearly indicate that higher dietary concentrations of S. costatum (particularly at 0.4% inclusion) significantly enhance growth indicators, immunological responses, digestive enzyme activities, and antioxidant activities, compared to the control group. Shrimp feed at 0.4% exhibited the highest improvements in key physiological parameters such as amylase, CAT, SOD, lipase, lysozyme activities, and immune-related gene expressions (p53, Prx, and PPO1). These findings suggest that S. costatum can serve as a promising, sustainable aquafeed additive to boost shrimp health, immunity, and growth. Further studies are needed to investigate the long-term impact and optimal dietary concentrations of S. costatum for different shrimp species.

Conflicts of Interest

The authors declare no conflicts of interest.

Author Contributions

Mohamed Ashour: conceptualization, formal analysis, validation, investigation, software, resources, methodology, writing – review and editing, writing – original draft preparation, project administration. Einar Ringø: visualization, resources, supervision, and writing – review and editing. Mohamed M. Mabrouk: conceptualization, methodology, formal analysis, software, investigation, resources, and writing – original draft preparation. Ahmed I. A. Mansour: conceptualization, methodology, formal analysis, resources, software, writing – original draft preparation, validation, investigation. Mohammed A. E. Naiel: methodology. Abdallah Tageldein Mansour: visualization, funding acquisition, supervision, writing – review and editing. Rabee M. A. Gheetas: software, investigation, resources, methodology, writing – original draft preparation. Ehab Mohamed: visualization, resources, supervision, writing – review and editing. Ahmed F. Abdelhamid: conceptualization, methodology, software, investigation, resources, validation, and writing – original draft preparation. All authors have read and agreed to the published version of the manuscript.

Funding

The authors express their gratitude to the support of the Deanship of Scientific Research, Vice Presidency for Graduate Studies and Scientific Research, King Faisal University, Saudi Arabia (KFU251915).

Open Research

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

References

1 Abbas E. M., Al-Souti A. S., Sharawy Z. Z., El-Haroun E., and Ashour M., Impact of Dietary Administration of Seaweed Polysaccharide on Growth, Microbial Abundance, and Growth and Immune-Related Genes Expression of the Pacific Whiteleg Shrimp (litopenaeus Vannamei), Life. (2023) 13, no. 2, https://doi.org/10.3390/life13020344, 344.
10.3390/life13020344
CAS PubMed Google Scholar
2 Mathan Muthu C. M., Vickram A. S., Bhavani Sowndharya B., Saravanan A., Kamalesh R., and Dinakarkumar Y., A Comprehensive Review on the Utilization of Probiotics in Aquaculture Towards Sustainable Shrimp Farming, Fish & Shellfish Immunology. (2024) 147, https://doi.org/10.1016/j.fsi.2024.109459, 109459.
10.1016/j.fsi.2024.109459
CAS PubMed Google Scholar
3 Mansour A. T., Ashry O. A., Ashour M., Alsaqufi A. S., Ramadan K. M., and Sharawy Z. Z., The Optimization of Dietary Protein Level and Carbon Sources on Biofloc Nutritive Values, Bacterial Abundance, and Growth Performances of Whiteleg Shrimp (litopenaeus Vannamei) Juveniles, Life. (2022) 12, no. 6, https://doi.org/10.3390/life12060888, 888.
10.3390/life12060888
CAS PubMed Google Scholar
4 Nisar U., Zhang H., Navghan M., Zhu Y., and Mu Y., Comparative Analysis of Profitability and Resource Use Efficiency Between Penaeus Monodon and Litopenaeus Vannamei in india, PLoS One. (2021) 16, no. 5, https://doi.org/10.1371/journal.pone.0250727, e0250727.
10.1371/journal.pone.0250727
CAS PubMed Web of Science® Google Scholar
5 Tran T., Duong D. V., and Le T. D., et al.Promoting Sustainable Shrimp Farming: Balancing Environmental Goals, Awareness, and Socio-Cultural Factors in the Mekong Delta Aquaculture, Aquaculture International. (2025) 33, no. 2, https://doi.org/10.1007/s10499-024-01802-y, 119.
10.1007/s10499-024-01802-y
Web of Science® Google Scholar
6 Ramasubburayan R., Prakash S., and Immanuel G., et al.The Transformative Role of Prebiotics, Probiotics, and Microbiomes in Biofloc Systems for Sustainable Aquaculture: A Comprehensive Review, Reviews in Aquaculture. (2025) 17, no. 1, https://doi.org/10.1111/raq.13000, e13000.
10.1111/raq.13000
Web of Science® Google Scholar
7 Dineshbabu G., Goswami G., Kumar R., Sinha A., and Das D., Microalgae-Nutritious, Sustainable Aqua-and Animal Feed Source, Journal of Functional Foods. (2019) 62, https://doi.org/10.1016/j.jff.2019.103545, 2-s2.0-85071523610, 103545.
10.1016/j.jff.2019.103545
CAS Web of Science® Google Scholar
8 Phong W. N., Regmi R., Adhikari K. C., Bhattarai R. R., and Show P. L., Bioactive Compounds From Diatoms, Diatoms Biotechnology, 2023, CRC Press, 20–37.
Google Scholar
9 Bhattacharjya R., Kiran Marella T., Tiwari A., Saxena A., Kumar Singh P., and Mishra B., Bioprospecting of Marine Diatoms Thalassiosira, Skeletonema and Chaetoceros for Lipids and Other Value-Added Products, Bioresource Technology. (2020) 318, https://doi.org/10.1016/j.biortech.2020.124073, 124073.
10.1016/j.biortech.2020.124073
CAS PubMed Web of Science® Google Scholar
10 Abate R., Song S., and Patil V., et al.Enhancing the Production of a Marine Diatom (Skeletonema costatum) With Low-Frequency Ultrasonic Irradiation, Journal of Applied Phycology. (2020) 32, no. 6, 3711–3722, https://doi.org/10.1007/s10811-020-02270-6.
10.1007/s10811-020-02270-6
CAS Web of Science® Google Scholar
11 Ratnawati R., Alimin I., and Hasan S., Evaluation of Different Types of Phytoplankton on Rearing of Vannamei Shrimp Larva (Litopenaues vanamei), Acta Aquatica: Aquatic Sciences Journal. (2022) 9, no. 3, 193–200, https://doi.org/10.29103/aa.v9i3.7997.
10.29103/aa.v9i3.9515
Google Scholar
12 Uddin S. A. and Zafar M., Live Feed Production in Different Nutritive Condition as Diet for Penaeus Monodon in Shrimp Hatchery, Bangladesh, International Journal of Agriculture and Biology. (2006) 8, 493–495.
Google Scholar
13 Sivakumar K. and Kannappan S., Effects of a Marine Diatom Skeletonema Costatum Extract on Luminescence Disease Causing Vibrio Harveyi During Penaeus Monodon Larviculture, Bangladesh Journal of Botany. (2020) 49, no. 4, 1053–1062, https://doi.org/10.3329/bjb.v49i4.52538.
10.3329/bjb.v49i4.52538
Web of Science® Google Scholar
14 Hasle G. R., Syvertsen E. E., Steidinger K. A., Tangen K., and Tomas C. R., Identifying Marine Diatoms and Dinoflagellates, 1996, Elsevier.
Google Scholar
15 Cheng J., Li Y., and Liang J., et al.Morphological Variability and Genetic Diversity in Five Species of Skeletonema (Bacillariophyta), Progress in Natural Science. (2008) 18, 1345–1355.
10.1016/j.pnsc.2008.05.002
CAS Web of Science® Google Scholar
16 Sánchez C., Cristóbal G., and Bueno G., Diatom Identification Including Life Cycle Stages Through Morphological and Texture Descriptors, PeerJ. (2019) 7, https://doi.org/10.7717/peerj.6770, e6770.
10.7717/peerj.6770
PubMed Web of Science® Google Scholar
17 Jung S.-W., Yun S.-M., Lee S.-D., Kim Y.-O., and Lee J.-H., Morphological Characteristics of Four Species in the Genus Skeletonema in Coastal Waters of South korea, ALGAE. (2009) 24, no. 4, 195–203, https://doi.org/10.4490/ALGAE.2009.24.4.195.
10.4490/ALGAE.2009.24.4.195
Google Scholar
18 Guillard R. R., Culture of Phytoplankton for Feeding Marine Invertebrates, Culture of Marine Invertebrate Animals, 1st Conference on Culture of Marine Invertebrate Animals Greenport, 1975, Springer.
Google Scholar
19 Rausch T., The Estimation of Micro-Algal Protein Content and its Meaning to the Evaluation of Algal Biomass I. Comparison of Methods for Extracting Protein, Hydrobiologia. (1981) 78, no. 3, 237–251, https://doi.org/10.1007/BF00008520, 2-s2.0-0000797211.
10.1007/BF00008520
CAS Google Scholar
20 Myklestad S. and Haug A., Production of Carbohydrates by the Marine Diatom Chaetoceros affinis Var. Willei (Gran) Hustedt. I. Effect of the Concentration of Nutrients in the Culture Medium, Journal of Experimental Marine Biology and Ecology. (1972) 9, no. 2, 125–136, https://doi.org/10.1016/0022-0981(72)90041-X, 2-s2.0-49649137136.
10.1016/0022-0981(72)90041-X
CAS Google Scholar
21 Vautherin D. and Brink D. M., Hartree-Fock Calculations With Skyrme’s Interaction. I. Spherical Nuclei, Physical Review C. (1972) 5, no. 3, 626–647, https://doi.org/10.1103/PhysRevC.5.626, 2-s2.0-4244100621.
10.1103/PhysRevC.5.626
CAS Google Scholar
22 DuBois M., Gilles K. A., Hamilton J. K., Rebers P. A., and Smith F., Colorimetric Method for Determination of Sugars and Related Substances, Analytical Chemistry. (1956) 28, no. 3, 350–356, https://doi.org/10.1021/ac60111a017, 2-s2.0-33749946901.
10.1021/ac60111a017
CAS PubMed Web of Science® Google Scholar
23 Bligh E. G. and Dyer W. J., A Rapid Method of Total Lipid Extraction and Purification, Canadian Journal of Biochemistry and Physiology. (1959) 37, no. 1, 911–917, https://doi.org/10.1139/y59-099.
10.1139/y59-099
CAS PubMed Web of Science® Google Scholar
24 Ashour M., Al-Souti A. S., and Hassan S. M., et al.Commercial Seaweed Liquid Extract as Strawberry Biostimulants and Bioethanol Production, Life. (2022) 13, no. 1, https://doi.org/10.3390/life13010085, 85.
10.3390/life13010085
PubMed Google Scholar
25 APHA, Standard Methods for the Examination of Water and Wastewater, 2005, American Public Health Association (APHA), Washington, DC, USA.
Google Scholar
26 Venkateswarlu V., Seshaiah P., Arun P., and Behra P., A Study on Water Quality Parameters in Shrimp l. Vannamei Semi-Intensive Grow Out Culture Farms in Coastal Districts of Andhra Pradesh, India, International Journal of Fisheries and Aquatic Studies. (2019) 7, 394–399.
Google Scholar
27 Spoors F., James M. A., Mendo T., McKnight J. C., Bønnelycke E.-M. S., and Khan N., Investigating Clove Oil and its Derivatives as Anaesthetic Agents for Decapod Crustaceans to Improve Welfare Commercially and at Slaughter, Frontiers in Animal Science. (2023) 4, https://doi.org/10.3389/fanim.2023.1180977, 1180977.
10.3389/fanim.2023.1180977
Web of Science® Google Scholar
28 AOAC, Official Methods of Analysis of the Association of Official Analytical Chemists Association of Official Analytical Chemists (AOAC), 2003.
Google Scholar
29 Moss D. M., Rudis M., and Henderson S. O., Cross-Sensitivity and the Anticonvulsant Hypersensitivity Syndrome, The Journal of Emergency Medicine. (1999) 17, no. 3, 503–506, https://doi.org/10.1016/S0736-4679(99)00042-6, 2-s2.0-0032955034.
10.1016/S0736-4679(99)00042-6
CAS PubMed Web of Science® Google Scholar
30 Caraway W. T., A Stable Starch Substrate for the Determination of Amylase in Serum and Other Body Fluids, American Journal of Clinical Pathology. (1959) 32, no. 1, 97–99, https://doi.org/10.1093/ajcp/32.1_ts.97.
10.1093/ajcp/32.1_ts.97
CAS PubMed Web of Science® Google Scholar
31 Aebi H., [13] Catalase in Vitro, Methods in Enzymology. (1984) 105, 121–126.
10.1016/S0076-6879(84)05016-3
CAS PubMed Web of Science® Google Scholar
32 Ohkawa H., Ohishi N., and Yagi K., Assay for Lipid Peroxides in Animal Tissues by Thiobarbituric Acid Reaction, Analytical Biochemistry. (1979) 95, no. 2, 351–358, https://doi.org/10.1016/0003-2697(79)90738-3, 2-s2.0-0018384650.
10.1016/0003-2697(79)90738-3
CAS PubMed Web of Science® Google Scholar
33 Nishikimi M., Appaji Rao N., and Yagi K., The Occurrence of Superoxide Anion in the Reaction of Reduced Phenazine Methosulfate and Molecular Oxygen, Biochemical and Biophysical Research Communications. (1972) 46, no. 2, 849–854, https://doi.org/10.1016/S0006-291X(72)80218-3, 2-s2.0-0015530358.
10.1016/S0006-291X(72)80218-3
CAS PubMed Web of Science® Google Scholar
34 Harshbarger J. C., Spero P. M., and Wolcott N. M., Neoplasms in Wild Fish From the Marine Ecosystem, Pathobiology of Marine and Estuarine Organisms. (1992) 2, 157.
Google Scholar
35 Goncalves P., Guertler C., Bachère E., de Souza C. R. B., Rosa R. D., and Perazzolo L. M., Molecular Signatures at Imminent Death: Hemocyte Gene Expression Profiling of Shrimp Succumbing to Viral and Fungal Infections, Developmental & Comparative Immunology. (2014) 42, no. 2, 294–301, https://doi.org/10.1016/j.dci.2013.09.017, 2-s2.0-84886445678.
10.1016/j.dci.2013.09.017
CAS PubMed Web of Science® Google Scholar
36 Liu W.-C., Zhou S.-H., Balasubramanian B., Zeng F.-Y., Sun C.-B., and Pang H.-Y., Dietary Seaweed (Enteromorpha) Polysaccharides Improves Growth Performance Involved in Regulation of Immune Responses, Intestinal Morphology and Microbial Community in Banana Shrimp Fenneropenaeus Merguiensis, Fish & Shellfish Immunology. (2020) 104, 202–212, https://doi.org/10.1016/j.fsi.2020.05.079.
10.1016/j.fsi.2020.05.079
CAS PubMed Web of Science® Google Scholar
37 Wang Y.-C., Chang P.-S., and Chen H.-Y., Tissue Expressions of Nine Genes Important to Immune Defence of the Pacific White Shrimp Litopenaeus Vannamei, Fish & Shellfish Immunology. (2007) 23, no. 6, 1161–1177, https://doi.org/10.1016/j.fsi.2007.04.004, 2-s2.0-35648931381.
10.1016/j.fsi.2007.04.004
CAS PubMed Web of Science® Google Scholar
38 Nuñez-Hernandez D., Camacho-Jiménez L., and Leyva-Carrillo L., et al.Expression of p53 Isoforms in Response to Two Levels of Hypoxia and Effects of p53 Knock-Down in Glyceraldehyde-3-Phosphate Dehydrogenase in the White Shrimp Litopenaeus Vannamei, Aquaculture Research. (2021) 52, no. 5, 2313–2323, https://doi.org/10.1111/are.15083.
10.1111/are.15083
CAS Web of Science® Google Scholar
39 Livak K. J. and Schmittgen T. D., Analysis of Relative Gene Expression Data Using Real-Time Quantitative Pcr and the 2^−δδct Method, Methods. (2001) 25, no. 4, 402–408, https://doi.org/10.1006/meth.2001.1262, 2-s2.0-0035710746.
10.1006/meth.2001.1262
CAS PubMed Web of Science® Google Scholar
40 Zar J. H., Statistical Significance of Mutation Frequencies, and the Power of Statistical Testing, Using the Poisson Distribution, Biometrical Journal. (1984) 26, no. 1, 83–88, https://doi.org/10.1002/bimj.4710260116, 2-s2.0-71749107274.
10.1002/bimj.4710260116
Web of Science® Google Scholar
41 Duncan D. B., Multiple Range and Multiple F Tests, Biometrics. (1955) 11, no. 1, 1–42, https://doi.org/10.2307/3001478.
10.2307/3001478
PubMed Web of Science® Google Scholar
42 Swift M. L., Graphpad Prism, Data Analysis, and Scientific Graphing, Journal of Chemical Information and Computer Sciences. (1997) 37, no. 2, 411–412, https://doi.org/10.1021/ci960402j, 2-s2.0-50849130329.
10.1021/ci960402j
CAS Web of Science® Google Scholar
43 Firdous A. P., Sindhu E. R., Ramnath V., and Kuttan R., Anticarcinogenic Activity of Meso-Zeaxanthin in Rodents and its Possible Mechanism of Action, Nutrition and Cancer. (2013) 65, no. 6, 850–856, https://doi.org/10.1080/01635581.2013.801501, 2-s2.0-84882331967.
10.1080/01635581.2013.801501
CAS PubMed Web of Science® Google Scholar
44 Bouyahya A., El Omari N., and Hakkur M., et al.Sources, Health Benefits, and Biological Properties of Zeaxanthin, Trends in Food Science & Technology. (2021) 118, 519–538, https://doi.org/10.1016/j.tifs.2021.10.017.
10.1016/j.tifs.2021.10.017
CAS Web of Science® Google Scholar
45 Tavanappanavar A. N., Mulla S. I., and Seth C. S., et al.Phytochemical Analysis, GC-MS Profile and Determination of Antibacterial, Antifungal, Anti-Inflammatory, Antioxidant Activities of Peel and Seeds Extracts (Chloroform and Ethyl Acetate) of Tamarindus indica L, Saudi Journal of Biological Sciences. (2024) 31, no. 1, https://doi.org/10.1016/j.sjbs.2023.103878, 103878.
10.1016/j.sjbs.2023.103878
CAS PubMed Google Scholar
46 Losso J. and Bansode R., Anti-Angiogenic Functional Food, Degenerative Disease and Cancer, Functional Foods, Ageing and Degenerative Disease, 2004, Woodhead Publishing, 485–523.
10.1533/9781855739017.4.485
Google Scholar
47 Bharathi M., Sivamaruthi B. S., Kesika P., Thangaleela S., and Chaiyasut C., In Silico Screening of Bioactive Compounds of Representative Seaweeds to Inhibit SARS-CoV-2 ACE2-Bound Omicron B.1.1.529 Spike Protein Trimer, Marine Drugs. (2022) 20, no. 2, https://doi.org/10.3390/md20020148, 148.
10.3390/md20020148
CAS PubMed Web of Science® Google Scholar
48 Rizwana H., Al Otibi F., and Al-Malki N., Chemical Composition, FTIR Studies and Antibacterial Activity of Passiflora Edulis f. Edulis (Fruit), Journal of Pure and Applied Microbiology. (2019) 13, no. 4, 2489–2498, https://doi.org/10.22207/JPAM.13.4.64.
10.22207/JPAM.13.4.64
CAS Google Scholar
49 Chan P., Cheng J.-T., Tsao C.-W., Niu C.-S., and Hong C.-Y., The in Vitro Antioxid Ant Activity of Trilinolein and Other Lipid-Related Natural Substances as Measured by Enhanced Chemiluminescence, Life Sciences. (1996) 59, no. 24, 2067–2073, https://doi.org/10.1016/S0024-3205(96)00560-7, 2-s2.0-0030575828.
10.1016/S0024-3205(96)00560-7
CAS PubMed Google Scholar
50 Chan P., Kao P.-F., and Tomlinson B., Cardiovascular Effects of Trilinolein, a Natural Triglyceride Isolated From the Herb Sanchi (Panax Notoginseng), Acta Cardiologica Sinica. (2005) 21, 71–76.
Google Scholar
51 Chen Y.-F., Wu K.-J., Siao L.-R., and Tsai H.-Y., Trilinolein, a Natural Triacylglycerol, Protects Cerebral Ischemia Through Inhibition of Neuronal Apoptosis and Ameliorates Intimal Hyperplasia via Attenuation of Migration and Modulation of Matrix Metalloproteinase-2 and RAS/MEK/ERK Signaling Pathway in VSMCS, International Journal of Molecular Sciences. (2022) 23, no. 21, https://doi.org/10.3390/ijms232112820, 12820.
10.3390/ijms232112820
CAS PubMed Web of Science® Google Scholar
52 Ashour M., Al-Souti A. S., and Mabrouk M. M., et al.A Commercial Seaweed Extract Increases Growth Performance, Immune Responses, and Related Gene Expressions in Whiteleg Shrimp (Litopenaeus vannamei), Aquaculture Reports. (2024) 36, https://doi.org/10.1016/j.aqrep.2024.102154, 102154.
10.1016/j.aqrep.2024.102154
Web of Science® Google Scholar
53 Goda M., Eltamany E. E., Hassanean H., Abdelhameed R. F., and Ibrahim A. K., B: Gas Chromatography-Mass Spectrometry Analysis of Marine Seagrass Thalassodendron Ciliatum Collected From Red Sea, Records of Pharmaceutical and Biomedical Sciences. (2020) 4, no. 2, 1–15, https://doi.org/10.21608/rpbs.2020.27958.1058.
10.21608/rpbs.2020.27958.1058
Google Scholar
54 Hashem E. Z., Khodadadi M., and Asadi F., et al.The Antioxidant Activity of Palmitoleic Acid on the Oxidative Stress Parameters of Palmitic Acid in Adult Rat Cardiomyocytes, Annals of Military and Health Sciences Research. (2016) 14, e11467.
Google Scholar
55 Bermúdez M. A., Pereira L., Fraile C., Valerio L., Balboa M. A., and Balsinde J., Roles of Palmitoleic Acid and Its Positional Isomers, Hypogeic and Sapienic Acids, in Inflammation, Metabolic Diseases and Cancer, Cells. (2022) 11, no. 14, https://doi.org/10.3390/cells11142146, 2146.
10.3390/cells11142146
CAS PubMed Web of Science® Google Scholar
56 Wang X., Zhang C., and Bao N., Molecular Mechanism of Palmitic Acid and its Derivatives in Tumor Progression, Frontiers in Oncology. (2023) 13, https://doi.org/10.3389/fonc.2023.1224125, 1224125.
10.3389/fonc.2023.1224125
CAS PubMed Web of Science® Google Scholar
57 Granum E., Kirkvold S., and Myklestad S. M., Cellular and Extracellular Production of Carbohydrates and Amino Acids by the Marine Diatom Skeletonema Costatum: Diel Variations and Effects of N Depletion, Marine Ecology Progress Series. (2002) 242, 83–94, https://doi.org/10.3354/meps242083, 2-s2.0-0037175218.
10.3354/meps242083
CAS Web of Science® Google Scholar
58 Wu M., Gao G., Jian Y., and Xu J., High CO₂ Increases Lipid and Polyunsaturated Fatty Acid Productivity of the Marine Diatom Skeletonema Costatum in a Two-Stage Model, Journal of Applied Phycology. (2022) 34, 43–50.
10.1007/s10811-021-02619-5
CAS Web of Science® Google Scholar
59 Nurhidayati T., Purnobasuki H., Muslihatin W., Ferdianto A., and Purwani K. I., The Influences of N and Si on Growth and Lipid Content of Microalgae Skeletonema Costatum, AIP Conference Proceedings, 2023, AIP Publishing.
Google Scholar
60 Shang X., Yang Y., Zan Y., Sun Z., Lu Z., and Sun J., Effects of Temperature on the Growth, Total Lipid Content and Fatty Acid Composition of Skeletonema Dohrnii, Frontiers in Marine Science. (2024) 11, https://doi.org/10.3389/fmars.2024.1361157, 1361157.
10.3389/fmars.2024.1361157
Web of Science® Google Scholar
61 Bastos C. R., Maia I. B., Pereira H., Navalho J., and Varela J. C., Optimisation of Biomass Production and Nutritional Value of Two Marine Diatoms (Bacillariophyceae), Skeletonema Costatum and Chaetoceros Calcitrans, Biology. (2022) 11, no. 4, https://doi.org/10.3390/biology11040594, 594.
10.3390/biology11040594
CAS PubMed Web of Science® Google Scholar
62 Javid S., Ather H., and Hani U., et al.Discovery of Novel Myristic Acid Derivatives as N-Myristoyltransferase Inhibitors: Design, Synthesis, Analysis, Computational Studies and Antifungal Activity, Antibiotics. (2023) 12, no. 7, https://doi.org/10.3390/antibiotics12071167, 1167.
10.3390/antibiotics12071167
CAS Google Scholar
63 Liu C., Yuan C., Ramaswamy H. S., Ren Y., and Ren X., Antioxidant Capacity and Hepatoprotective Activity of Myristic Acid Acylated Derivative of Phloridzin, Heliyon. (2019) 5, no. 5, https://doi.org/10.1016/j.heliyon.2019.e01761, 2-s2.0-85066168761, e01761.
10.1016/j.heliyon.2019.e01761
PubMed Web of Science® Google Scholar
64 Cao H., Gerhold K., Mayers J. R., Wiest M. M., Watkins S. M., and Hotamisligil G. S., Identification of a Lipokine, a Lipid Hormone Linking Adipose Tissue to Systemic Metabolism, Cell. (2008) 134, no. 6, 933–944, https://doi.org/10.1016/j.cell.2008.07.048, 2-s2.0-51549107903.
10.1016/j.cell.2008.07.048
CAS PubMed Web of Science® Google Scholar
65 de Souza C. O., Vannice G. K., Rosa Neto J. C., and Calder P. C., Is Palmitoleic Acid a Plausible Nonpharmacological Strategy to Prevent or Control Chronic Metabolic and Inflammatory Disorders?, Molecular Nutrition & Food Research. (2018) 62, no. 1, https://doi.org/10.1002/mnfr.201700504, 2-s2.0-85040355172, 1700504.
10.1002/mnfr.201700504
Google Scholar
66 Chi C., Giri S. S., and Jun J. W., et al.Effect of the Algaecide Palmitoleic Acid on the Immune Function of the Bay Scallop Argopecten Irradians, Molecules (Basel, Switzerland). (2016) 21, no. 5, https://doi.org/10.3390/molecules21050610, 2-s2.0-84973629604, 610.
10.3390/molecules21050610
PubMed Web of Science® Google Scholar
67 Chi C., Giri S. S., and Jun J. W., et al.Detoxification and Immune Transcriptomic Response of the Gill Tissue of Bay Scallop (Argopecten Irradians) Following Exposure to the Algicide Palmitoleic Acid, Biomolecules. (2018) 8, 139.
10.3390/biom8040139
PubMed Web of Science® Google Scholar
68 Chan P. and Tomlinson B., Antioxidant Effects of Chinese Traditional Medicine: Focus on Trilinolein Isolated From the Chinese Herb Sanchi (Panax pseudoginseng), The Journal of Clinical Pharmacology. (2000) 40, no. 5, 457–461, https://doi.org/10.1177/00912700022009215, 2-s2.0-0033672871.
10.1177/00912700022009215
CAS PubMed Web of Science® Google Scholar
69 Ashour M., Mabrouk M. M., and Ayoub H. F., et al.Effect of Dietary Seaweed Extract Supplementation on Growth, Feed Utilization, Hematological Indices, and Non-Specific Immunity of Nile Tilapia, Oreochromis Niloticus Challenged With Aeromonas Hydrophila, Journal of Applied Phycology. (2020) 32, no. 5, 3467–3479, https://doi.org/10.1007/s10811-020-02178-1.
10.1007/s10811-020-02178-1
CAS Web of Science® Google Scholar
70 Ashour M., Mabrouk M. M., and Abo-Taleb H. A., et al.A Liquid Seaweed Extract (tam®) Improves Aqueous Rearing Environment, Diversity of Zooplankton Community, Whilst Enhancing Growth and Immune Response of Nile Tilapia, Oreochromis Niloticus, Challenged by Aeromonas Hydrophila, Aquaculture. (2021) 543, https://doi.org/10.1016/j.aquaculture.2021.736915, 736915.
10.1016/j.aquaculture.2021.736915
CAS Web of Science® Google Scholar
71 Hassan S. M., Ashour M., and Sakai N., et al.Impact of Seaweed Liquid Extract Biostimulant on Growth, Yield, and Chemical Composition of Cucumber (Cucumis sativus), Agriculture. (2021) 11, no. 4, https://doi.org/10.3390/agriculture11040320, 320.
10.3390/agriculture11040320
CAS Web of Science® Google Scholar
72 Lim K. C., Yusoff F. M., Karim M., and Natrah F. M. I., Carotenoids Modulate Stress Tolerance and Immune Responses in Aquatic Animals, Reviews in Aquaculture. (2023) 15, no. 2, 872–894, https://doi.org/10.1111/raq.12767.
10.1111/raq.12767
Web of Science® Google Scholar
73 Tan K., Zhang H., Lim L.-S., Ma H., Li S., and Zheng H., Roles of Carotenoids in Invertebrate Immunology, Frontiers in Immunology. (2020) 10, https://doi.org/10.3389/fimmu.2019.03041, 3041.
10.3389/fimmu.2019.03041
PubMed Web of Science® Google Scholar
74 Yu W., Zhang M., Wang B., Xu R., Pang T., and Liu J., Dietary Haematococcus Pluvialis Powder Supplementation Affect Carotenoid Content, Astaxanthin Isomer, Antioxidant Capacity and Immune-Related Gene Expression in Pacific White Shrimp, Litopenaeus Vannamei, Aquaculture Research. (2021) 52, no. 6, 2403–2414, https://doi.org/10.1111/are.15090.
10.1111/are.15090
CAS Web of Science® Google Scholar
75 Mansour A. T., Ashour M., and Abbas E. M., et al.Growth Performance, Immune-Related and Antioxidant Genes Expression, and Gut Bacterial Abundance of Pacific White Leg Shrimp, Litopenaeus Vannamei, Dietary Supplemented With Natural Astaxanthin, Frontiers in Physiology. (2022) 13, https://doi.org/10.3389/fphys.2022.874172, 874172.
10.3389/fphys.2022.874172
PubMed Web of Science® Google Scholar
76 Iba W., Rice M. A., and Wikfors G. H., Microalgae in Eastern Pacific White Shrimp, Litopenaeus Vannamei (Boone 1931) Hatcheries: A Review on Roles and Culture Environments, Asian Fisheries Science. (2014) 27, no. 3, 212–233, https://doi.org/10.33997/j.afs.2014.27.3.005.
10.33997/j.afs.2014.27.3.005
Google Scholar
77 Lestari D. P., Ekawati A. W., and Maftuch M., Dried Skeletonema Costatum in Feed Formulation for the Growth of Vaname Shrimp (Litopenaeus vannamei), The Journal of Experimental Life Sciences. (2014) 4, no. 2, 45–49, https://doi.org/10.21776/ub.jels.2014.004.02.04.
10.21776/ub.jels.2014.004.02.04
Google Scholar
78 Sharawy Z. Z., Ashour M., Labena A., Alsaqufi A. S., Mansour A. T., and Abbas E. M., Effects of Dietary Arthrospira Platensis Nanoparticles on Growth Performance, Feed Utilization, and Growth-Related Gene Expression of Pacific White Shrimp, Litopenaeus vannamei, Aquaculture. (2022) 551, https://doi.org/10.1016/j.aquaculture.2022.737905, 737905.
10.1016/j.aquaculture.2022.737905
CAS Web of Science® Google Scholar
79 Mabrouk M. M., Ashour M., and Labena A., et al.Nanoparticles of Arthrospira Platensis Improves Growth, Antioxidative and Immunological Responses of Nile Tilapia (Oreochromis niloticus) and its Resistance to Aeromonas hydrophila, Aquaculture Research. (2022) 53, no. 1, 125–135, https://doi.org/10.1111/are.15558.
10.1111/are.15558
CAS Web of Science® Google Scholar
80 Goda A. M.-S., Aboseif A. M., and Mohammedy E. Y., et al.Earthen Pond-Based Floating Beds for Rice-Fish Co-Culture as a Novel Concept for Climate Adaptation, Water Efficiency Improvement, Nitrogen and Phosphorus Management, Aquaculture. (2024) 579, https://doi.org/10.1016/j.aquaculture.2023.740215, 740215.
10.1016/j.aquaculture.2023.740215
CAS Web of Science® Google Scholar
81 Xu T., Xia Q.-X., Long J., and Long X., A Study on Multi-Domain Modeling and Simulation of Precision High-Speed Servo Numerical Control Punching Press, Proceedings of the Institution of Mechanical Engineers, Part I: Journal of Systems and Control Engineering. (2018) 232, no. 7, 830–844, https://doi.org/10.1177/0959651818762945, 2-s2.0-85045065587.
10.1177/0959651818762945
Web of Science® Google Scholar
82 de Moraes L. B. S., Santos R. F. B., and Gonçalves Junior G. F., et al.Microalgae for Feeding of Penaeid Shrimp Larvae: An Overview, Aquaculture International. (2022) 30, 1295–1313.
10.1007/s10499-022-00857-z
Web of Science® Google Scholar
83 Fioramonti J., Fargeas M. J., Bertrand V., Pradayrol L., and Bueno L., Induction of Postprandial Intestinal Motility and Release of Cholecystokinin by Polyamines in Rats, American Journal of Physiology-Gastrointestinal and Liver Physiology. (1994) 267, no. 6, G960–G965, https://doi.org/10.1152/ajpgi.1994.267.6.G960.
10.1152/ajpgi.1994.267.6.G960
CAS Web of Science® Google Scholar
84 Zaky A. A., Paterson S., Gómez-Cortés P., and Hernández-Ledesma B., Bioactive Peptides Released From Microalgae During Gastrointestinal Digestion, Protein Digestion-Derived Peptides. (2024) 335–352.
10.1016/B978-0-443-19141-1.00012-1
Google Scholar
85 Pakravan S., Akbarzadeh A., Sajjadi M. M., Hajimoradloo A., and Noori F., Partial and Total Replacement of Fish Meal by Marine Microalga Spirulina platensis in the Diet of Pacific White Shrimp Litopenaeus vannamei: Growth, Digestive Enzyme Activities, Fatty Acid Composition and Responses to Ammonia and Hypoxia Stress, Aquaculture Research. (2017) 48, no. 11, 5576–5586, https://doi.org/10.1111/are.13379, 2-s2.0-85019088033.
10.1111/are.13379
CAS Web of Science® Google Scholar
86 Abbas E. M., Ali F., and Desouky S., et al.Novel Comprehensive Molecular and Ecological Study Introducing Coastal Mud Shrimp (Solenocera Crassicornis) Recorded at the Gulf of Suez, Egypt, Journal of Marine Science and Engineering. (2021) 9, no. 1, https://doi.org/10.3390/jmse9010009, 9.
10.3390/jmse9010009
Web of Science® Google Scholar
87 Rajendran K., Sreedharan K., Deepika A., and Kulkarni A., Shrimp Immune System and Immune Responses, Fish Immune System and Vaccines, 2022, Springer, 17–43.
Google Scholar
88 Cakir M. and Karatas T., Assessment of the Protective Role of Dietary Rosemary Extract Against Deltamethrin-Induced Neuroimmunity, Apoptosis, and DNA Damage in Rainbow Trout Brain Tissue (Oncorhynchus mykiss), The European Zoological Journal. (2024) 91, no. 2, 1093–1103, https://doi.org/10.1080/24750263.2024.2401400.
10.1080/24750263.2024.2401400
CAS Web of Science® Google Scholar
89 Akbari P., Gholamhosseini A., Ali M., Aminikhoei Z., Rezaei Tavabe K., and Samadi Kuchaksaraei B., Growth, Fatty Acid Composition, Antioxidant Activity and Resistance of Litopenaeus Vannamei Fed With Dunaliella Salina, Iranian Journal of Science. (2023) 47, no. 1, 35–45, https://doi.org/10.1007/s40995-022-01396-1.
10.1007/s40995-022-01396-1
Web of Science® Google Scholar
90 Zhang D., Shi S., and Jia X., et al.Effects of Dietary Hot Water Extracts of Chlorella Vulgaris on Muscle Component, Non-Specific Immunity, Antioxidation, and Resistance to Non-Ionic Ammonia Stress in Pacific White Shrimp Litopenaeus vannamei, Frontiers in Marine Science. (2024) 11, https://doi.org/10.3389/fmars.2024.1431852, 1431852.
10.3389/fmars.2024.1431852
Web of Science® Google Scholar
91 Hu X., Ma W., and Zhang D., et al.Application of Natural Antioxidants as Feed Additives in Aquaculture: A Review, Biology. (2025) 14, no. 1, https://doi.org/10.3390/biology14010087, 87.
10.3390/biology14010087
CAS PubMed Web of Science® Google Scholar
92 Mabrouk M., Ashour M., and Abdelghany M. F., et al.Effects of Dietary Supplementation With Benthic Diatom Amphora coffeaeformis on Blood Biochemistry, Steroid Hormone Levels and Seed Production Efficiency of Nile Tilapia Oreochromis niloticus Broodstock, Journal of Animal Physiology and Animal Nutrition. (2024) 108, no. 6, 1605–1615, https://doi.org/10.1111/jpn.14004.
10.1111/jpn.14004
CAS PubMed Web of Science® Google Scholar
93 Sandeep K., Sivaramakrishnan T., and Sudhin S., et al.Influence of Dietary Microalgal Concentrates on Growth, Survival and Health Status of Penaeus Vannamei, Aquaculture International. (2023) 31, no. 5, 2883–2903, https://doi.org/10.1007/s10499-023-01114-7.
10.1007/s10499-023-01114-7
CAS Web of Science® Google Scholar
94 Bu R., Wang P., Zhao C., Bao W., and Qiu L., Gene Characteristics, Immune and Stress Responses of PmPrx1 in Black Tiger Shrimp (Penaeus monodon): Insights From Exposure to Pathogenic Bacteria and Toxic Environmental Stressors, Developmental & Comparative Immunology. (2017) 77, 1–16, https://doi.org/10.1016/j.dci.2017.07.002, 2-s2.0-85025113012.
10.1016/j.dci.2017.07.002
PubMed Web of Science® Google Scholar
95 Wanvimonsuk S. and Somboonwiwat K., Peroxiredoxin-4 Supplementation Modulates the Immune Response, Shapes the Intestinal Microbiome, and Enhances AHPND Resistance in Penaeus Vannamei, Fish & Shellfish Immunology. (2023) 139, https://doi.org/10.1016/j.fsi.2023.108915, 108915.
10.1016/j.fsi.2023.108915
CAS PubMed Web of Science® Google Scholar
96 Phan H. N. T., Nguyen H. L., and Dinh T. H., et al.Phenoloxidases From Black Tiger Shrimp (Penaeus monodon): Gene Expression and Activity Distribution in Different Tissues, Aquaculture International. (2023) 31, 1423–1437.
10.1007/s10499-022-01033-z
CAS Web of Science® Google Scholar
97 Cerenius L. and Söderhäll K., Immune Properties of Invertebrate Phenoloxidases, Developmental & Comparative Immunology. (2021) 122, https://doi.org/10.1016/j.dci.2021.104098, 104098.
10.1016/j.dci.2021.104098
CAS PubMed Web of Science® Google Scholar
98 Amparyup P., Charoensapsri W., and Tassanakajon A., Prophenoloxidase System and its Role in Shrimp Immune Responses Against Major Pathogens, Fish & Shellfish Immunology. (2013) 34, no. 4, 990–1001, https://doi.org/10.1016/j.fsi.2012.08.019, 2-s2.0-84875376505.
10.1016/j.fsi.2012.08.019
CAS PubMed Web of Science® Google Scholar
99 Cano L. G., Role of p73 and p53 in the Biology of Neural Stem Cells and in the Architecture of the Neurogenic Niches in Mouse Brain, 2013, Universidad de León.
Google Scholar
100 Li H., Wang S., and Chen Y., et al.Identification of Two p53 Isoforms From Litopenaeus Vannamei and Their Interaction With NF-κb to Induce Distinct Immune Response, Scientific Reports. (2017) 7, no. 1, https://doi.org/10.1038/srep45821, 2-s2.0-85016552990, 45821.
10.1038/srep45821
CAS PubMed Google Scholar
101 Guru A., Sudhakaran G., Murugan R., Arshad A., and Arockiaraj J., Double-Edged Sword Role of Shrimp Mirna Explains an Evolutionary Language Between Shrimp-Pathogen Interactions That Unties the Knot of Shrimp Infection, Reviews in Aquaculture. (2022) 14, 578–593.
10.1111/raq.12613
Web of Science® Google Scholar
102 Zhang Y., Yan F., and Hu Z., et al.Hemocyanin From Shrimp Litopenaeus Vannamei Shows Hemolytic Activity, Fish & Shellfish Immunology. (2009) 27, no. 2, 330–335, https://doi.org/10.1016/j.fsi.2009.05.017, 2-s2.0-67650508522.
10.1016/j.fsi.2009.05.017
PubMed Web of Science® Google Scholar
103 Zhao X., Qiao J., and Zhang P., et al.Protein Diversity and Immune Specificity of Hemocyanin From Shrimp Litopenaeus Vannamei, Frontiers in Immunology. (2021) 12, https://doi.org/10.3389/fimmu.2021.772091, 772091.
10.3389/fimmu.2021.772091
CAS PubMed Web of Science® Google Scholar
104 Immanuel G., Sivagnanavelmurugan M., Marudhupandi T., Radhakrishnan S., and Palavesam A., The Effect of Fucoidan From Brown Seaweed Sargassum Wightii on WSSV Resistance and Immune Activity in Shrimp Penaeus Monodon (Fab), Fish & Shellfish Immunology. (2012) 32, no. 4, 551–564, https://doi.org/10.1016/j.fsi.2012.01.003, 2-s2.0-84856641101.
10.1016/j.fsi.2012.01.003
CAS PubMed Web of Science® Google Scholar
105 Setyawan A., Isnansetyo A., Indarjulianto S., and Handayani C. R., Comparative Immune Response of Dietary Fucoidan From Three Indonesian Brown Algae in White Shrimp Litopenaeus Vannamei, Aquaculture, Aquarium, Conservation & Legislation. (2018) 11, 1707–1723.
Google Scholar
106 Alprol A. E., Mansour A. T., Ibrahim M. E. E.-D., and Ashour M., Artificial Intelligence Technologies Revolutionizing Wastewater Treatment: Current Trends and Future Prospective, Water. (2024) 16, no. 2, https://doi.org/10.3390/w16020314, 314.
10.3390/w16020314
CAS Web of Science® Google Scholar

All articles

Marine Diatom Skeletonema costatum Dietary Supplementation Improves Growth, Immunological Responses, Antioxidant Activities, Gene Expressions, and Digestive Enzymes of Shrimp Litopenaeus vannamei

Abstract

1. Introduction

2. Materials and Methods

2.1. Marine Diatom, S. costatum

2.1.1. Isolation and Culture Conditions

2.1.2. Biochemical Composition and Phytochemical Content

2.2. Pacific Whiteleg Shrimp

2.2.1. Experimental Techniques

2.2.2. Experimental Diet and Procedures

2.2.3. Growth Performance Achievement

2.2.4. Samples Collection

2.2.5. Shrimp’s Carcass Analysis

2.2.6. Digestive Enzyme Activities

2.2.7. Antioxidant Activities

2.2.8. Lysozyme Activities

2.2.9. Immunity-Related Genes Expressions

2.3. Statistical Analysis

3. Results

3.1. Marine Diatom, S. costatum

3.1.1. Biochemical Composition

3.1.2. Phytochemical Compounds Content

3.2. Pacific Whiteleg Shrimp

3.2.1. Growth Indicators

3.2.2. Carcass Analysis

3.2.3. Digestive Enzyme Activities

3.2.4. Antioxidant Activities and Nonspecific Immunity Response

3.2.5. Immunity-Related Gene Expressions

4. Discussion

4.1. S. costatum

4.2. Pacific Whiteleg Shrimp

5. Conclusion

Conflicts of Interest

Author Contributions

Funding

Open Research

Data Availability Statement

References

Figures

References

Related

Information