2.1 Human specimens

The tumor and adjacent paracancerous tissue samples from 20 NSCLC patients were obtained during the surgery under a protocol approved by the Hunan Aerospace Hospital (No. HNHTYY20240918LLSH-015-01). All participants were informed of the purpose and risks of this study and provided informed consent. The basic information and clinicopathological parameters of all patients were complete, and no radiotherapy or chemotherapy was performed before surgery. The collected samples were used for the separation of CAFs, and the remaining tissues were stored at −80°C for subsequent experiments.

2.2 Isolation of fibroblast

This protocol for isolating CAFs is based on the paper by Zawieracz and Eckert.²⁷ The minced tumor tissue was placed into a conical tube containing sterile phosphate buffered saline (PBS), 0.25% trypsin (15090046, Gibco), and 0.1% EDTA (AM9260G, Gibco). The tube was positioned on an orbital shaker at 37°C for 30 min. Following the removal of the supernatant, the tissue was incubated with a dissociation solution containing PBS, hyaluronidase (9001-54-1, Sigma-Aldrich), and type 3 collagenase (9007-34-5, Sigma-Aldrich) at 37°C for 6 h. Subsequently, the supernatant containing the dissociated cells was carefully centrifuged for 5 min. The resulting pellet was washed with Roswell Park Memorial Institute 1640 (RPMI 1640) medium containing fetal bovine serum‌ (FBS) and penicillin-streptomycin solution. The fibroblasts were resuspended in the above culture medium and inoculated into a dish. The procedure for isolating normal fibroblasts (NF) from adjacent paracancerous tissues closely resembles the previously described methodologies, and the culture conditions employed are the same as those utilized for CAFs. Passage culture was performed when CAFs and NF were observed to reach 80%–100% confluence.

2.3 Cell culture and treatment

The normal human lung epithelial cell line BEAS-2B and lung cancer cell lines, including A549, H1299, HCC827, and H23, were obtained from the American Type Culture Collection (ATCC). H1299, HCC827, and H23 cells were cultured in RPMI 1640 medium (Gibco) containing 10% FBS (A5670701, Gibco) and 1% penicillin–streptomycin solution (15070063, Gibco), whereas A549 cells were cultured in Ham's F12K medium (21127030, Gibco) and dulbecco's modified eagle medium (11966025, Gibco) was used to maintain BEAS-2B cell growth. All cell lines were placed in a humidified incubator at 37°C with a 5% CO₂ in air atmosphere.

To investigate the impact of CAFs on the malignant behaviors of NSCLC cells, the cultured medium of CAFs and NFs was collected separately, and they were treated with NSCLC cells as a conditional medium. A549 and H1299 cells were pretreated with the lactate production inhibitor oxamate (10 μM, 565-73-1, MedChemExpress) for 24 h and then replaced with fresh culture medium.

2.4 Cell transfection

The overexpression plasmid for ZNF384 and the short hairpin RNA against METTL3, ZNF384, and POLR3G expression were synthesized by GenePharma. All plasmids, as well as their corresponding controls, were packaged with lentivirus and subsequently transfected into A549 and H1299 cells with Lipofectamine 3000 (L3000150, Invitrogen) according to the protocols. Following a 24-h transfection period, puromycin was employed to select the successfully transfected cells, and then cells were harvested to assess transfection efficiency for subsequent experiments.

2.5 RNA extraction and quantitative reverse transcription-polymerase chain reaction

To extract total RNA from tissues and cells, Trizol reagent (R411-02, Vazyme), chloroform (75915E, Adamas) and isopropyl alcohol (75885AU, Adamas) were applied sequentially. The HiScript cDNA Synthesis Kit (R212-01, Vazyme) was used to reverse-transcribed the collected RNA sample into cDNA. According to the instructions of the SuperReal PreMix Plus kit (FP205-01, TIANGEN), a 20 μL reaction system was prepared, and 40 cycles of two-step PCR reactions (95°C for 10s and 60°C for 30s) were carried out after the pre-denaturation period. The relative quantitative value of each gene was assessed using the 2^−ΔΔCT formula, with β-actin acting as the internal control gene. The primer sequences used in this study are as follows:

ZNF384 forward:GGTAGAATGGAAGAATCTCACTTCA,

ZNF384 reverse:CTGTCAGCAAGGTGGGGTAG;

METTL3 forward:GAGTGCATGAAAGCCAGTGA,

METTL3 reverse:CTGGAATCACCTCCGACACT;

POLR3G forward:CCGTTAAGAGCCTTCTTT,

POLR3G reverse:CTCATGCTGGTAAAGCAACC;

β-actin forward:CTCTTCCAGCCTTCCTTCCT,

β-actin reverse:AGCACTGTGTTGGCGTACAG.

2.6 Western Blot

Total protein from tissues and cells was extracted using radio immunoprecipitation assay buffer and quantified by the bicinchoninic acid protein concentration assay kit (P0010S, Beyotime). The protein sample was mixed with an appropriate loading buffer and placed in a boiling water bath for 10 min. Then, the denatured protein sample was added evenly into the prepared sodium dodecyl sulfate polyacrylamide gel electrophoresis gel for electrophoresis. After separating the protein, the substances on the gel were transferred to a polyvinylidene fluoride membrane, and the membrane was blocked with 5% skim milk. Subsequently, primary antibodies of ZNF384 (ab176689, Abcam), METTL3 (ab195352, Abcam), E-Cadherin (ab314063, Abcam), vimentin (ab92547, Abcam), Snail (ab216347, Abcam), POLR3G (ab200721, Abcam), Kla (PTM-1401RM, PTMBio), and H3K18la (PTM-1406RM, PTMBio) were incubated with the membranes overnight at 4°C. Then, the protein bands were treated with HRP-labeled secondary antibody for 1 hour incubation. An electrochemiluminescence luminescent reagent was applied for visualization under a multi-functional imaging system, and Image-J software was used for analysis.

2.7 CCK-8 assay

A549 and H1299 cells were inoculated into a 96-well plate. Following this pre-culture period, the cells were subjected to specific treatments and maintained in culture for 24 h. Then, CCK-8 solution (C0037, Beyotime) was introduced to the designated wells, and the plates were incubated for an additional hour. Subsequently, a microplate reader (Thermo Scientific) was employed to measure the absorbance of the wells at 450 nm, facilitating the calculation of cell viability.

2.8 Scratch test

First, use a marker to draw some lines on the back of the six-well plate to mark it. Then, the cells were seeded into the wells. The following day, a trace of the center of the cell was spread using a sterile pipette tip, and then rinsed with PBS. After an incubation of 24 h, the cell migration rate was determined by observing the migration of cells under an optical microscope.

2.9 Transwell assay

The Matrix-Gel™ (C0371, Beyotime) was uniformly applied to the base of the Transwell chamber (Corning). The appropriately treated cells were inoculated into the Transwell chamber, followed by the addition of a serum-free medium. Then, the lower side of the chamber was fulfilled with 500 μL complete culture medium. The chamber was then carefully positioned into the 24-well plate and incubated at 37°C for 24 h. After the incubation, 600 μL of 4% paraformaldehyde fixative (P0099, Beyotime) was added to the clean wells of the 24-well plate, and the chamber was immersed in the fixation solution for 30 min. After washing with PBS, 600 μL of 1% crystal violet staining solution was applied for a staining period of 10 min. Once adequately air-dried, cell invasion was assessed using an optical microscope (Leica).

2.10 Immunofluorescence

The CAFs were seeded into a 24-well plate, and after washing with PBS, a 4% paraformaldehyde solution was applied for a fixation period of 15 min. The fixative was discarded, and CAFs were treated with Triton-X-100 solution (P0096, Beyotime) for 20 min. Subsequently, CAFs were blocked with a 5% bovine serum albumin (37520, Thermo Scientific) for 60 min. After washing with PBS, CAFs were mixed with anti-α-SMA (A2547, Sigma-Aldrich) and anti-FSP1 (ab219986, Abcam) overnight at 4°C. Following a rinse with PBS, fluorescently labeled secondary antibodies were introduced for a 60 min incubation in the dark. Then, CAFs were stained with 4’,6-diamidino-2-phenylindole for 5 min, and PBS was applied to eliminate excess dye. Finally, a fluorescence microscope (Thermo Scientific) was applied to observe the samples.

2.11 Detection of lactic acid level

The lactic acid kit utilized in this study was purchased from Enzyme-linked (ml076587) and was evaluated according to the instructions. Briefly, the harvested cells were subjected to sonication in an extraction solution, followed by centrifugation to isolate the supernatant. Subsequently, the appropriate reagents were added to both the test sample and the standard, and the mixture was incubated at 37°C for 30 min. The OD530 was measured by a spectrophotometer (METTLER TOLEDO), and the lactic acid concentration was calculated based on the established formula.

2.12 Methylated RNA immunoprecipitation

Total RNA was extracted using the TRIzol reagent (15596018CN, Invitrogen). Then, the quality and quantity of total RNA were analyzed, and the RNA was cleaved into oligonucleotides of approximately 100 nucleotides after purification. Then, a m6A-specific antibody (No. 202003, Synaptic Systems) was mixed with cleaved RNA and protein A/G beads to co-incubate. The beads were then eluted with free m6A (Sigma-Aldrich), and the eluted solution obtained was analyzed using qPCR experiments to determine enrichment.

2.13 Chromatin immunoprecipitation (ChIP)

Pierce Magnetic Chromatin Immunoprecipitation (ChIP) Kit (Thermo Scientific) was used to perform the ChIP assay under the manufacturer's instructions. Briefly, cells were crosslinked using 1% formaldehyde; then, a halt cocktail was added to the mixture. The next step is to treat the collected cell pellet with an MNase digestion buffer solution to obtain the supernatant containing digested chromatin. Subsequently, the supernatant was incubated with the antibody against ZNF384 (ab176689, Abcam) or H3K18la (PTM-1406RM, PTMBio) and Protein A/G Magnetic Beads to complete immunoprecipitation. The eluted IP solution was obtained through repeated elution of the beads, DNA recovery was performed to acquire purified DNA, and the final analysis was conducted by qPCR.

2.14 Dual-luciferase reporter assay

The mutant fragment POLR3G containing the two previously predicted binding sites (Pro#1 and Pro#2) was cloned into the pGL3 basic vector (Promega) to obtain different dual-luciferase reporter plasmids. Subsequently, the above constructed plasmid was co-transfected with OE-ZNF384 or OE-NC plasmid into A549 or H1299 cells. The Dual-Glo system (Promega) was applied to quantify the relative luciferase activity 48 h after transfection and the luciferase signal in the assay results were compared and examined with the endogenous luciferase signal.

2.15 Statistical analysis

The data statistics and analysis in this study utilized GraphPad Prism 9.0 software and were presented as mean ± standard deviation. Specifically, an independent samples t-test was employed for comparisons between two groups, while one-way analysis of variance followed by Tukey's test was used for comparisons among multiple groups. All experiments were conducted in triplicate or more, and a p-value of less than 0.05 was deemed statistically significant.

3.1 ZNF384 promoted EMT in NSCLC cells

First, we discovered that ZNF384 levels were markedly higher in NSCLC tissues compared to those in paracancerous tissues (Figure 1A,B). Additionally, ZNF384 presented the higher expression in A549 and H1299 cells among all lung cancer cell lines (Figure 1C,D). Therefore, we chose A549 and H1299 cell lines for the subsequent experiments and performed transfection with sh-ZNF384 to knock down ZNF384. As illustrated in Figure 1E, the transfection of sh-ZNF384 markedly inhibited ZNF384 levels. Then, we examined the influence of ZNF384 knockdown on NSCLC cell function. As displayed in Figure 1F–H, the silencing of ZNF384 resulted in a reduction of cell viability in migration and invasion. In addition, the levels of EMT marker proteins, specifically vimentin and Snail, exhibited a reduction corresponding to the diminished expression of ZNF384 (Figure 1I). Conversely, the knockdown of ZNF384 resulted in an upregulation of E-Cadherin (Figure 1I). These results indicated that ZNF384 could facilitate EMT in NSCLC cells.

3.2 CAFs increased ZNF384 m6A modification by enhancing METTL3 H3K18 lactylation

CAFs were isolated from the obtained NSCLC tissues to investigate the regulatory role of CAFs in NSCLC. As illustrated in Figure 2A, CAFs marker proteins α-SMA and FSP1 were confirmed to be positively expressed. Subsequently, we found that lactate production in CAFs was markedly elevated compared to that in fibroblasts sourced from paracancerous lung tissue (Figure 2B). The findings in Figure 2C,D indicated that CAFs induced increased ZNF384 and METTL3 levels. Concurrently, CAFs increased the m6A modification levels of ZNF384 (Figure 2E). Then, we suppressed METTL3 expression in NSCLC cells, and Figure 2F displayed the efficiency of the METTL3 knockdown. As shown in Figure 2G–I, METTL3 deficiency mitigated the stimulatory influence of CAFs on the m6A modification of ZNF384, as well as ZNF384 expression in NSCLC cells. Furthermore, CAFs elevated Pan Kla and H3K18la levels in NSCLC cells (Figure 3A). In addition, CAFs markedly raised the amounts of H3K18la on the METTL3 promoter (Figure 3B). To analyze the lactate secretion by CAFs, cells were treated with Oxamate (lactate generation inhibitor). The results showed that the lactate levels from CAFs supernatant were higher than NF supernatant, and Oxamate treatment remarkedly decreased lactate levels (Figure 3C). More importantly, we observed that the promoting effect of CAFs on METTL3 promoter H3K18la levels and protein expression can be reversed by Oxamate treatment (Figure 3D,E). According to the findings above, lactate released by CAFs stimulated METTL3 expression by H3K18 lactylation of METTL3, and METTL3 upregulated ZNF384 via mediating its m6A modification.

3.3 CAFs upregulated ZNF384 expression to induce EMT in NSCLC cells

In subsequent investigations, we explored whether CAFs affect the EMT of NSCLC cells through ZNF384. We observed that A549 and H1299 cell viability was enhanced by CAFs, whereas ZNF384 knockdown prevented this effect (Figure 4A). Similarly, ZNF384 knockdown reduced the increase in NSCLC cell migration and invasion caused by CAFs (Figure 4B,C). Furthermore, ZNF384 depletion resulted in a downregulation of vimentin and Snail in NSCLC cells co-cultured with CAFs, while concurrently elevating E-Cadherin (Figure 4D). These findings implied that CAFs facilitated the EMT process of NSCLC cells through the modulation of ZNF384.

3.4 ZNF384 transcriptionally activated POLR3G

We further investigated the downstream molecules regulated by ZNF284 in NSCLC. Initially, we found that the transfection of OE-ZNF384 not only caused an increase in ZNF384 expression but also elevated both mRNA and protein levels of POLR3G (Figure 5A,B). As illustrated in Figure 5C, the JASPAR database (https://jaspar.elixir.no/) predicted two potential binding sites between ZNF384 and POLR3G promoter. ChIP assay revealed a remarkable enrichment of ZNF384 at the site2 sequence, confirming that ZNF384 interacted with the POLR3G promoter specifically at this binding site (Figure 5D). Additionally, the overexpression of ZNF384 markedly enhanced the luciferase activity in cells driven by Pro or Pro#2, whereas no such effect was observed with Pro#1 (Figure 5E). The results mentioned above demonstrated that ZNF384 is bound to the POLR3G promoter in NSCLC cells, thereby upregulating its expression.

3.5 Knockdown of POLR3G counteracted the promotion effect of ZNF384 on EMT

At last, the function of the ZNF384/POLR3G axis in regulating EMT of NSCLC cells was clarified. As seen in Figure 6A, the transfection of sh-POLR3G markedly decreased POLR3G levels in A549 and H1299 cells. Further cell functional experiments showed that ZNF384 overexpression led to an increased the viability, migration, and invasion of NSCLC cells (Figure 6B–D). However, POLR3G knockdown abolished the effects induced by ZNF384 (Figure 6B–D). Moreover, POLR3G silencing inhibited the decrease of E-Cadherin expression and the increase of vimentin and Snail expression caused by ZNF384 overexpression (Figure 6E). In summary, ZNF384 facilitated EMT in NSCLC cells by regulating POLR3G.