2.1 Animals

The 8-week-old male C57BL/6J mice used in this study were purchased from GemPharmatch Co. Ltd. (Nanjing, Jiangsu, China) and housed in a specific pathogen-free facility with controlled temperature and humidity, and a 12-h light/dark cycle, with free access to food and water. All animal experiments were conducted in strict accordance with the guidelines and approved by the Ethics Committee. The decision to use only male mice was guided by several considerations. Hormone levels in female mice, such as estrogen, fluctuate throughout the estrous cycle and may influence neurological recovery following ischemic brain injury. Previous studies have demonstrated that estrogen exerts protective effects against ischemic stroke by improving cerebral perfusion, reducing oxidative stress, and attenuating inflammatory responses [21-23]. To avoid variability introduced by these hormonal fluctuations and ensure consistency in experimental conditions, we opted to use only male mice in this initial study. This choice aligns with numerous prior studies on ischemic stroke pathology, most of which utilized male mice [24, 25], thus enabling direct comparisons between our findings and existing literature. As this study represents our initial investigation into the mechanisms underlying the effects of DHC on ischemic brain injury, selecting male mice allowed us to effectively validate our core hypotheses without confounding factors.

2.2 Transient Middle Cerebral Artery Occlusion Model and Drug Treatment

Mice were anesthetized with 2.5% avertin, and the right common carotid artery and its external and internal branches were isolated through a midline cervical incision. A filament was inserted into the external carotid artery to occlude the middle cerebral artery. One hour later, the filament was removed to allow for reperfusion. The mice were randomly divided into the sham, MCAO, and DHC groups. The DHC group received intraperitoneal injections of 10 mg/kg DHC (CAS: 477-43-0, Aladdin, Shanghai, China) 30 min after model creation and daily on the second and third days. The MCAO group received intraperitoneal injections of DMSO at the same time points for 3 days. After drug administration, behavioral and subsequent experiments were conducted.

2.3 Behavioral Tests

All mice underwent behavioral training twice daily for three consecutive days immediately preceding MCAO induction. Baseline performance was assessed on the final day of training, one day before MCAO. Mice unable to reliably perform the behavioral tasks after training sessions were excluded from subsequent experiments. Specifically, mice that consistently failed to maintain balance on the rotarod or repeatedly displayed a high error rate in the foot fault test were excluded. This ensured that all animals included in the study had stable and consistent baseline behavioral performance prior to MCAO induction. The rotarod test was used to assess balance and sensorimotor coordination. The mice were placed on a rotating rod, with the speed adjusted to 10, 20, and 30 rpm, each for 5 min, with a 5-min interval between speeds. Subsequent training sessions were conducted at 20, 30, and 40 rpm for 5 min. The time taken to fall off the rod at 40 rpm was recorded as the baseline, and the same was recorded on the test day. The foot fault test was used to assess motor function. The mice were placed on a grid to walk freely, and the number of lost steps in the left upper limb within 50 steps was counted as the baseline, with the same values recorded on the test day. The grip strength test was used to assess muscle function. The mice were lifted by their tail to grasp a horizontal bar with their forepaws, and the grip strength was recorded multiple times. The modified neurological severity score (mNSS) was used to evaluate the severity of neurological deficits, including motor, sensory, and reflex functions. The sum of these values was recorded on the test day. The mice were lifted to observe the bending of their forelimbs and hind limbs, as well as walking on flat ground. The mice were placed on a balance beam to observe their falling behavior.

2.4 TTC Staining

The mice were sacrificed by cervical dislocation, and their brains were removed and sliced using a mold. The slices were then immediately stained with 2% 2,3,5-Triphenyltetrazolium chloride (TTC) staining solution (T8877, Sigma-Aldrich, St. Louis, MO, USA). After the color change, the TTC solution was removed, and the slices were photographed. Infarct area was calculated using ImageJ software (National Institutes of Health, Bethesda, MD, USA).

2.5 Cell Culture

Primary microglial cells were isolated from the brains of newborn mice. The heads of the newborn mice were cut off, and the whole brains were separated and digested with trypsin (T2600000, Sigma-Aldrich, St. Louis, MO, USA) at 37°C for 10 min. The trypsin was then discarded, and the cells were resuspended in medium containing 10% serum (BC-SE-FBS01, Biochannel, Nanjing, China) and 1% Penicillin–Streptomycin (BC-CE-007, Biochannel, Nanjing, China) and cultured at 37°C. The medium was changed at 48 h and 1 week after plating. Cells were collected on days 10 and 13 for subsequent experiments. BV2 cells were cultured in medium supplemented with 10% serum and 1% Penicillin–Streptomycin at 37°C.

2.6 CCK-8 Assay

BV2 cells were plated overnight at a density of 8000 cells/well in 96-well plates. The cells were treated with DMSO or DHC for 24 h, and the medium was removed. CCK-8 solution was prepared according to the instructions of CCK-8 Cell Counting Kit (A311-01, Vazyme, Nanjing, China), and 100 μL of the solution was added to each well. The plates were incubated at 37°C for 1 h, and the absorbance was measured at 450 nm using a microplate reader. Cell viability was calculated as (experimental group—blank group)/(control group—blank group) × 100%. Cells pretreated with DHC for 2 h were stimulated with 500 ng/mL LPS for 24 h, and then cell viability was determined.

2.7 LDH Assay

BV2 cells were treated as described above. LDH assay was performed according to the LDH kit instructions (11644793001; Roche Diagnostics GmbH, Mannheim, Germany). In general, the maximum lysis group was pretreated with lysis buffer for 15 min to ensure complete cell death and served as a control. One hundred microliters of dye were added to each well and incubated at room temperature for 30 min, followed by the addition of stop solution, and the absorbance was measured at 490 nm. The cell death rate was calculated as follows: (experimental group—background group)/(maximum lysis group—background group) × 100.

2.8 Enzyme-Linked Immunosorbent Assay

After collecting the supernatants from each group, IL-6, TNF-α, and IL-1β proteins were detected according to the instructions provided (ABclonal, Wuhan, China).

2.9 Whole Transcriptome Sequencing

Whole transcriptome sequencing was conducted by Shanghai Majorbio Bio-Pharm Technology Co. Ltd. Briefly, total RNA was extracted and the library was enriched. Quality control of the sequencing data was carried out using the fastp software to eliminate low-quality sequences. The software HiSat2 was employed for alignment with the reference genome, and RSEM was used to quantify gene expression levels. DESeq2 was used to analyze gene differences. The criteria for significantly different genes were FDR < 0.05, and |log2FC| > 1. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was performed using the Python software package and calculated using the Fisher's test.

2.10 Immunofluorescence

After anesthetizing mice with 2.5% avertin, PBS and 4% paraformaldehyde were perfused through the right atrial auricular until the liver turned white. Then the mice were sacrificed by cervical dislocation, and their brains were removed. The detached brains were fixed overnight with 4% paraformaldehyde and then sequentially dehydrated in 15% and 25% sucrose solutions for 24 h each. Brain slices of 20 μm thickness were cut by CryoStar NX50 (Thermo Fisher Scientific, Waltham, MA, USA) for further experiments. Primary microglial cells were plated in confocal dishes and treated with DHC for 2 h, followed by stimulation with 100 ng/mL LPS (Escherichia coli 055: B5, Sigma-Aldrich, St. Louis, MO, USA) for 1.5 h. The cells were fixed with 4% paraformaldehyde for 20 min and rinsed with PBS × 10 min each. Cells were permeabilized with 0.25% Triton X-100 and blocked with 5% BSA for 1 h, followed by incubation with primary antibodies anti-Iba1 (Goat, Abcam, 1:500), anti-TMEM119 (Rabbit, Abcam, 1:50), and anti-CD86 (Rabbit, Abcam, 1:100) overnight at 4°C. The next day, after rinsing for 3 × 10 min with PBS, secondary antibodies were applied and incubated at room temperature in the dark for 1 h. After washing with PBS, the nuclei were stained with DAPI (ab104139, Abcam, Cambridge, MA, USA), and imaging was performed using a STELLARIS 5 Confocal Microscope (Leica Microsystems CMS GmbH, Mannheim, Germany) at 20× magnification.

2.11 qRT-PCR

The BV2 cells were plated at a density of 80,000 cells/well in 24-well plates. Cells were treated with DHC for 2 h, followed by stimulation with 500 ng/mL LPS for 3 h or replaced with sugar-free medium and placed in a container containing 95% N₂ and 5% CO₂ for oxygen–glucose deprivation for 1 h, and then replaced with complete medium for reoxygenation for 3 h. Total RNA was extracted using Vezol Reagent (R411, Vazyme, Nanjing, China) and reverse-transcribed into cDNA. Real-time quantitative PCR was performed using the ChamQ Universal SYBR qPCR Master Mix (Q711-02, Vazyme, Nanjing, China), and the expression levels were obtained using the QuantStudio 5 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The results were normalized to the GAPDH expression levels. The primer sequences used were as follows:

iNOS Forward TCCAGGATGAGGACATGAGCAC

Reverse GAACGTCACACACCAGCAGGTTA

COX-2 Forward TGAGCAACTATTCCAAACCAGC

Reverse GCACGTAGTCTTCGATCACTATC

IL-1β Forward CCATCCTCTGTGACTCATGGG

Reverse TCAGCTCATATGGGTCCGAC

IL-6 Forward GACAAAGCCAGAGTCCTTCAGAGAG

Reverse CTAGGTTTGCCGAGTAGATCTC

TNF-α Forward CCACCACGCTCTTCTGTCTA

Reverse GATCTGAGTGTGAGGGTCTGG

GAPDH Forward AGGTCGGTGTGAACGGATTTG

Reverse TGTAGACCATGTAGTTGAGGTCA

2.12 Western Blotting

Proteins from the ischemic penumbra tissue of the mouse cerebral cortex and cells were extracted using radioimmunoprecipitation assay (RIPA) lysis buffer (P0013K; Beyotime, Shanghai, China) containing protease and phosphatase inhibitors. After the protein was lysed on ice for half an hour, it was centrifuged at 12,000 rpm for 20 min. The supernatant was then taken and quantified using a BCA Protein Quantification Kit (E112, Vazyme, Nanjing, China). Denatured proteins were separated by electrophoresis using 10% glue and transferred onto a PVDF membrane. Membranes were blocked with 5% skim milk for 1 h and incubated with primary antibodies anti-iNOS (Rabbit, Abways, 1:1000), anti-COX-2 (Rabbit, Bioworld, 1:1000), anti-TNF-α (Mouse, Abcam, 1:1000), anti-phospho-p65 (Rabbit, Cell signaling technology, 1:1000), anti-p65 (Rabbit, Cell signaling technology,1:1000), anti-phospho-IκBα (Rabbit, Cell signaling technology, 1:1000), anti-IκBα (Rabbit, Abways, 1:1000), anti-phospho-JNK (Rabbit, Cell signaling technology, 1:1000), anti-JNK (Mouse, Proteintech, 1:3000), and anti-GAPDH (Rabbit, ABclonal, 1:300000) overnight at 4°C. After washing thrice with PBST, the membranes were incubated with secondary antibodies at room temperature for 1 h. After three more washes, ECL reagent (BL520A, Biosharp, Beijing, China) was added, and the blots were developed using an Automatic Chemiluminescence Imaging Analysis System (Tanon, Shanghai, China). Bands were quantified using ImageJ software (National Institutes of Health, Bethesda, MD, USA).

2.13 Statistical Analysis

All Statistical analyses were performed using GraphPad Prism version 9.0 (GraphPad Software, La Jolla, CA, USA). Data were presented as mean ± SEM. All data distributions were determined by a normality test, followed by Shapiro–Wilk test. Significant differences between two groups were determined by unpaired Student's t-test, whereas significant differences among multiple groups were determined by one-way ANOVA, followed by Bonferroni's post hoc test. Statistical significance was considered when p < 0.05.

3.1 DHC Exhibits a Safe Concentration Range for Microglial Cells

DHC is a lipophilic compound extracted from snow lotus and is composed of lactone and aromatic rings (Figure 1A). To determine the safe range in BV2 cells, we used CCK-8 and LDH assay kits to test the viability and death rates at various concentrations of DHC. Compared to the control group, a concentration of DHC at 2.5, 5, and 10 μM had no obvious effect on the cell viability and death rates, while at 30 and 50 μM a significant increase in cell death rates was reported (Figure 1B,C). Furthermore, immunofluorescence staining was used to confirm the effective concentration of DHC in primary microglial cells. We did not find any significant difference in the number of Iba-1-positive microglial cells with any tested concentration (Figure 1D,E). In summary, DHC at concentrations of 2.5, 5, and 10 μM showed no toxicity to microglia, which were chosen in subsequent experiments. Additional assays under LPS stimulation further demonstrated significant cytotoxicity at or above 25 μM, thereby establishing 10 μM as the safe upper therapeutic limit (Figure S1).

3.2 DHC Suppresses the Expression of LPS-Induced Pro-Inflammatory Factors in BV-2 Microglial Cells

In order to explore the inhibition effect of DHC on inflammatory responses, mRNA levels of pro-inflammatory factors IL-1β, IL-6, TNF-α, and COX-2 were detected by qRT-PCR. As shown in Figure 2A–D, the levels of pro-inflammatory factors were significantly elevated in the LPS group compared to the control group, and treatment with DHC significantly inhibited the release of these cytokines in a dose-dependent manner, with higher concentrations exhibiting greater inhibitory effects. The protein levels of cytokines in cell lysates and supernatants detected by western blotting and ELISA showed a significant increase in the LPS-treated group compared with that in the control group, but significantly decreased in the DHC-treated group, consistent with findings related to the mRNA (Figure 2E–I). Overall, DHC effectively inhibited the release of pro-inflammatory factors in activated BV2 cells.

3.3 DHC Alleviates Microglia-Mediated Neuroinflammation After Experimental Stroke

Microglia-mediated neuroinflammation is a key factor in stroke outcomes. We further investigated the role of DHC in post-stroke pro-inflammatory responses. The mice were divided into three groups (Sham, DMSO-treated, and DHC-treated) and subjected to MCAO surgery, with the exception of the sham group. Penumbra tissues and brain slices from mice in each group were collected 3 days after MCAO. Our results showed that the mRNA levels of pro-inflammatory factors such as TNF-α, iNOS, IL-1β, and IL-6 were significantly increased after MCAO surgery and obviously decreased after treatment with 10 mg/kg DHC (Figure 3A–D). Similarly, the protein levels of iNOS and COX-2 were decreased in the DHC-treated group compared to the DMSO-treated group (Figure 3E–G). In addition, microglia were activated in an amoeboid-like shape with increased cell volume and short, thick processes after ischemic stroke, which was reversed by DHC treatment (Figure 3H). Dual immunofluorescence staining further revealed a marked reduction in CD86 expression in microglia (TMEM119-positive cells) of the DHC-treated group compared to the transient middle cerebral artery occlusion (tMCAO) group, indicating that DHC might suppress neuroinflammation by inhibiting M1-type microglial activation (Figure S2). Overall, DHC reduced the microglia-mediated neuroinflammation in the penumbra following ischemic stroke.

3.4 DHC Improves Mice Brain Injury After Ischemic Stroke

To examine the infarct size and neurological deficits in mice, TTC and behavioral tests, including the rotarod test, foot fault, grip strength, and mNSS scores, were used in this study. The schematic timeline of animal experiments is shown in Figure 4A. Briefly, after MCAO surgery, mice were intraperitoneally administered 10 mg/kg DHC for 3 days. The mouse brains were then removed from the skull for TTC staining. The TTC staining results showed that DHC treatment reduced the infarct size after MCAO (Figure 4B,C). Behavioral tests showed that DHC treatment also alleviated the functional impairments in MCAO mice, restoring motor and balance abilities to a certain extent (Figure 4D–G).

3.5 DHC Suppresses Pro-Inflammatory Response by Targeting CYP2A6, a Subtype of the Cytochrome P450 Enzyme Through TNF Pathway

After treatment with LPS, transcriptome sequencing was performed to assess the expression profile of total RNA in the lysates of BV2 cells treated with or without DHC. KEGG datasets were used to analyze differentially expressed genes (DEGs) and showed that the target proteins were mainly enriched in the TNF signaling pathway (Figure 5A). Sustained activation of the TNF signaling pathway has been verified in the pathogenesis of a series of human diseases, including diabetes, inflammatory bowel diseases, and autoimmune diseases, providing a new field of agents for the treatment of ailments [26]. The binding of TNF to TNF receptors could ultimately result in the activation of two major inflammatory pathways, JNK and nuclear factor B κB (NF-κB) [27]. Therefore, we validated the expression of the TNF, JNK, and NF-κB pathway-related proteins, namely TNF-α, JNK, p65, and IκBα. Our results showed that LPS treatment upregulated the expression level of TNF-α and the phosphorylation levels of JNK, p65, and IκBα, which were significantly downregulated in the DHC-treatment group (Figure 5B–F). In addition, CYP2A6, a subtype of the cytochrome P450 enzyme predicted to be the most likely target of DHC through the SwissTargetPrediction website, was mimicked as a substrate of DHC in legend-protein interactions (the binding energy was −8.6 kcal/mol) through hydrogen bonds using Autodock software (Figure 5G,H). To verify the inhibition of this target in neuroinflammation, Methoxsalen, a CYP2A6-specific selective inhibitor, was added to detect the mRNA levels of pro-inflammatory factors. As expected, a significant downregulation in the release of pro-inflammatory factors was observed in the Met-treated group compared to that in the LPS-stimulated group, and no differences were observed among those administered DHC, Met, or both (Figure 5I,J). Similar results were obtained under OGD conditions, where Methoxsalen significantly inhibited pro-inflammatory cytokine expression without additional effects from combined DHC and Met treatment (Figure S3). These data indicate that DHC exerts an effect on neuroinflammatory inhibition by suppressing the activation of the TNF pathway via binding to CYP2A6.