Dietary levels of protein and free amino acids affect pancreatic proteases activities, amino acids transporters expression and serum amino acid concentrations in starter pigs
Summary
The dietary contents of crude protein and free amino acids (AA) may affect the protein digestion and AA absorption in pigs. Trypsin and chymotrypsin activities, AA serum concentrations and expression of AA transporters in the small intestine of pigs fed a low protein, AA-supplemented (19.2%, LPAA) or a high protein (28.1%, HP), wheat-soybean meal diet were measured in two 14-d trials. The LPAA diet contained free L-Lys, L-Thr, DL-Met, L-Leu, L-Ile, L-Val, L-His, L-Trp and L-Phe. All pigs were fed the same amount of feed (890 and 800 g/d for trial 1 and 2 respectively). In trial 1, samples of mucosa (duodenum, jejunum and ileum) and digesta (duodenum and jejunum) were collected from 14 pigs (17.2 ± 0.4 kg); in trial 2, blood samples were collected from 12 pigs (12.7 ± 0.3 kg). The trypsin and chymotrypsin activities in both intestinal segments were higher in pigs fed the HP diet (p < 0.01). Trypsin activity was higher in jejunum than in duodenum regardless the dietary treatment (p < 0.05). Pigs fed the LPAA diet expressed more b0,+AT in duodenum, B0AT1 in ileum (p < 0.05), and tended to express more y+LAT1 in duodenum (p = 0.10). In pigs fed the LPAA diet, the expression of b0,+AT was higher in duodenum than in jejunum and ileum (p < 0.01), but no difference was observed in pigs fed the HP diet. Ileum had the lowest b0,+AT expression regardless the diet. The serum concentrations of Lys, Thr and Met were higher in LPAA pigs while serum Arg was higher in HP pigs (p < 0.05). Serum concentrations of AA appear to reflect the AA absorption. In conclusion, these data indicate that the dietary protein contents affect the extent of protein digestion and that supplemental free AA may influence the intestinal site of AA release and absorption, which may impact their availability for growth of young pigs.
Introduction
The supplementation of low protein diets with free AA for pigs improves the AA profile and reduces N excretion (Carter et al., 1996). Five free essential AA, feed-grade, are currently available to be included in practical diets and, when added properly, can substantially reduce their protein content. Low-protein AA-supplemented diets may contain up to 60% free Lys and as low as 40% protein-bound (PB) Lys. The free AA are available for absorption as they reach the proximal small intestine but the PB AA need to be released during protein digestion before their absorption takes place. Thus, the content of PB and free AA in the diet may affect the absorption site of AA in the small intestine of pigs.
The protein concentration in the small intestine digesta, which reflects the dietary protein content, seems to affect the secretion of pancreatic proteases in animals. Rats fed low protein diets secrete less pancreatic trypsin and chymotrypsin than those fed high-protein diets (Green et al., 1986; Fushiki and Iwai, 1989). Moreover, the availability of free AA appears to affect the abundance of AA transporters in the small intestine of pigs (Morales et al., 2013). Lysine absorption is critical because it is the first limiting AA in most feed ingredients for pigs. Lysine is absorbed via the systems b0,+AT (Majumder et al., 2009) and y+LAT1 (Bröer, 2008) in exchange for neutral AA (Leu). System B0AT1 is the major Leu transporter (Bröer, 2008). Our hypothesis was that the activities of pancreatic proteases decrease in pigs fed a low-protein diet compared with pigs fed a high-protein diet, and that the supplementation with free AA stimulates the abundance (expression) of mRNA coding for AA transporters along the whole small intestine. In turn, the absorption and serum concentration of AA would be affected as well. However, there is no available data regarding these assumptions in young pigs.
The objective of the present study was to compare the effect of feeding pigs with either a low-protein diet supplemented with free AA or a high-protein diet with no supplemental free AA on: (i) the activity of trypsin and chymotrypsin in duodenal and jejunal digesta, (ii) the expression of two cationic AA and one neutral AA transporters in duodenum, jejunum and ileum, (iii) the concentrations of free AA in serum. The enzyme activities and the expression of AA transporters among the intestinal segments were also compared.
Materials and methods
Animals, housing and dietary treatments
The pigs used in these studies were cared for in accordance with the guidelines established in Official Mexican Regulations on Animal Care (Norma Oficial Mexicana, 2001). Two trials were conducted with 26 crossbred (Large White × Duroc) pigs. Fourteen pigs (initial BW of 17.2 ± 1.4 kg) and 12 pigs (initial BW of 12.7 ± 0.6 kg) were used in trial 1 and trial 2 respectively. In both trials, the pigs were randomly assigned to two dietary treatments: 1) low-protein diet supplemented with free AA, and 2) high-protein diet with no supplemental free AA. There were seven pig-replicates (five gilts and two barrows) in trial 1 and six pig-replicates (four gilts and two barrows) in trial 2. The initial BW was balanced across treatments. Pigs were individually housed in raised floor metabolism pens (1.2 m wide, 1.2 m long and 1.0 m high) equipped with a nipple water drinker, and iron mesh floor in a temperature-controlled room (22–24 °C). In both trials, all pigs were trained to consume the same amount of feed (two meals of equal size offered daily at 0700 and1900 h) in 30 min or less. The pigs had ad libitum access to the water. Both trials consisted of 7 days for adaptation to the diets and pens, followed by 7 days for response evaluation. The average BW of pigs at the end of trials 1 and 2 were 23.2 and 16.7 kg respectively.
The two dietary treatments were based on wheat and soybean meal (SBM) as follows: 1) low-protein (19.2%) diet supplemented with L-Lys, L-Thr, DL-Met, L-Leu, L-Ile, L-Val, L-His, L-Trp and L-Phe (LPAA); and 2) high-protein (28.1%) diet (HP) without free AA (Table 1). The HP diet was formulated to meet the standardized ileal digestible (SID) requirement of Lys for pigs within the range of 11–25 kg (NRC, 2012). The LPAA diet was formulated to contain optimal indispensable AA:Lys ratios (NRC, 2012). The diets were formulated using the analysed AA content and the published SID coefficients in wheat and SBM (Stein et al., 2001); the SID of free AA was considered to be equal to 100%. The LPAA and HP diets contained 9% and 41% of SBM respectively. The LPAA diet contained approx. 50% PB-Lys and 50% free Lys while in the HP diet, Lys was completely in the form of protein. These diets were evaluated to test the hypothesis that the activities of trypsin and chymotrypsin, the expression of AA transporters and the serum concentration of free AA in pigs fed a low LPAA are different compared with those fed a HP diet. The analysed AA composition of both diets is presented in Table 2. All diets were supplemented with a mineral-vitamin premix to meet or exceed their requirements for growing pigs (NRC, 2012), and contained 10.2 MJ NE/kg.
| Ingredient, % | LPAAa | HP |
|---|---|---|
| Wheat | 85.88 | 51.12 |
| Soybean meal, 48% | 9.00 | 41.00 |
| Amino acids premixb | 2.43 | – |
| Calcium carbonate | 1.56 | 1.53 |
| Dicalcium phosphate | 0.58 | 1.00 |
| Iodized salt | 0.35 | 0.35 |
| Vitamin-mineral premixc | 0.20 | 0.20 |
| Canola oil | – | 4.80 |
- a LPAA: low-protein (19%) diet supplemented with free amino acids. HP: high-protein diet (28%) with no supplemental free AA, formulated to meet the standardized ileal digestible (SID) requirement of Lys.
- b The amino acid premix was prepared in situ and contained 0.76% L-Lys.HCl, 0.35% L-Thr, 0.21% DL-Met, 0.05% L-Trp, 0.16%, L-Phe, 0.37% L-Leu, 0.18% L-Ile, 0.12% L-His and 0.23% L-Val.
- c Supplied per kg of diet: Vitamin A, 4800 IU; vitamin D3, 800 IU; vitamin E, 4.8 IU; vitamin K3, 1.6 mg; riboflavin, 4 mg; D-pantothenic acid, 7.2 mg; niacin, 16 mg; vitamin B12, 12.8 mg; Zn, 64 mg; Fe, 64 mg; Cu, 4 mg; Mn, 4 mg; I, 0.36 mg; Se, 0.13 mg. The premix was supplied by Nutrionix, S.A., Hermosillo, México.
| Diet | ||
|---|---|---|
| LPAA | HP | |
| Crude protein, % | 19.18 | 28.05 |
| Indispensable amino acids, % | ||
| Arginine | 0.89 | 1.73 |
| Histidine | 0.53 | 0.71 |
| Isoleucine | 0.82 | 1.21 |
| Leucine | 1.56 | 2.10 |
| Lysine | 1.24 | 1.42 |
| Methionine | 0.42 | 0.42 |
| Phenylalanine | 0.95 | 1.37 |
| Threonine | 0.86 | 0.97 |
| Valine | 0.97 | 1.31 |
| Dispensable amino acids, % | ||
| Alanine | 0.61 | 1.09 |
| Aspartic Acid | 1.14 | 2.56 |
| Glutamic Acid | 4.53 | 5.84 |
| Glycine | 0.63 | 1.08 |
| Proline | 1.43 | 1.74 |
| Serine | 0.73 | 1.12 |
| Tyrosine | 0.43 | 0.81 |
Collection of tissue and blood samples
Samples of mucosa from duodenum, jejunum and ileum were collected from all pigs of trial 1. The pigs were euthanized by electrical stunning and exsanguination at about 2.5 h after the morning meal of d 14. The carcasses were immediately eviscerated and mucosal samples scratched from the middle duodenum, jejunum and ileum (approx. 0.5 g) were collected into 2-ml micro tubes. In addition, digesta samples from duodenum and jejunum of all pigs were collected to measure the activities of trypsin and chymotrypsin. The mucosa samples were immediately frozen in liquid nitrogen, and stored at −82 °C until analysis. The total collection process took no longer than 8 min to maximize the quality of the extracted RNA. The intestinal digesta samples were stored at −20 °C before the analysis. Blood samples from all pigs of trial 2 were collected according to the following protocol. The pigs were fed their corresponding morning meals on d 14 after 11 h of fasting. Following, blood samples (approx. 7 ml) from the carotid artery were collected by venipuncture at 2.5 h after that morning meal to analyse the serum concentration of free AA during the absorptive state. Immediately after collection, the blood samples were centrifuged at 1500 × g, 4 °C for 10 min to separate serum from blood cells and stored at −20 °C until analysis.
Enzyme activity
Thawed duodenal and jejunal digesta were centrifuged at 3000 × g, 4 °C, for 15 min (Eppendorf Centrifuge 5810r, Hamburg, Germany). The supernatant was transferred to a clean tube. Activities of trypsin and chymotrypsin in ileal digesta were analysed following the procedures of Hummel (1959). For trypsin, the optical density was read at 247 nm, at 1 min intervals, for 10 min (Spectronic Helios β, Thermo Electron Co. Cambridge, UK). One unit of activity was defined as the hydrolysis of 1 μmole of Nα-p-toluenesulfonyl-L-arginine methyl ester per minute at 25 °C and pH 8.1 in the presence of 0.01 m calcium ion. For chymotrypsin, the optical density was read at 256 nm, at 1 min intervals, for 10 min. One unit of activity was defined as the hydrolysis of 1 μmole of N-benzoyl-L-tyrosine ethyl ester per minute at 25 °C and pH 7.8.
Total RNA extraction and purification
The samples of intestinal mucosa were treated to extract total RNA by pulverization into liquid N, and homogenized into Trizol reagent (Invitrogen, Carlsbad, CA, USA) as reported by Méndez et al. (2011). Purified RNA was eluted with 30 μl of RNase-free distilled water and stored at −82 °C. The total RNA concentration was determined spectrophotometrically (Helios β, Thermo Electron Co., Rochester, NY, USA) at 260 nm, and purity of RNA was assessed by using the A260/A280 ratio, which ranged from 1.8 to 2.0 (Sambrook and Russell, 2001). The integrity of total RNA was evaluated by gel electrophoresis on 1% agarose gels. All RNA samples had good quality with a 28S:18S rRNA ratio around 2.0:1.0 (Sambrook and Russell, 2001).
Reverse transcription and quantitative PCR
Approximately 2 μg of total RNA was treated with 1 U of DNase I (1 U/μl; Thermo Scientific, Carlsbad, CA, USA) and 6 μl of 5 × reverse transcription buffer in a 30 μl reaction completed with nuclease free water (Thermo Scientific, Carlsbad, CA, USA); the reaction was carried out for 15 min at room temperature and another 15 min at 70 °C to stop the reaction. The reverse transcription was initiated with DNase-treated RNA samples, adding 1 μl of random primers (150 ng/μl, Invitrogen, Carlsbad, CA, USA) and 1 μl of dNTPs solution (10 μm each); the reaction was incubated for 5 min at room temperature and then chilled on ice for 1 min. Following, 3 μl of nuclease free water, 1 μl of ribonuclease inhibitor (40U/μl; RiboLock, Thermo Scientific, Carlsbad, CA, USA) and 2 μl of × reverse transcription buffer were added to the reaction and incubated at 42 °C for 2 min to stabilize it before adding 1 μl of reverse transcriptase enzyme (200 U/ μl; RevertAid H Minus, Thermo Scientific, Carlsbad, CA, USA). The reverse transcription reaction was incubated at 42 °C for 50 min, followed by 15 min at 70 °C, and chilled on ice to stop it. cDNA samples were quantified spectrophotometrically and diluted into a final concentration of 50 ng/μl.
Specific primers for b0,+AT (SLC7A9), y+LAT1 (SLC7A7), B0AT1(SLC6A19) and the 18S rRNA were designed according to their published sequences at the GenBank (Table 3). A housekeeping 18S rRNA (GenBank AY265350) was used as an endogenous control to normalize variations in mRNA. Before starting, end point PCR was carried out to standardize amplification conditions for each pair of primers, and in order to confirm the specificity of the PCR products related to its mRNA. A sample of every PCR product was sequenced at the Davis Sequencing Facility (Davis, CA, USA). The sequencing results revealed that the products for b0,+AT, y+ LAT1, B0AT1 and 18S rRNA have 100% homology with their corresponding expected sequences acquired from the virtual template sequences reported in the GenBank.
| mRNA | Primer | Location (bp) on the template | Sequence | Amplicon size (bp) |
|---|---|---|---|---|
| b0,+AT: Sus scrofa cationic amino acid transporter SLC7A9, mRNA (GenBank: EF127857) | ||||
| Forward | 1–19 | 5′CGGAGAGAGGATGAGAAGT3′ | 562 | |
| Reverse | 545–562 | 5′GCCCGCTGATGATGATGATGA3′ | ||
| y+ LAT1: Sus scrofa cationic amino acid transporter SLC7A7, mRNA (GenBank: NM001110421.1) | ||||
| Forward | 4239–4258 | 5′TCAAGTGGGGAACCCTGGTA3′ | 259 | |
| Reverse | 4548–4567 | 5′ATGGAGAGGGGCAGATTCCT3′ | ||
| B0AT1: Sus scrofa neutral amino acid transporter SLC6A19 mRNA (GenBank: DQ231579.1). | ||||
| Forward | 8–28 | 5′TCTGTCCACAACAACTGCGAG3′ | 205 | |
| Reverse | 193–212 | 5′CAGCGAAGTTCTCCTGCGTC3′ | ||
| 18S rRNA; Sus scrofa 18S ribosomal RNA gene (GenBank: AY265350) | ||||
| Forward | 236–255 | 5′GGCCTCACTAAACCATCCAA3′ | 295 | |
| Reverse | 511–530 | 5′TAGAGGGACAAGTGGCGTTC3′ | ||
The expression of genes (relative mRNA abundance) coding for b0,+AT, y+ LAT1, B0AT1were estimated by quantitative PCR (qPCR) assays, using the Maxima SYBR Green/ROX qPCR Master Mix (Thermo Scientific, Carlsbad, CA, USA) into a Chromo 4-DNA Engine with the MJ Opticon Monitor 3.1 software (Bio-Rad, Herefordshire, England). The equipment was calibrated with a standard curve using the 18S rRNA cloned into a TOPO vector 4.0, from which a calibrator's cDNA was produced. Relative standard curve methods for each specific mRNA were obtained using known concentrations of five 100-fold serial dilutions of the cDNA and the linear range for target mRNA quantification was established. The reactions for qPCR contained 50 ng of cDNA, 0.5 μm of each specific primer, 12.5 μl of 2 × SYBR green/ROX qPCR Master Mix, and nuclease free water to complete a final volume of 25 μl. The PCR conditions used for the amplification and quantification were an initial denaturing stage (95 °C for 1 min), followed by 45 cycles of amplification (denaturing at 95 °C for 30 s, annealing at 56 °C for 15 s, and extension at 72 °C for 30 s) and a melting curve program (60–90 °C). Fluorescence was measured at the end of every cycle and every 0.2 °C during the melting program. The relative mRNA abundance was normalized to the relative 18S abundance by calculating the mRNA:18S relative abundance ratios (Liao et al., 2009).
Analyses of AA in the diets and free AA in serum
The analyses of AA were carried out at the laboratory of Evonik Industries AG, Hanau-Wolfgang, Germany. Dietary concentrations of all AA, except for tryptophan, were determined by ion-exchange chromatography with post-column derivatization with ninhydrin. The AA were oxidized with performic acid, and then neutralized with Na metabisulfite (Llames and Fontaine, 1994; Commission Directive, 1998). The dietary protein was hydrolyzed with 6 N HCl for 24 h at 110 °C and quantified with the internal standard by measuring the absorption of reaction products with ninhydrin at 570 nm. The serum concentration of free AA was determined by ion-exchange chromatography using a Biochrom 20 amino acid analyser column (Biochrom, Cambridge, UK) with lithium buffers. The AA were determined after dissolving the freeze-dried serum samples and carrying out protein precipitation with sulfosalicylic acid and centrifugation (30 min at 10 000 turns/min; temperature 20–25 °C). The AA were quantified using the internal standard norleucine by measuring the absorption of reaction products with ninhydrin at 570 and 440 nm.
Statistical analysis
Data analyses for all variables were performed using SAS (Statistical Analysis System 9.1, SAS Institute, Cary, NC, USA). The effect of diet and intestinal segment (trial 1) on the enzyme activity was analysed as a 2 (LPAA and HP) × 2 (duodenum and jejunum) factorial arrangement; the effect on the expression of AA transporters was analysed as a 2 (LPAA and HP) × 3 (duodenum, jejunum and ileum) factorial arrangement. When the interaction diet x intestinal segment was significant, a non-orthogonal contrast was constructed to compare the effect of diet (LPAA vs. HP) within each intestinal segment. In addition, two non-orthogonal contrasts were constructed to compare the AA transporter expression in jejunum with that in duodenum (jejunum vs. duodenum) and ileum (jejunum vs. ileum). The effect of dietary treatment on the SC of AA (trial 2) was analysed by independent-sample t-tests. Probability levels of p ≤ 0.05, and 0.05 < p ≤ 0.10 were defined as significant differences and tendencies respectively.
Results
All pigs completed their corresponding trial. The daily feed intake of each pig was 890 and 800 g in trial 1 and 2 respectively. All pigs consumed their meals in 15 min or less during the 7-d response evaluation period.
Enzyme activity
The activities of trypsin and chymotrypsin are presented in Fig. 1. The interaction diet × intestinal segment was not significant (p > 0.05). Pigs fed the HP diet had greater activities of trypsin and chymotrypsin in the digesta of both duodenum and jejunum (p < 0.001). Regardless the dietary treatment, on average the activity of trypsin was higher in jejunum than in duodenum (p < 0.05). However, the average activity of chymotrypsin did not differ between duodenal and jejunal digesta (p > 0.10).
Gene expression
The relative expression values of mRNA coding for two cationic (b0,+AT and y+LAT1) and one neutral (B0AT1) AA transporters in the small intestine of pigs are presented in Table 4. The interaction diet x intestinal segment was significant (p < 0.05) hence the dietary effect on gene expression was compared separately in each intestinal segment. The expression of mRNA for b0,+AT in duodenum was higher (p = 0.030) in pigs fed the LPAA diet, but no difference was observed in jejunum and ileum between pigs fed the LPAA and HP (p > 0.10). The expression of mRNA for y+LAT1 in duodenum tended to be higher in pigs fed the LPAA diet (p = 0.098) but no difference was observed in jejunum (p > 0.10); no expression was detected in ileum. The expression of mRNA for B0AT1 in duodenum and jejunum was not affected by the dietary treatment (p > 0.10) but, in ileum, it was higher in pigs fed the LPAA diet (p = 0.011).
| Transporter | Intestinal | Dieta | |||
|---|---|---|---|---|---|
| Segment | LPAA | HP | SEM | p = | |
| b0,+AT (SLC7A9)b | Duodenum | 0.0649 | 0.0385 | 0.0071 | 0.030 |
| Jejunum | 0.0281 | 0.0295 | 0.0054 | 0.857 | |
| Ileum | 0.0139 | 0.0105 | 0.0019 | 0.236 | |
| y+LAT1 (SLC7A7) | Duodenum | 0.0154 | 0.0110 | 0.0019 | 0.098 |
| Jejunum | 0.0262 | 0.0334 | 0.0053 | 0.370 | |
| Ileum | nd | nd | nd | ndc | |
| B0AT1 (SLC6A19) | Duodenum | 0.0337 | 0.0333 | 0.0041 | 0.947 |
| Jejunum | 0.0374 | 0.0387 | 0.0081 | 0.913 | |
| Ileum | 0.0374 | 0.0091 | 0.0061 | 0.011 | |
- a Diets: LPAA, low-protein (14%) wheat-SBM supplemented with free AA; HP, high-protein wheat-SBM diet without supplemental free AA.
- b Pigs fed the LPAA diet: Duodenum vs. Jejunum, p < 0.01.
- c Expression of y+ LAT1 (SLC7A7) was not detected in ileum.
The comparative expression of the AA transporters b0,+AT and B0AT1in duodenum, jejunum and ileum is presented in Fig. 2. In pigs fed the LPAA diet, the expression of mRNA for b0,+AT in duodenum was higher than that in jejunum (p < 0.01), but no difference was observed between jejunum and ileum (p > 0.10). The expression of mRNA for B0AT1 did not differ between jejunum and the other two intestinal segments (p > 0.10). In pigs fed the HP diet, the expression of both b0,+AT and B0AT1 in duodenum did not differ from that in jejunum (p > 0.10) but it was higher in jejunum in comparison with that in ileum (p < 0.01).
Serum amino acid concentration
The absorptive serum concentrations of free indispensable and dispensable AA are presented in Table 5. Serum Arg was higher (p = 0.011) in pigs fed the HP diet. In contrast, the serum concentrations of Lys (p < 0.049), Met (p = 0.027), and Thr (p = 0.037) were higher in pigs fed the LPAA diet. The serum concentrations of His, Ile, Leu, Phe and Val were not affected by the dietary treatment. Regarding the dispensable AA, serum Asn was higher (p = 0.006), Asp tended to be lower (p = 0.094) and Glu was lower (p = 0.003) in pigs fed the HP diet; no differences in the serum concentrations of Ala, Asp, Gly and Pro were observed (p > 0.10).
| Amino acids | LPAA | HP | SEM | p-Value |
|---|---|---|---|---|
| Indispensable | ||||
| Arginine | 2.528 | 4.300 | 0.454 | 0.011 |
| Histidine | 1.244 | 1.688 | 0.205 | 0.141 |
| Isoleucine | 1.992 | 2.318 | 0.326 | 0.487 |
| Leucine | 3.344 | 2.878 | 0.537 | 0.546 |
| Lysine | 4.147 | 1.954 | 0.747 | 0.049 |
| Methionine | 1.173 | 0.631 | 0.162 | 0.027 |
| Phenylalanine | 1.614 | 1.998 | 0.233 | 0.257 |
| Threonine | 4.336 | 2.295 | 0.649 | 0.037 |
| Valine | 3.318 | 2.775 | 0.510 | 0.533 |
| Dispensable | ||||
| Alanine | 7.920 | 6.445 | 0.910 | 0.264 |
| Asparagine | 0.944 | 1.688 | 0.173 | 0.006 |
| Aspartate | 0.269 | 0.195 | 0.030 | 0.094 |
| Glutamine | 8.547 | 7.448 | 0.987 | 0.439 |
| Glutamate | 3.198 | 1.465 | 0.366 | 0.003 |
| Glycine | 5.818 | 5.816 | 0.664 | 0.999 |
| Proline | 4.401 | 4.786 | 0.530 | 0.616 |
| Serine | 1.508 | 1.892 | 0.236 | 0.263 |
Discussion
This study was conducted to determine whether feeding young pigs with low-protein diets supplemented with free AA affects their digestive and absorptive functions as compared with those fed a high-protein diet with no free AA. Free Lys, Met and Thr in the LPAA diet accounted for about 53%, 50% and 36%, respectively, of the total content of each AA. Thus, substantial amounts of these AA were readily available for absorption as they reached the proximal small intestine, without the need of proteolytic enzymes. However, the HP diet contained only protein-bound AA which needed to be released by the action of pancreatic proteases. Hence, we speculated that the abundance or activity of pancreatic proteases and AA transporters might be different between pigs fed either the HP or the LPAA diet.
The secretion of pancreatic proteases appears to be affected by the presence of pancreatic enzymes and their substrates in the proximal small intestine. The infusion of active trypsin, chymotrypsin or elastase into the duodenum blocks the secretion of pancreatic juice (Ihse et al., 1979), but their zymogens are unable to suppress it (Lyman et al., 1974). In contrast, the infusion of trypsin inhibitor stimulates the secretion of pancreatic proteases (Miura et al., 1997). It seems that active pancreatic proteases are critical in the regulation of pancreatic secretion. Fushiki and Iwai (1989) reported that the secretion of pancreatic enzymes in rats and pigs is regulated by a negative feedback mechanism mediated by the intestinal activities of trypsin and chymotrypsin. On the other hand, the intestinal infusion of intact protein (casein) but not a mix of free AA resembling the AA composition of casein stimulated the pancreatic secretion in rats (Schneeman et al., 1977). The lower activities of trypsin and chymotrypsin analysed in the duodenal and jejunal digesta of pigs fed the LPAA diet in the present experiment are in agreement with these reports. The LPAA diet contained less protein, and this protein was lower in Lys and Arg (approx. 50%) than that in the HP diet because of its lower percentage of soybean proteins. Trypsin is highly specific for Lys and Arg (Olsen et al., 2004). Thus, it is speculated that the high content of Arg- and Lys-rich proteins in the HP diet attracted more trypsin preventing it from inhibiting the pancreatic secretion. Liddle et al. (1986) reported that dietary proteins, highly susceptible for the activity of pancreatic proteases, stimulate the secretion of pancreatic enzymes by serving as transient trypsin inhibitors. Thus, the lower contents of protein, Arg and Lys partially explain the reduced trypsin and chymotrypsin activities in pigs fed the LPAA diet.
The release and absorption of most dietary protein-bound AA occur mainly in the jejunum (Silk et al., 1985). Consequently, the abundance of AA transporters in pigs fed diets containing mostly protein-bound AA is expected to be greater in the jejunal mucosa than in that of duodenum or ileum. Likewise, the high content of free Lys in the LPAA diet used in the present experiment would rather stimulate the abundance of Lys transporters in the duodenum, as compared with pigs fed the HP diet. Based on previous reports (Dave et al., 2004; Bröer, 2008), the expression (mRNA abundance) of AA transporters represents their functional activity, hence the increase in the expression of Lys transporters in duodenum may improve the absorption capacity of pigs fed the LPAA diet. We were especially interested in the Lys transporters because Lys is the first limiting AA in most diets for pigs. We were also interested in the neutral AA transporter because Leu interacts with Lys for absorption,
The uptake of dietary Lys by the enterocyte in the small intestine of pigs is facilitated largely by the cationic AA transporter b0,+AT (Bröer, 2008), which is mainly expressed in the apical membrane of epithelial cells (Torras-Llort et al., 2001). The expression of b0,+AT has been reported in duodenum, jejunum and ileum of Tibetan pigs (Wang et al., 2009) and growing pigs (Morales et al., 2015a). The systems b0,+AT functions as antiporters exchanging Leu for Lys, it takes Lys into the enterocyte in exchange for Leu that goes out to the intestinal lumen (Pineda et al., 2004). In the present experiment, the expression of b0,+AT in duodenum was about twofold higher in pigs fed the LPAA diet compared with those fed the HP diet. Similar response was recently reported using 25–50-kg pigs (Morales et al., 2015a). Interestingly, the expression of b0,+AT in jejunum was not affected by the dietary treatment, which is in agreement with the results of Zhang et al. (2013) and Morales et al. (2015b). Hence, the results of the present experiment indicate that the presence of free Lys in duodenal digesta stimulates the expression of b0,+AT in the mucosa of duodenum. Furthermore, assuming the expression of AA transporters represents their functional activity (Dave et al., 2004; Bröer, 2008), these results may indicate that: a) the duodenal absorption of dietary free Lys may be greater than protein-bound Lys, and b) the absorption efficiency of AA may be greater in pigs fed the LPAA diet.
The transport of Lys from the intestinal lumen to blood, initiated by b0,+AT, is completed by the y+LAT1 system, which transports Lys across the basolateral membrane of the enterocyte to blood (Bröer, 2008). This system also functions as antiporter, transporting Lys from the enterocyte to blood in exchange for Leu that goes into the enterocyte (Pfeiffer et al., 1999). In the present experiment, the expression of y+LAT1 in duodenum tended to be 50% higher in pigs fed the LPAA diet. Similar to b0,+AT the expression of y+LAT1 in jejunum was not affected by the dietary treatment. Again, assuming the expression of AA transporters represents their functional activity, these results seem to show a complementary activity between y+ LAT1 and b0,+AT in the process of bringing cationic AA from the intestinal lumen to circulating blood. On the other hand, pigs fed the LPAA diet tended to express more y+LAT1 in jejunum than in duodenum (data not shown). These results support the hypothesis that the form (free vs. protein-bound) in which AA are included in the diet affects the expression site of y+LAT1 in growing pigs. This differential response may be explained as a result of differences in availability of AA for absorption, i.e. free dietary AA are readily available while protein-bound AA have to be digested before being released from the dietary proteins.
The absorption of most neutral AA in the small intestine is mediated by the system B0AT1 (Bröer, 2008), which is located exclusively in the apical membrane of the enterocyte and transports all neutral AA with high preference for Leu, Ile, Val and Met (Reimer et al., 2000). Zhang et al. (2013) reported that the dietary supplementation of branched-chain AA did not affect the expression of B0AT1 in jejunum. We observed recently that B0AT1expression in duodenum, jejunum and ileum was not different between growing (25–50 kg) pigs fed either a low-protein diet supplemented with free AA or a high-protein diet with no supplemental AA (Morales et al., 2015b). The expression of B0AT1 analysed in duodenum and jejunum of the present study was not affected either by the dietary treatment, but it was 4.1-fold higher in ileum of pigs fed the LPAA diet. Although the LPAA diet was supplemented with free neutral AA, it contained more than 80% of protein-bound neutral AA, which partially explains the lack of effect in duodenum and jejunum. However, it is not clear why the expression of B0AT1in ileum was higher in pigs fed the LPAA diet. The LPAA diet was formulated mostly with wheat (approx. 86%), as compared with the HP diet that contained 51% wheat and 41% SBM. Thus, it may be speculated that the wheat proteins, which contain approx. 50% neutral AA, are preferentially digested in the distal small intestine. Based on the assumption that normal Leu influx to the enterocyte occurs across the apical and basolateral membranes via B0AT1 and y+LAT1, respectively (Bröer, 2008), an adequate intracellular content of neutral AA would be expected, helping in turn to sustain the intestinal absorption of cationic AA through b0,+AT.
The transporter B0AT1 is similarly expressed in all segments (duodenum, jejunum and ileum) of the mouse small intestine (Romeo et al., 2006) whereas in humans, B0AT1 expression increases from the duodenum to ileum (Terada et al., 2005). In 25–50-kg pigs, the expression of B0AT1 in jejunum was substantially higher than in the other two intestinal segments (Morales et al., 2015b). In the present study, the expression of B0AT1 was not different between the intestinal segments of pigs fed the LPAA diet, but in pigs fed the HP diet it was higher in both duodenum and jejunum compared with ileum (Fig. 2). These data indicate differences in expression patterns between species and body weight of pigs.
The intestinal abundance of AA transporters is expected to correlate with the absorption and availability of the AA preferred by these transporters. The AA content in the diet (Langer and Fuller, 2000) and the form (free vs. protein-bound) in which AA are consumed by pigs (Yen et al., 2004) are mirrored in the serum concentration of free AA when blood is collected within the first 3 h post-prandial. The total contents of Lys, Met and Thr in the current study were similar between the LPAA and the HP diet, but the LPAA diet contained substantial amounts of free Lys, Thr and Met while the HP contained exclusively protein-bound AA. This explains why the serum concentrations of Lys, Thr and Met were between 90% and 110% higher in pigs fed the LPAA diet. Interestingly, the higher serum concentration of Lys corresponds to the greater expression of b0,+AT in duodenum of the same pigs. On the other hand, the higher serum value of Arg in pigs fed the HP is partially explained by the fact that this diet contained almost twice as much Arg as compared with the LPAA diet. Hence, the serum AA results of the present experiment indicate that a) the serum concentration of AA reflects the dietary AA composition as well as the form (free vs. protein-bound) in which AA are consumed, and b) serum AA may reflect the differential abundance and activity of AA transporters located in each segment of the small intestine.
Conclusion
In conclusion, the activities of trypsin and chymotrypsin in 17-kg pigs are affected by the dietary protein content. Also, adding free AA to low-protein diets differentially modifies the expression pattern of the AA transporters b0,+AT, y+LAT1 and B0AT1 in the small intestine, increasing the first two in duodenum and the third one in ileum. The presence of free Lys in duodenum increases the abundance (expression) of mRNA coding for the synthesis of the cationic AA transporters b0,+AT1 and y+LAT1. The increased serum concentration of Lys in pigs fed the LPAA diet, which was added with significantly high levels of free Lys, seems to support the hypothesis that the expression of AA transporters represents their functional activity. Based on this hypothesis, it appears that pigs fed low-protein diets supplemented with high levels of free AA make certain physiological adjustments that modify their absorption pattern. Specifically, the higher abundance of cationic AA transporters in duodenum combined with the increased serum concentration of cationic AA in pigs fed the LPAA diet, may suggest an increased absorption capacity of these pigs, despite their reduced enzyme activity.
Acknowledgements
The authors acknowledge the Mexican Science and Technology Council (CONACYT) for providing scholarships to L. Buenabad, L. Vázquez and G. Castillo, and thank Evonik Nutrition & Care GmbH for partially financing this research by supplying crystalline AA and performing AA analysis.
