A single proline substitution is critical for the thermostabilization of Clostridium beijerinckii alcohol dehydrogenase

Site-Directed Mutagenesis

The enzymes for DNA cloning, sequencing, and amplification were purchased from Amersham (Buckinghamshire, England), New England Biolabs (Beverly, MA), Fermentas MBI (Vilnius, Lithuania), and Promega (Madison, WI). Oligonucleotides for cloning, sequencing, and site-directed mutagenesis of the T. brockii, E. histolytica, and C. beijerinckii adh genes were synthesized by the WIS Chemical Synthesis Laboratory. All other chemicals were of analytical grade. The genes encoding TbADH, CbADH, and EhADH1 were constructed and expressed according to Peretz et al.,28 using the plasmids pBSP80^TbADH, pBSP80^EhADH1, and pBSP80^CbADH as templates for generating the recombinant plasmids coding for the respective mutants H100P-TbADH, P100A-EhADH1, and Q100P-CbADH. Site-directed mutagenesis of TbADH was performed according to the method of Byrappa et al.37 For EhADH1 and CbADH, we used the QuikChange XL Site-Directed Mutagenesis Kit of Stratagene (La Jolla, CA). The mutations were verified by DNA sequencing of the corresponding plasmids. The forward/reverse primers (5′-3′) used for generating the mutants are listed below, with the exchanged bases underlined:

for H100P-TbADH: CCCAGCACTCCGGTGGAA/GATATCCTCTTTGTACTTCAGA

for P100A-EhADH1: CGCAAAGAGGATATGCAATGCATTCAGGAGG/

CCTCCTGAATGCATTGCATATCCTCTTTGCG

for Q100P-CbADH: GTTCAAGCTGGTTTTCCACAGCACTCAAACGGTATGC/

GCATACCGTTTGAGTGCTGTGGAAAACCAGCTTGAAC

Expression and Purification of Recombinant Enzymes

All recombinant plasmids bearing TbADH, EhADH1, CbADH and their mutated variants were transformed into E. coli strain TG-1, and the recombinant proteins were purified according to a modification of a procedure described by Peretz and Burstein.26 Briefly, the transformed cells were cultured for 17 h in 2YT with zinc chloride (50 μM) and ampicillin (100 mg L⁻¹) at 37°C, harvested by centrifugation for 20 min at 8,000g (4°C), and resuspended in buffer A (25 mM Tris-HCl, pH 7.3; 0.1 mM DTT, 0.1 mM EDTA, 0.1 mM benzamidine, 0.02% sodium azide, and 10% glycerol). The cells were disrupted for 5 min by pulsed sonication (Branson Sonifier 450) using a rosette cup immersed in an ice bath and then centrifuged (23,000g for 15 min) to remove cell debris. The supernatant was then heat-treated for 3 min at 65°C and recentrifuged for 15 min at 12,000g. The clear supernatant was applied onto a DEAE-52-cellulose column (10 × 5 cm²), pre-equilibrated with buffer A at 4°C. The column was extensively washed with buffer A until the eluate contained no detectable protein according to the method of Bradford.38 The proteins were eluted from the column with buffer A containing 0.1M NaCl, and the enzymatically active fractions were pooled and applied onto a short Red Sepharose column (12 × 5 cm²) (Pharmacia, Uppsala, Sweden). The purified recombinant enzymes eluted from the Red Sepharose column in a linear gradient of NaCl at concentration ranges of 0.1–1 M for TbADH, 0.1–2 M for CbADH, and 50–250 mM for EhADH1 in buffer A. The fractions containing alcohol dehydrogenase (ADH) activity were collected, concentrated by ultrafiltration (Amicon YM-30), and stored at 4°C. All mutant enzymes used in this study were obtained as intact tetramers and purified to homogeneity, as judged by Coomassie Brilliant Blue staining of SDS-polyacrylamide gel electrophoresis (PAGE) gels.

Enzyme Activity Assay

The catalytic activity of ADH at 40°C was measured by following the reduction of NADP⁺ (and the formation of NADPH), monitored at 340 nm (ε₃₄₀ = 6.2 mM⁻¹ cm⁻¹). The standard assay mixture contained 150 mM 2-butanol, 0.5 mM NADP⁺, and 100 mM Tris-HCl (pH 9.0) in a total volume of 1 mL. One unit of ADH is defined as the amount of enzyme that catalyzes the oxidation of 1 μmol of 2-butanol min⁻¹ at 40°C under the initial velocity at the above-mentioned conditions. Kinetic parameters were measured and calculated using a Beckman DU-7500 spectrophotometer equipped with a Multicomponent/SCA/Kinetics Plus software package and a thermostatted circulating water bath. The Km values for 2-butanol were determined using increasing concentrations of alcohol (0.1–100 mM) and enzyme (5–120 nM) with 0.5 mM NADP⁺ in 100 mM Tris-HCl (pH 9.0). Values represent the average of three experiments; individual measurements were within 10% of the quoted mean.

Thermal Inactivation (T_1/; T_1/)

The thermal stability of the ADHs was determined by monitoring the residual enzymatic activity after 60 min incubation in 25 mM Na/K phosphate buffer (pH 6.8) and 0.1 M NaCl at increasing temperatures. T is the temperature at which 50% of the enzymatic activity is lost after 1-h incubation, interpolated from a plot of the residual enzymatic activity versus temperature. T is the temperature at which 50% of the original CD signal at 218 nm is lost upon heating the protein sample between 30° and 98°C, with an average increase in temperature of 1°C min⁻¹. The value is the mean of three experiments; individual measurements were within 5% of the quoted mean.

Circular Dichroism

Far-UV (200–260 nm) CD spectra were obtained at a temperature range of 30–110°C with an average increase in temperature of 1°C min⁻¹, using an Aviv spectrophotometer, Model 202. Scans were performed every 4°C using ∼3 μM (0.5 mg mL⁻¹) protein in 50 mM Na/K phosphate buffer, pH 6.8, in quartz cells and with a light path of 0.1 cm. Data (mdeg vs. wavelength) were collected every nanometer with an averaging time of 2 s. The background CD signal for each analysis, determined in a single scan using buffer alone at 25°C, was subtracted from each scan and was temperature-independent. The decrease in CD signal with increase of temperature was evaluated at the local minima of 218 nm and further normalized by subtracting from each wavelength the lowest signal observed at that particular wavelength. The change in the percent residual CD signal was plotted as a function of temperature, and the residual 50% CD signal (T) was estimated.

Analytical Procedures

DNA sequencing was performed on an Applied Biosystems Model 373A DNA sequencer using the dideoxy method according to Sanger and Coulson39 and appropriate primers. SDS-PAGE was performed on 12% slab gels and 5% stacking gels according to Laemmli40 (Bio-Rad MiniProtean II system) and stained with Coomassie Brilliant Blue. Protein concentrations were determined according to Bradford,38 using bovine serum albumin as standard. The estimated molecular weight of the recombinant enzymes was determined by chromatography on a column of Superdex S-200.

Crystallization, Data Collection, and Refinement

Single crystals of the Q100P-CbADH mutant were obtained by the microbatch method under oil, using the IMPAX 1-5 robot (Douglas Instruments, East Garston, Hungerford, Berkshire, U.K.). The purified CbADH (6 mg mL⁻¹) was crystallized in a mixture containing polyethylene glycol (PEG) 100 5% (w/v); 2-morpholinoethane-sulfonic acid (MES) 1M, pH 6; PEG 600 30% (v/v); glycerol 10% (v/v); 25 mM NaCl; 50 μM DTT and 25 μM ZnCl₂. A complete data set was collected from a single crystal on a Rigaku R-AXIS IV++ imaging plate area detector using a Rigaku RU-H3R rotating anode operated at 5 kW and Osmic multilayer X-ray focusing mirrors.

Diffraction data were integrated, scaled, and reduced using the HKL program package.41 Crystals formed in space group P2₁2₁2₁, with cell constants a = 79.47 Å, b = 103.34 Å, and c = 193.31 Å, contained one tetramer in the asymmetric unit cell with a Vm of 2.6 ų D⁻¹ and diffracted to 2.25 Å resolution. The structure was solved by molecular replacement using the program PHASER,42 using the refined structure of an apo-CbADH mutant with enhanced thermostability30 (PDB accession code 1JQB) as a model. To avoid model bias in the mutated regions, we calculated a simulated annealing omit electron density map using the standard CNS protocol in a 3.5 Å vicinity of the mutated residues. Side chains of the mutated amino acid residues were then built into the resulting 3Fo-2Fc map. The data collection and refinement statistics are presented in Table I.

All steps of atomic refinement were carried out using the program CNS.43 Map display and model rebuilding were performed using the program O,44 and model inspection using WHATIF and PROCHECK.45 The PDB accession code for Q100P-CbADH is 2B83. The figures were created using the program PyMOL (DeLano Scientific LLC).

Structural Considerations

The structure alignment of the monomers of CbADH, TbADH, and EhADH1 showed very high homology with rms difference of 0.8 Å between CbADH and EhADH1 and 0.7 Å between TbADH and EhADH1. A detailed analysis of the regions in close proximity of Gln100 in CbADH and His100 in TbADH showed that the phi and psi angles of Q100 of CbADH (−55, −41) and H100 of TbADH (−63, −22) fall into the zone allowed for prolines (ϕ −50 to −80; ψ = 120–180) or (ϕ −50 to −70; ψ = −10 to −50).15 Moreover, the preceding residues F99 of CbADH and Y99 of TbADH have the respective ϕ and ψ angles (−128, 75) and (−118, 77), the most common conformation for a residue preceding proline.46 The mutations Q100P-CbADH and H100P-TbADH were performed “in silico” and all possible Pro rotamers were examined. None of the newly introduced Pro rotamers clashed with other residues of the mutant protein.

Molecular and Enzymatic Properties of Mutant Enzymes

Following the site-directed mutagenesis of residue 100 in all three enzymes, we constructed the mutants Q100P-CbADH, H100P-TbADH, and P100A-EhADH1. The purified recombinants were characterized by non-denaturing gel filtration (Superdex S-200) and SDS-PAGE displaying the apparent molecular weights of 38 kDa per monomer and 160 kDa per tetramer, similar to those of the wild-type enzymes (data not shown).

Table II shows the kinetic properties of the enzymatic activity of TbADH, EhADH1, CbADH and their mutants at 40°C, using 2-butanol as substrate. The Km and the enzymatic efficiency (Kcat/Km) values of Q100P-CbADH were very similar to those of CbADH, indicating that neither the binding nor the catalytic efficiency of the enzyme was severely affected by the mutations. The Kcat of P100A-EhADH1 was reduced roughly twofold as compared to the wild type enzyme, however it was compensated by the subsequent reduction in Km leading to preservation of the enzymatic efficiency. Indeed, the mutation of residue 100 in the ADH is far from the active site of the enzyme,31 and any structural change that might have resulted from these mutations did not appear to perturb the active site. The enzymatic efficiency of H100P-TbADH was reduced about fourfold compared to the native enzyme, mainly due to the reduced substrate binding (three fold elevation in Km). This result supports the notion that a conformational change caused by a mutation located at one end of a protein molecule may induce a conformational change at another end of the molecule, thus affecting properties of the protein.47

Thermal Stability

The T and T values of the mutants are presented in Table III and in Figures 2 and 3, respectively. Replacing Gln100 with Pro significantly enhanced the thermal stability of CbADH: ΔT = +8°C; ΔT = +11.5°C. Replacing His100 of TbADH with Pro and Pro100 of EhADH1 with Ala, however, did not alter the thermostability of the thermophilic enzymes.

Table III. Thermal Parameters of the ADHs

ADHs	T (°C)a	ΔT (°C)b	T (°C)a	ΔT (°C)b
TbADH	93.8		93.8
H100P-TbADH	93.8	0	93.8	0
EhADH1	77.5		80
P100A-EhADH1	77.5	0	78.5	−1.5
CbADH	64.5		65.5
Q100P-CbADH	72.5	+8	77	+11.5

• ADHs, Alcohol dehydrogenase.
• a T is the temperature at which 50% of the enzymatic activity is lost after 1 h incubation, interpolated from a plot of the residual enzymatic activity vs temperature. T is the temperature at which 50% of the original CD signal at 218 nm is lost upon heating the protein sample between 30 and 98°C, with an average increase in temperature at 1°C/min.
• b Relative to the wild type enzyme.

Three-Dimensional Structure of Q100P-CbADH

The three-dimensional structure of Q100P-CbADH [tetramer, Fig. 4(a)] was determined to 2.25 Å resolution. No significant change was observed in the Cα chain of the mutant compared with that of the wild-type protein. Inspection of the three-dimensional structure of Q100P-CbADH shows that substitution of the side chain of glutamine with the pyrolidine ring of proline did not impose any steric constraint on the protein structure. Two intra-molecular hydrogen bonds were lost, one between Oϵ1 of the amide group of Gln100 and the main chain nitrogen of Gly297 (distanced 2.62 Å), and the other between Nε2 of the amide group of Gln100 and the main chain carbonyl of Gly297 (distanced 2.92 Å). Upon mutation, an extra CH₂ group, Cδ of Pro100, was introduced into a non-polar environment formed by the nearby Pro88 (distant 3.8 Å from the mutation site), Trp90 (3.5 Å from the mutation site), and Val95 (4 Å from the mutation site) [Fig. 4(b)]. All these residues—P100, P88, W90, and V95—are located in the structural lobe of the protein. An additional 11 aliphatic and aromatic carbon atoms are present within the sphere of 6 Å from Cδ of Pro100 (two methyl groups of Val95; three carbon atoms of the Trp90 indole group; Cβ and Cγ methylene groups of Pro100; Cβ and Cγ of Gln101, and two carbons of the Phe99 phenyl ring).