2.1 Generation and identification of human il-6r knock-in mice

To explore the effects of mIL-6R-mediated signaling and mIL-6R blockade on SIRS, we employed CRISPR-Cas9 technology to knock in the human il-6r gene because it is responsible for mIL-6R expression (Figure S1A). In brief, we designed guide RNA (gRNA) for il-6r as GAAGGAAGCATGCTGACCGT and performed nucleic acid electrophoresis to verify the validity of the il-6r gRNA (Figure S1B), as well as the T7-Cas9 vectors and Cas9 mRNA (Figure S1C). We constructed the homologous recombinant plasmid and identified the plasmid by PCR (Figure S1D). The nucleic acid electrophoresis showed the three spliced fragments of the homologous recombinant plasmid, with length of 852 bp, 6665 bp, and 8137 bp, respectively (Figure S1E). The homologous recombination mice named IL6r-e(hIL6R)1 were confirmed by PCR (Figure S1F). The amplification products showed that in 3′ homology arm of homologous recombinant positive mice were expected to be a 5.5 kbp-long fragment while that of the homologous recombinant negative mice were expected to yield no fragment. The red lines indicated that the fragments of targeted allele PCR products were sequenced for comparing with the corresponding human il-6r gene DNA sequence. The electrophoresis of 5′ homology arm products showed that within the 40 P₀ transgenic mice, samples of No. 3, 8, 11, 14, and 23 mice were amplified with expected products of 5.6 kbp-long (Figure S1G). Thereafter, we chose these homologous recombinant positive (5′ homology arm) mice and verified that the 3′ homology arm products were 5.5 kbp, consistent with the expected length by electrophoresis (Figure S1H). Besides, the sequencing of PCR products confirmed that there were no mutation or insertion/deletion of DNA sequences in transgenic mice (data not shown).

All the offspring generations of IL6r-e(hIL6R)1 transgenic mice were confirmed by PCR. The PCR product of the wild-type (WT) mice was 553 bp, while the PCR product from the homozygous offspring generations of IL6r-e(hIL6R)1 mice was 894 bp (Figure 1A,B). Real-time quantitative PCR (qRT-PCR) and immunoblotting analysis showed that human il-6r gene was significantly expressed in the transgenic mice compared to the WT mice on both mRNA and protein levels (Figure 1C,D). Moreover, there were no differences in dietary habits and weight growing rate between the IL6r-e(hIL6R)1 mice and the WT mice (Figure 1E). Additionally, we performed H&E staining of the major organs including liver, heart, spleen, lung, kidney, and thymus and there were no development deficiencies in the human il-6r gene knock-in mice (Figure 1F). Therefore, human il-6r knock-in transgenic mouse IL6r-e(hIL6R)1 was generated and available for further studies.

2.2 Preparation of the specific monoclonal antibodies against human mIL-6R

To study the effects of mIL-6R blockade in human il-6r knock-in mice IL6r-e(hIL6R)1, we generated 21 in-house hybridoma clones (HCs) against the fragment Peptide3 (sequence: EWGPRSTPSLTTKAC) of human mIL-6R by the hybridoma technology. We collected and screened all the supernatants of the cell clones to determine the specificity of the obtained clones by Peptide3-conjugated Keyhole Limpet Hemocyanin (KLH) based enzyme-linked immunosorbent assay (ELISA, data not shown). We selected seven HCs with relative high specificity and then, we utilized the supernatants of the seven HCs (total protein concentration 100 μg/ml) and the serum of the immunized mice (PolyAb) containing the potential human mIL-6R mAbs as the primary antibody of immunoblotting for human mIL-6R detection in the human mIL-6R expressing cell line HepG2 and U251MG (Figure 2A,B). The results indicated that mAbs produced by No.2 HC and No.5 HC had relative higher specificity of human mIL-6R among the obtained HCs. Therefore, we purified these two clones to get 100 and 1 μg/ml mAbs respectively and performed flow cytometry analysis using the purified mAbs and the supernatants of No.2 HC and No.5 HC as the primary antibody to further examine the specificity to human mIL-6R in HepG2 cell line. We found that the percentage of the positive HepG2 cells detected by the No.2 HC and No.5 HC was significantly higher than that detected by the M-IgG as the primary antibody (Figure 2C,D), indicating that the purified No.2 HC and No.5 HC mAbs were specific to human mIL-6R than the M-IgG. Besides, we performed immunoblotting with the small quantity of total protein (2.5 and 5.0 μg) from the HepG2 cell lysates and used the purified mAbs from No.2 HC and No.5 HC and the commercial IL-6R antibody as the primary antibody of immunoblotting analysis. The results showed that the purified mAbs were able to detect mIL-6R from the small quantity of total protein (Figure 2E). To confirm the specificity of the purified mAbs, we knocked down the expression of IL-6R in HepG2 cells by small interfering RNAs (siRNAs) and detected the decreased IL-6R expression level by immunoblotting analysis using the purified mAbs from the HCs as the primary antibody (Figure 2F). The results showed that the mAb from No.5 HC had relative high specificity against human mIL-6R compared with other HCs. More importantly, the binding affinity of the mIL-6R mAb from No.5 HC was determined by surface plasmon resonance (SPR) with the K_d value of 1.1 × 10⁻⁹ M using the corresponding immunogen IL-6R-KLH. Furthermore, to verify the effectiveness of the human mIL-6R mAb from the No.5 HC and human mIL-6R expression in IL6r-e(hIL6R)1 mice, we performed immunoblotting analysis using the mIL-6R mAb from No.5 HC to detect mIL-6R protein levels in spleen, liver, and kidney tissues from the IL6r-e(hIL6R)1 mice (Figure 2G,H). In consistence with the results detected by the commercial human IL-6R antibody, the expression of human mIL-6R was significantly higher in the organs from the IL6r-e(hIL6R)1 mice compared to the organs from the WT mice. In addition, we collected PBMC from the IL6r-e(hIL6R)1 mice and performed flow cytometry assay using the mIL-6R mAb from the No.5 HC to detect human mIL-6R expression in CD3 positive cells from the PBMC. Consistently, we found that human mIL-6R expression was significantly higher than mouse mIL-6R expression in CD3 positive cells of the IL6r-e(hIL6R)1 mice and more importantly, we found that the No.5 HC mAb was capable of binding mIL-6R because human mIL-6R expression in CD3 positive cells was significantly higher in the IL6r-e(hIL6R)1 mice compared with that in the WT mice (Figure 2I). Taken together, after functional and structural identification, we chose the mAb from the No.5 HC (named as h-mIL-6R mAb) as the effective mAb against human mIL-6R for further studies.

2.3 The h-mIL-6R mAb alleviated LPS-induced SIRS in the IL6r-e(hIL6R)1 mice

To investigate the therapeutic effectiveness of mIL-6R mAbs for SIRS, we established the murine SIRS model by intraperitoneal injection of LPS. We utilized the commercialized IL-6R mAb Tocilizumab, of which SIRS is a candidate disease, as treatment for the positive control group and analyzed the survival time of LPS-induced SIRS mice with the h-mIL-6R or Tocilizumab treatment.⁸ The results showed that both the h-mIL-6R and Tocilizumab significantly improved the survival of the SIRS mice (Figure 3A), indicating the effectiveness of mIL-6R blockade in the treatment of SIRS. Besides, to evaluate the capability in controlling systemic inflammation response mediated by the mIL-6R mAb treatment, we measured the levels of pro-inflammatory cytokines in serum including TNF-α, IL-1β, IL-6, and interferon-γ (IFN-γ) of the indicated groups 6 h after the treatments, because increased levels of pro-inflammatory cytokines in serum is the prominent characteristic in the SIRS/sepsis model. The results showed that the h-mIL-6R mAb and Tocilizumab treatment significantly decreased serum concentrations of these four cytokines in the LPS-induced SIRS mice, implying that the IL-6R mAb treatment could contribute to alleviating systemic inflammation in SIRS (Figure 3B). In view of LPS-induced inflammatory injury and liver dysfunction, we detected liver injury biomarkers aspartate transaminase (AST) and alanine transaminase (ALT) in serum 24 h after the treatments. The results showed that the IL-6R mAbs remarkably decreased ALT and AST levels in the serum (Figure 3C). Furthermore, to determine the inflammation of the lung tissue, we detected levels of myeloperoxidase (MPO), the sensitive biomarker associated with neutrophil accumulation-mediated tissue injury in lung tissues.^{28, 29} The results suggested that MPO levels were significantly lowered in the h-mIL-6R mAb- and Tocilizumab-treated SIRS mice (Figure 3D), suggesting that inflammation in lung tissue was lessened by the IL-6R mAbs. Given that kidney injury is frequently complicated with SIRS, we detected blood urea nitrogen (BUN) and creatinine levels to evaluate the alterations of the renal function in the murine SIRS model. We found that both of the mIL-6R blockade treatments prominently reduced the levels of BUN and creatinine (Figure 3E,F) and they could mitigate renal dysfunction in LPS-induced SIRS.

In addition, histological malformation can be observed and be used for evaluating severity of organ dysfunctions by scoring analysis in SIRS.³⁰ As for liver injury, disappearance of sinus hepaticus, swollen hepatocytes, and slight infiltration of periportal neutrophils and macrophage were observed in lower degree of liver injury, while vacuolar degeneration, ballooning degeneration, and obscure nucleus of hepatocytes and severe inflammatory cell infiltration indicate moderate liver injury. The above alterations together with granulomas and necrosis of hepatocytes are found in higher degree of liver injury. H&E staining showed that the alterations including obscure nucleus (indicated by red arrows) and vacuolar degeneration (indicated by yellow arrows) in hepatocytes of the LPS-induced SIRS model are apparent (Figure 3G,H). The h-mIL-6R mAb decreased these malformations and infiltration of macrophages (indicated by blue arrows) in liver tissue of the SIRS mice. As for lung injury in SIRS, alveolar edema and congestion, macrophage infiltration, and small area of hemorrhage suggest lower degree of lung injury. Consolidation of lung tissue, large area of hemorrhage, and severe macrophage infiltration indicate moderate lung injury, and more hemorrhage, together with severe consolidation of lung tissue implies higher degree of lung injury in SIRS.³⁰ The results illustrated that while multiple foci of hemorrhage (indicated by red arrows), edema of lung tissue (indicated by yellow arrows) and severe macrophage infiltration (indicated by blue arrows) were found in the SIRS mice without therapy, both IL-6R mAbs alleviated histological injuries and reduced scores of lung tissue damage (Figure 3G,H). When it comes to kidney injury, histological malformations include cell lysis and necrosis, loss of brush border, tubular dilation, and inflammatory cell infiltration.³¹ We found that the h-mIL-6R and Tocilizumab significantly attenuated cell lysis and necrosis (indicated by red arrows) and infiltration of inflammatory cells (indicated by blue arrows, Figure 3G,H). These results indicated that the h-mIL-6R mAb and Tocilizumab relieved inflammatory responses and improved prognosis together with organ injury in the murine SIRS model.

2.4 The h-mIL-6R mAb mediated anti-inflammatory effects via the inhibition of NF-κB/Ccl2 signaling pathways in the LPS-treated THP-1 cells

Given that PBMC mediates inflammatory response via recognition and release of cytokines including IL-6 in SIRS, we focused on the effects of mIL-6R blockade on inflammatory response in PBMC isolated from LPS-treated IL6r-e(hIL6R)1 mice.³² To explore the mechanism underlying the inhibitory effect of mIL-6R blockade mediated by the h-mIL6R mAb in the LPS-induced murine SIRS model, we collected PBMC from the model with/without the h-mIL6R mAb (25 mg/kg) treatment and employed RNA-seq analysis to find out the differential expressed gene (DEG) profiles. We obtained 65 major DEGs (p < 0.05, q < 0.1) and then enriched the 65 DEGs into KEGG database. Considering the potential effects associated with inflammatory response and immune system caused by mIL-6R blockade, we selected the first nine significant KEGG pathways (Figure 4A) and the corresponding DEGs enriched to them. We found that “JAK-STAT signaling pathway” and “TNF signaling pathway” associated with IL-6 signaling were enriched, implying the effectiveness of mIL-6R blockade mediated by the h-mIL6R mAb to some extent. What's more, we found that “NOD-like receptor signaling pathway” concerned with inflammasome and pyroptosis downstream NF-κB signaling was also included in the enriched pathways, suggesting that mIL-6R blockade mediated by the h-mIL-6R mAb could be involved in NF-κB/NLRP3 signaling and pyroptosis in PBMC. Next, we got down to verifying expression alteration of the DEGs in the enriched pathways by qRT-PCR in PBMC. Considering IL-6R expression and IL-6/IL-6R were manipulated in the LPS-induced murine SIRS model with h-mIL-6R mAb treatment, we excluded these two genes and verified the rest seven DEGs. The results showed that compared with the LPS+M-IgG group, Ccl2 was significantly decreased by the h-mIL-6R mAb treatment in the LPS-induced SIRS model (Figure 4B). By contrast, other examined DEGs showed no significance with/without the h-mIL-6R mAb treatment. Previous studies reported that Ccl2 magnified the recruiting effect of inflammatory cells and expression of pro-inflammatory mediators of monocyte/macrophage.^{33, 34} What's more, Ccl2 expression was able to be activated by IL-6 treatment and by the transcription factor p65 of NF-κB signaling pathway with LPS treatment.^{21, 35} Therefore, mIL-6R blockade mediated by the h-mIL-6R mAb may protect from inflammatory responses and SIRS by regulating Ccl2 expression.

Forwardly, for verification of RNA-seq results and mechanism investigations in vitro, we used the human monocyte cell line THP-1, highly expressing IL-6R, for simulation of PBMC according to previous studies, because monocyte/macrophage is the important component of PBMC and exerts the role of effector cell of the innate immune system responding to LPS-induced systemic inflammatory response.^{36, 37} To verify the effectiveness of the h-mIL-6R mAb in mIL-6R blockade at first, we detected activation of JAK/STAT3 and JAK/MAPK (extracellular signal-regulated kinase, ERK) signaling pathway with IL-6 treatment, because IL-6/mIL-6R complex leads to activation of JAK and subsequent phosphorylation of cytoplasmic STAT3 and MAPK via gp130. We treated THP-1 cells with the h-mIL-6R mAb/Tocilizumab/M-IgG for 30 min, then added IL-6 to the cells and cultured the THP-1 (co-treated with the mAbs/M-IgG and IL-6) for another 6 h. Immunoblotting analysis showed that while IL-6 treatment significantly increased phosphorylation levels of JAK, STAT3 and ERK, the h-mIL-6R mAb inhibited phosphorylation of JAK, STAT3 and ERK, indicating that the h-mIL-6R mAb effectively blocked mIL-6R and suppressed activation of JAK/STAT3 and JAK/MAPK signaling pathway induced by IL-6 treatment (Figure 4C). These results demonstrated that the h-mIL-6R mAb was capable of blocking IL-6/mIL-6R signaling and inhibiting LPS-induced inflammatory signaling activation, which was in consistent with our results of the LPS-induced murine SIRS model.

To examine the protective effects from LPS-induced inflammatory signaling activation and potential effects on Ccl2 expression indicated by RNA-seq, we treated THP-1 cells with the h-mIL-6R mAb/Tocilizumab/M-IgG for 30 min, then added LPS to the cell and cultured the THP-1 (co-treated with the mAbs/M-IgG and LPS) for another 6 h. Subsequently, we detected the levels of pro-inflammatory cytokines including TNF-α, IL-1β, IL-6 and Ccl2 by qRT-PCR. We found that LPS stimulation promoted TNF-α, IL-1β, IL-6, and Ccl2 gene expression and more importantly, the h-mIL-6R mAb decreased mRNA levels of the above pro-inflammatory cytokines and Ccl2 (Figure 4D). More importantly, we detected levels of TNF-α and Ccl2 in the supernatant of the THP-1 by ELISA because they exert the pro-inflammatory effects following the secretion from the cells. We found that the h-mIL-6R and Tocilizumab deceased TNF-α and Ccl2 levels in the supernatant, suggesting that the mIL-6R blockade inhibited secretion of TNF-α and Ccl2 from the LPS-treated THP-1 cells (Figure 4E,F). Considering activation of NF-κB is critically required for LPS-induced inflammation, we studied the effects of the h-mIL-6R mAb on the regulation of the NF-κB signaling pathway. We detected phosphorylation of the key subunit of NF-κB, p65 and the inhibitive regulation factor inhibitor of NF-κB (IκB) by immunoblotting analysis (Figure 4G). We found that the h-mIL-6R mAb and Tocilizumab could promote phosphorylation of IκB and p65, suggesting that both of the mIL-6R blockade mAbs effectively inhibited LPS-induced activation of the NF-κB signaling pathway. To verify whether mIL-6R blockade could regulate Ccl2 expression, we also detected Ccl2 levels and found that the h-mIL-6R mAb remarkably inhibited LPS-induced Ccl2 expression. To clarify whether NF-κB regulates mIL-6R blockade-mediated Ccl2 inhibition, we utilized NF-κB inhibitor BAY 11-7082 in addition to the h-mIL-6R mAb and LPS co-treatment. The results showed that the combination of the NF-κB inhibitor and the h-mIL-6R mAb forwardly decreased LPS-induced Ccl2 expression in the THP-1 cells (Figure 4H). Collectively, mIL-6R blockade mediated by the h-mIL-6R mAb or Tocilizumab was able to inhibit the pro-inflammatory signaling NF-κB/Ccl2 in LPS-treated monocyte.

2.5 The h-mIL-6R mAb inhibited NLRP3-mediated inflammasome formation and pyroptosis in the LPS-treated THP-1 cells

Although the KEGG enrichment analysis of the RNA-seq results indicated that IL-6R blockade mediated by the h-mIL-6R mAb could regulate “NOD-like receptor signaling pathway” and the expression of the enriched DEG Naip1, it has been documented that Naip1 is the receptor of the bacterial protein, type III secretion system (T3SS) needle protein, and activates NLRC4-mediated inflammasome.²⁷ To our knowledge, LPS-induced SIRS model did not bring about bacterial protein exposure and NLRC4 activation. More importantly, we found that the indicated DEG Naip1 was not significantly regulated as demonstrated by the qRT-PCR results in the PBMC isolated from the LPS-induced murine SIRS model. However, NF-κB was found to promote pro-inflammatory mediator expression including TNFs and IFNs, but also NLRP3 priming, the ready state of inflammasome activation.²⁷ Besides, it has been documented that NLRP3 inflammasome is critical in LPS-induced sepsis and septic organ injury.³⁸ Considering the inhibition of IL-6R blockade mediated by the h-mIL-6R mAb on pro-inflammatory NF-κB signaling, we speculated that IL-6R blockade could also inhibit NLRP3-associated inflammasome and pyroptosis via inhibiting NF-κB signaling in the LPS-stimulated monocyte. We detected levels of NLRP3, the active form of GSDMD (N-terminal of GSDMD, N-GSDMD) and Caspase-1 (p20) by immunoblotting analysis. We found that LPS treatment significantly activated NLRP3 inflammasome, GSDMD and Caspase-1, whereas the h-mIL-6R mAb (5 and 20 μg/ml) prominently decreased the levels of NLRP3, N-GSDMD and cleaved Caspase-1 (p20) (Figure 5A). Besides, we performed ELISA to assay the levels of IL-1β in the supernatant of the treated THP-1 cells since pyroptotic cell is also characterized by the release of mature IL-1β through the membrane pores perforated by N-GSDMD. The results showed that both the h-mIL-6R and Tocilizumab significantly decreased IL-1β levels in the supernatant (Figure 5B). Furthermore, we employed flow cytometry analysis to determine pyroptotic cell (PI ^high Caspase-1 activity^high) percentage and found that the IL-6R mAbs reduced the percentage of PI ^high Caspase-1 activity^high cells (Figure 5C,D), consistently indicating that the mIL-6R blockade could prevent THP-1 cell from pyroptosis. To investigate whether the mIL-6R blockade alleviated NLRP3-mediated pyroptosis through inhibiting NF-κB activation, we utilized the NF-κB inhibitor BAY 11–7082 and performed immunoblotting analysis of the pyroptosis-associated proteins including NLRP3, GSDMD, and Caspase-1. We found that combination of h-mIL-6R mAb and the NF-κB inhibitor led to significant reduced levels of NLRP3, N-GSDMD, and cleaved Caspase-1 in THP-1 cells (Figure 5E). ELISA assay showed that the h-mIL-6R mAb and the NF-κB inhibitor further suppressed release of IL-1β in the LPS-treated THP-1 cells (Figure 5F). Accordingly, the co-treatment of the h-mIL-6R mAb and the NF-κB inhibitor decreased pyroptotic cell (PI ^high Caspase-1 activity^high) percentage (Figure 5G,H). These results suggested the mIL-6R blockade could suppress inflammatory signaling by regulating NLRP3-associated pyroptosis via NF-κB inhibition in monocyte.

4.1 Generation of the mAbs against human mIL-6R

The in-house mAb against human mIL-6R (h-mIL-6R mAb) was generated by traditional hybridoma technology. In brief, for immunization, the immune peptide from human mIL-6R (Peptide3, sequence: EWGPRSTPSLTTKAC, location: 133–146 amino acids) conjugated with KLH or bovine serum albumin (BSA) was prepared by ChinaPeptides Co. Ltd, Shanghai, China. The C57BL/6J mice were immunized with 50 μg Peptide3-BSA for three times per 20 days. The supernatants of the hybridoma cells (HCs) were determined by ELISA and flow cytometry assay as previously reported.⁶⁵

4.2 Generation and identification of the human il-6r gene knock-in transgenic mice

CRISPR Cas9 technology was employed to knock in human il-6r gene in C57BL/6J mice and was conducted by Shanghai Biomodel Organism Science & Technology Development Co., Ltd. In brief, the knock-in site of human il-6r gene located between the exon 1 of murine il-6r gene and its upstream non-coding region: 5′UTR-…GCCGCTCTGCCGCCCGCCGTCCCGCGTAGAAGGAAGCATGCTGACCGTCGGCTGCACGCTGTTGGTCGCCCTGCTGGCCGCGCCCGCGGTCGCGCTGGTCCTCGGGAGCTGCCGCGCGCTGG…-3′UTR. Underlined sequence shown above was the site and the sequence from forward to reverse of gRNA. Cas9 mRNA and gRNA were in vitro transcribed and identified by nucleic acid electrophoresis. Homologous recombinant plasmid IL6r-e(hIL6R)1 Donor Vector containing 5′ homology arm-h-il-6r cDNA-woodchuck hepatitis virus post-transcriptional regulatory element (wpre)-polyA-3′ homology arm was constructed. The restriction enzyme Xba I enzyme was used for digestion. The homologous recombinant plasmid was identified by nucleic acid electrophoresis. Then, the plasmid was transfected into E. coli followed by ampicillin selection and plasmid DNA extraction. After male and female C57BL/6J mice mated, Cas9 mRNA and gRNA were mixed and injected into the zygotes. The transfected zygotes were cultured until the blastocyst stage, followed by being transferred into pseudopregnant mice. The parental generation (P₀) transgenic mice were generated and identified at 3 weeks old by PCR to select those with correct homologous recombination. The identification strategy by PCR was to amplify a fragment from 5′ homology arm and 3′ homology arm with a specific length, respectively. The used primers were: 5′ homology arm forward 5′-CACGTTTCCCCCTTAGCCTCTTCA-3′, reverse 5′-ACACTTTACTTCCGGGGGTCTCAT-3′, 3′ homology arm forward 5′-CTGCGCGGGACGTCCTTCTGCTAC-3′, and reverse 5′- TCCGGCCCCTGAGTCCTATT-3′. The PCR was performed using PrimeStar GXL kit (Takara Bio Inc, Tokyo, Japan) and the procedure was: 98°C for 2 min followed by 34 cycles of denaturation at 98°C for 10 s, annealing at 68°C for 15 s, and extension at 68°C for 3 min. The selected P₀ transgenic mice mated with C57BL/6J mice of WT to generate the first offspring (P₁) which were identified by PCR. The strategy and procedure were identical to that of P₀ identification. When P₀ and P₁ were identified, they were transferred to the Experimental Animal Center of our department in Air Force Medical University for breeding. The identification strategy for subsequent generations of mice by PCR was to amplify a fragment from 5′ UTR to 3′ UTR of WT allele and targeted allele with specific length, respectively. The primers were: WT allele forward 5′-GTGGCGCGGCTGCAGGAAGTAACC-3′, reverse 5′-CGAACCTCCACCGCGTCAGCACAG-3′, targeted allele forward 5′-ACGCTGCTTTAATGCCTTTGTATC-3′, reverse 5′-GGGCTCACTCTGCGAACGGAACC-3′. The procedure was: 94°C for 5 min followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 65°C for 30 s, and extension at 72°C for 1 min.

4.3 Animal studies and ethics statement

C57BL/6J mice were purchased from Experimental Animal Center of Air Force Medical University. The mice were kept under well-controlled environmental conditions with constant temperature (25 ± 2)°C, humidity (60 ± 10)%, and alternating 12 h-light–dark cycles. Standard pellet diet and sterilized water were accessible ad libitum.

To establish the murine SIRS model, LPS (E. coli O111:B4, Sigma Aldrich, St. Louis, MO, USA) was diluted with 0.9% sterilized saline. 8-week-old male IL6r-e(hIL6R)1 mice weighing (20 ± 2) g were chosen and were divided into six groups: 0.2 ml saline (intraperitoneal injection, i.p.) as the negative control group, 0.1 ml LPS and 0.1 ml mouse IgG (1 mg/ml) i.p., 0.1 ml LPS and 2.0 mg Tocilizumab (2 mg/ml, 0.1 ml) i.p. as the positive control group, 0.1 ml saline and 2.5 mg h-mIL-6R mAb (25 mg/ml, 0.1 ml) i.p., 0.1 ml saline and 0.5 mg h-mIL-6R mAb (5 mg/ml, 0.1 ml) i.p., 0.1 ml saline and 0.1 mg h-mIL-6R mAb (1 mg/ml, 0.1 ml) i.p.

The investigation was performed in accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals approved by the State Council of People's Republic of China and was approved by the Ethical Committee for Animal Experimentation of Air Force Medical University.

4.4 Cell culture

HepG2, U251MG and THP-1 cell lines were purchased from ATCC (Manassas, VA, USA). All the cells were authenticated by short-tandem repeat (STR) DNA testing by the Air Force Medical University Center for DNA Typing. HepG2 and hybridoma cell lines were cultured in DMEM medium (Gibco, NY, USA) supplemented with 10% fetal bovine serum (FBS, Invitrogen, Carlsbad, CA, USA). U251MG and THP-1 cell lines were cultured in RPMI 1640 (Invitrogen, CA, USA) containing 10% FBS. All the cells were incubated in humidified atmosphere of 5% CO₂ at 37°C and tested for mycoplasma contamination. The NF-κB inhibitor BAY 11–7082 was purchased from Selleck Chemicals (S2913, TX, USA). Human IL-6 was purchased from PeproTech (200-06-5UG, NJ, USA).

4.5 RNA extraction and qRT-PCR

Total RNA was extracted using E.Z.N.A. Total RNA Kit II (OMEGA Bio-tek, Inc, GA, USA) according to the manufacturer's instructions. Reverse transcription was performed using PrimeScript RTase (Takara Bio Inc) according to the manufacturer's protocol. The expression levels of IL-6R mRNA were determined with qRT-PCR using Premix Ex Taq (Takara Bio Inc) according to the manufacturer's instructions and normalized to the expression levels of the endogenous control, β-actin (Actb). The cycling conditions were as follows: 95°C for 2 min, followed by 40 cycles of denaturation at 95°C for 5 s, annealing at 55°C for 10 s, and extension at 72°C for 45 s. All reactions were run in triplicate. Threshold cycle values were used to calculate the fold change in the transcript levels by using the 2^−ΔΔCt method. The primers used for qRT-PCR were listed in Table S1.

4.6 RNA interference

siRNA specifically targeting human IL-6R and negative control siRNA (siNC) were synthesized by GenePharm (Shanghai, China). Sequences of the siRNA were: siRNA1, sense 5′-GGAAGACAAUGCCACUGUUTT-3′, antisense 5′-AACAGUGGCAUUGUCUUCCTT-3′; siRNA2, sense 5′-GCUCUUGGUGAGGAAGUUUTT-3′, antisense 5′-AAACUUCCUCACCAAGAGCTT-3′; siNC, sense 5′-UUCUCCGAACG UGUCACGUTT-3′, antisense 5′-ACGUGACACGUUCGGAGAATT-3′. The siRNA was transfected into cells using Lipofectamine™ 2000 (Invitrogen), and the transfection procedures were performed according to the manufacturer's instructions.

4.7 Immunoblotting and antibodies

Immunoblotting analysis was performed as previously described. In brief, cells or tissue samples were lysed in RIPA buffer (Beyotime Biotechnology, Jiangsu, China) added with PMSF (Beyotime). Protein concentration was measured using the bicinchoninic acid (BCA) method kit (Solarbio, Beijing, China). Protein samples were separated by 10% SDS-PAGE (Beyotime) and then transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, MA, USA). After blocking with 5% non-fat milk for 1 h, the membrane was incubated with primary antibodies at 4°C overnight and with the corresponding horse radish peroxidase (HRP)-conjugated secondary antibody for 1 h at room temperature. Finally, the blots were detected using enhanced chemiluminescence substrate (ECL kit, Millipore). The primary antibodies used for immunoblotting were against IL-6R (mouse monoclonal, Santa Cruz Biotechnology, sc-373708, diluted with 1:500), β-actin (rabbit monoclonal, abcam, ab179467, diluted with 1:3000), JAK2 (mouse monoclonal, Cell Signaling Technology, #3230, diluted with 1:2000), Phospho-JAK1 (Tyr1034/1035)/JAK2 (Tyr1007/1008) (mouse monoclonal, Cell Signaling Technology, #66245, diluted with 1:2000), STAT3 (mouse monoclonal, Cell Signaling Technology, #9139, diluted with 1:1000), Phospho-STAT3 (Tyr705) (rabbit monoclonal, Cell Signaling Technology, #9145, diluted with 1:1000), ERK1/2 (rabbit monoclonal, ProteinTech, 11257-1-AP, diluted with 1:1000), Phospho-p44/42 MAPK (ERK1/2) (Thr202/Tyr204) (rabbit monoclonal, Cell Signaling Technology, #4370, diluted with 1:2000), p65 (rabbit polyclonal, ProteinTech, 10745-1-AP, 1:2000), p-p65 (Ser536) (rabbit monoclonal, Cell Signaling Technology, #3033, 1:1000), IκBα (mouse monoclonal, Cell Signaling Technology, #4814, diluted with 1:1000), Phospho-IκB (Ser32) (rabbit monoclonal, HUABio, #2859, diluted with 1:1000), Ccl2 (rabbit monoclonal, Cell Signaling Technology, #39091, diluted with 1:1000), NLRP3 (rabbit polyclonal, abcam, ab214185, diluted with 1:1000), GSDMD (rabbit monoclonal, Affinity Biosciences, #AF4013, diluted with 1:1000), cleaved N-terminal GSDMD (rabbit monoclonal, abcam, ab215203, diluted with 1:500), cleaved Caspase-1 (rabbit monoclonal, Cell Signaling Technology, #89332, diluted with 1:1000), Caspase-1 (rabbit monoclonal, Cell Signaling Technology, #3866, diluted with 1:1000) and the second antibodies were HRP-conjugated antibodies (goat anti-rabbit IgG, horse anti-mouse IgG, #7074, #7076, Cell Signaling Technology, diluted with 1:2000).

4.8 Flow cytometry analysis

To evaluate the specificity to human mIL-6R of the mAbs produced by the HCs, the supernatants of the HCs were collected and the total protein concentration was adjusted to 100 μg/ml. The mAbs from the No. 2 and 5 HCs were collected, purified and the total protein mAb was adjusted to 100 and 1 μg/ml, respectively. The serum of the immunized mice was collected and was used as the polyclonal antibody for the control group. The total protein concentration of the serum was adjusted to 100 μg/ml. The mouse IgG (100 μg/ml) was used for the negative control group. The human mIL-6R expressing cell line HepG2 was harvested, washed twice with 4°C phosphate buffered saline (PBS) and re-suspended with the above-mentioned antibodies and supernatants before being incubated at 37°C for 1 h. Then, the samples were washed and incubated with the second antibody (Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (A-21202, Invitrogen, CA, USA)) for 30 min before the flow cytometry detection (Beckman Coulter, FL, USA) using the excitation sources and filters appropriate for fluorescein isothiocyanate (FITC).

Cell pyroptosis was detected with FAM FLICA™ Caspase-1 Kit (ICT097, Bio-Rad Laboratories Inc., CA, USA) according to the manufacturers’ instruction. In brief, THP-1 cells were collected, washed twice with 4°C PBS, and re-suspended in the diluted buffer (1 ×) with the FAM-YVAD-FMK FLICA Reagent of the kit. After incubation at 37°C for 1 h, the propidium iodide (PI) of the kit was added to the stained cells 15 min before the flow cytometry detection using the excitation sources and filters appropriate for FITC.

4.9 Resonance-based biosensor assay

SPR-based biosensor assay was conducted using the Octet Red96 system (ForteBio, Menlo Park, CA, USA). Briefly, the h-mIL-6R mAb was biotinylated using the EZ-Link™ NHS-LC-LC-Biotin kit (Thermo Scientific™) and diluted with the loaded concentration of 20 μg/ml, while the IL-6R-KLH protein solution (IL-6R-KLH dissolved in PBS) was diluted in the two-fold serial dilution with the final concentrations ranging from 1538 to 24 nM. The Biosensor/Streptavidin (SA) Tray (ForteBio, 18-5019) equilibrated in PBS as the probe was transferred into the IL-6R-KLH protein solution. Dissociation constants were calculated from raw data by the analysis software of the Octet Red 96 system (version 6.3, ForteBio).

4.10 Detection of cytokines and transaminases by ELISA

ELISA kits for the cytokines TNF-α, IL-1β, IL-6, IFN-γ, and Ccl2 were purchased from Dakewe Bio-engineering Co, Ltd (Guangdong, China. Cat. No: 1217202, 1117202 for TNF-α, 1210122, 1110122 for IL-1β, 1210602 for IL-6, 1210002 for IFN-γ and 1117392 for Ccl2). The procedure was performed according to the manufacturers’ instructions. The plates were measured by using an ELx 808 ELISA reader (Bio-Tek Instruments Inc., Winooski, VT, USA) at 450 nm. Detection of AST and ALT in the serum was conducted using the pre-coated ELISA kits (Cloud-Clone Corp., Hubei, China, Cat. No: SEA207Mu for ALT, SEB214Mu for AST). Blood samples were collected 6 h after LPS i.p. for detection of TNF-α, IL-1β, IL-6, and IFN-γ, and 24 h after LPS i.p. for AST and ALT detection. Following the collection, the samples were centrifuged at 400 g for 20 min at 4°C, and the supernatant was collected for ELISA detection.

4.11 Detection of MPO, blood urea nitrogen and creatinine

The lung tissue was collected 12 h after LPS i.p. for MPO detection to evaluate inflammation of lung tissue using the commercial kit (Jiancheng Bioengineering Institute, Jiangsu, China, Cat. No: A044-1-1). The mice were sacrificed and 100 mg lung tissue was sectioned, removed to PBS (Shanghai Double-helix Biotech Co. Ltd) and grinded to be homogenized on ice. The homogenization was centrifuged (15000 g for 15 min at 4°C) and the supernatant was collected and stored at −80°C before MPO detection. All the procedures were done according to the manufacturers’ instructions. The plates were measured with an ELx 808 ELISA reader at 460 nm.

BUN and creatinine in serum were detected to evaluate renal dysfunction. Blood samples were collected 12 h after LPS i.p., centrifuged at 400 g for 20 min at 4°C, and the supernatant was collected to detect BUN and creatinine levels using commercial kits (Jiancheng, Cat. No: C013-2-1 for BUN and C011-2-1 for creatinine). All the procedures were done according to the manufacturers’ instructions. The plates were measured with an ELx 808 plate reader (Bio-Tek Instruments Inc.) at 640 nm for BUN and 546 nm for creatinine.

4.12 Hematoxylin and Eosin (H&E) Staining

Tissues of C57BL/6J mice were harvested 24 h after LPS i.p., immersed in 4% paraformaldehyde (pH 7.4) fixative at 4°C overnight and then embedded in paraffin. Fixed sections (5-μm thick) were cut and stained with hematoxylin-eosin reagents (Sigma–Aldrich) and finally observed with a light microscopy (Olympus, Tokyo, Japan). For statistical analysis, three fields (magnification, 200 ×) were observed from one slide for scoring. The histopathological scores of liver, lung, and renal injury were calculated as previously reported.^{30, 31}

4.13 RNA-seq and analysis

Total RNA was extracted from PBMC of transgenic mice using Trizol (Invitrogen) according to manual instruction. Total RNA was qualified and quantified using the Nano Drop and Agilent 2100 bioanalyzer (Thermo Fisher Scientific, MA, USA). RNA-seq analysis was performed by BGI Group (Guangdong, China). The sequencing data were filtered with SOAPnuke (Ver. 1.5.2). The clean reads were mapped to the reference genome by using HISAT2 (Ver. 2.0.4). Bowtie2 (Ver. 2.2.5) was applied to align the clean reads to the reference coding gene set, and then the expression level of gene was calculated by RSEM (Ver. 1.2.12). Differential expression analysis and KEGG pathway enrichment analysis were performed. We defined the significant DEGs as those with p < 0.05, and the adjusted p-value q < 0.1. The sequencing data of this study have been deposited in the NCBI SRA database (http://www.ncbi.nlm.nih.gov/sra) with the accession number: BioProject ID PRJNA751363.

4.14 Statistical analysis

The results were expressed as mean ± SD through at least three independent experiments, with p < 0.05 considered to be statistically significant. Comparison between two groups were analyzed by two-tailed Student's t test and for multiple groups, the results were analyzed by one-way analysis of variance (ANOVA). The results of survival comparison were analyzed by Kaplan–Meier survival curves and log-rank test (Mantel–Cox method). All the statistical analyses were performed with GraphPad Prism 6.0 (GraphPad Software, CA, USA).