DNA methylation regulates α-smooth muscle actin expression during cardiac fibroblast differentiation

2.1 Animal care and murine myocardial infarction model

Forty male Sprague–Dawley (SD) rats aged 6–8 weeks and weighing 200–220 g were purchased from the Experimental Animal Center of Yangzhou University (Yangzhou, Jiangsu, China). All experiments in this study were approved by the Ethics Review Board for Animal Studies of the Institute of Southeast University, Nanjing, China and conducted in accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (DHWE Publication No. 96-01, revised in 2002). The SD rats were randomly divided into the myocardial infarction (MI) group or sham-operation group (20 rats per group) and underwent surgical induction of MI by permanent coronary ligation or a sham operation. In general, rats were anesthetized by an intraperitoneal injection of pentobarbital sodium (50 mg/kg, i.p.). After mechanical ventilation was established, a left thoracotomy between the third and fourth intercostal space was performed to expose the left ventricle. After removing the pericardium, the left coronary artery was ligated with a 6-0 silk suture. Successful ligation was confirmed by observation of left ventricular pallor immediately after ligation. Rats in the sham-operation group underwent a similar surgery without ligation. The chest and skin were closed with 5-0 silk suture; the animals were kept under mechanical ventilation until spontaneous breathing occurred and recovered on a heating pad (Liu et al., 2016).

2.2 Cell culture and treatment

The CFs were isolated from adult SD rats (6–8 weeks old) by enzymatic digestion following a standard protocol (Pan et al., 2013). Briefly, rats were anesthetized by pentobarbital sodium (50 mg/kg, i.p.) and steeped in 75% ethanol for 5 min. Hearts were rapidly excised, minced, and placed in a collagenase II/trypsin digestion solution at 37℃ for 8 min. Dulbecco's modified Eagle medium (DMEM) (HyClone, Logan, UT) supplemented with 10% fetal bovine serum (FBS) (Gibco, New Zealand) was added to the cell suspension. After six to seven digestion periods, the cell suspension was centrifuged at 1,000 rpm for 10 min to collect the dissociated cells. Cells were resuspended in DMEM with 10% FBS and 1% penicillin–streptomycin (gibco) and kept for 90 min at 37℃ in a humidified atmosphere containing 5% CO₂ to allow CFs to attach to the dishes. The cells in the medium were discarded. The CFs were further cultured and passaged at a 1:3 dilution. The second- to forth-passage CFs were used in the experiment.

CFs were starved for 12 hr in serum-free DMEM and then treated with 10 ng/ml recombinant human TGF-β₁ (Peprotech Company) or 5-aza-2′-deoxycytidine (5-aza-dC; Sigma-Aldrich) at different concentrations (0, 0.5, 1, and 2 μm) for 48 hr. Medium containing phosphate-buffered saline (PBS) was used as a control (Pan et al., 2013).

2.3 Enzyme-linked immunosorbent assay

Six weeks after the operation, blood samples were collected from the heart and centrifuged at 4°C and 1,000g for 15 min. Plasma was separated and stored at −80°C until analysis. Procollagen Type I C-terminal peptide (PICP) levels were determined using a PICP ELISA Detection Kit (USCNK, Wuhan, China), according to the manufacturer's instructions. Absorbance was determined at 450 nm by using a microplate reader. The results were compared with a standard curve constructed by titrating standards.

2.4 Histology

The rats were euthanized 6 weeks after the operation, and the hearts were harvested and perfused with ice-cold PBS to eliminate blood contamination. Hearts were isolated and fixed in 4% paraformaldehyde overnight, embedded in paraffin, and sectioned at 5-μm thickness. Masson's trichrome staining was performed according to standard methods.

2.5 Quantitative real-time polymerase chain reaction

After the experimental treatment period, total RNA was isolated using TRIzol reagent (Invitrogen, CA). Then, the concentration of RNA was measured using a NanoDropND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA). One microgram of total RNA was reverse transcribed to single-strand complementary DNA (cDNA) using moloney murine leukemia virus (M-MLV) reverse transcriptase (Invitrogen), according to the manufacturer's instructions. Quantitative polymerase chain reaction (qPCR) experiments were performed using IQ SYBR Green Supermix (Bio-Rad) and the BIO-RAD MJ Mini Opticon Real-Time PCR System. The relative gene expression values were calculated using the $$ method, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a control. The primer sequences are listed as follows:

α-SMA, forward primer GCTGTTTTCCCATCCATCGT

reverse primer TTCTCCCGGTTGGCCTTAG;

DNMT1, forward primer ACCACGCCGACATCAACCT

reverse primer TCCTCCACAGCCAGAAAACAC;

DNMT3A, forward primer GGCCCATTCGATCTGGTGA

reverse primer CTTGGCTATTCTGCCGTGTTC;

DNMT3B, forward primer GGTGCGTCGTTCAGGCAGT

reverse primer TCCTCATCTTCCCCTCGGTC;

TGF-β, forward primer CGGCAGCTGTACATTGACTT

reverse primer AGCGCACGATCATGTTGGAC;

Collagen I, forward primer TGACTGGAAGAGCGGAGAGTA

reverse primer GACGGCTGAGTAGGGAACAC;

Collagen III, forward primer TCTTATTTTGGCACAGCAGTC

reverse primer GTGGCTCCTCATCACAGATTA;

CTGF, forward primer CTGACCTGGAGGAAAACATTA

reverse primer TTAGCCCTGTATGTCTTCACAC; and

GAPDH, forward primer CCCATCTATGAGGGTTACGC

reverse primer TTTAATGTCACGCACGATTTC.

2.6 Western blot analysis

Protein was extracted using a Nuclear Protein and Cytoplasmic Protein Extraction kit (KeyGEN Biotech, Nanjing, China), and the protein concentration was quantified using the BCA Protein Assay Kit (KeyGEN Biotech). Western blot analysis was performed as previously described.

The following primary antibodies were used according to the manufacturer's protocol: α-SMA antibody (ab5694; Abcam, Cambridge, UK), DNMT1 antibody (ab13537; Abcam, Cambridge, UK), DNMT3A antibody (ab2850; Abcam, Cambridge, UK), DNMT3B antibody (ab2851; Abcam, Cambridge, UK), p-Smad2 antibody (cst-8828; Cell Signaling Technology), Smad2 antibody (cst-5678; Cell Signaling Technology), phosphorylated c-Jun N-terminal kinase (p-JNK) antibody (cst-9255s; Cell Signaling Technology), JNK antibody (cst-9255s; Cell Signaling Technology), phosphorylated extracellular signal-regulated kinase (p-ERK) antibody (cst-9911; Cell Signaling Technology), ERK antibody (cst-4370s; Cell Signaling Technology), p-p38 antibody (cst-4631; Cell Signaling Technology), p38 antibody (cst-8690; Cell Signaling Technology); in addition, GAPDH (AF1186; Beyotime Biotechnology, China) and tubulin (AF0001; Beyotime Biotechnology) were used as controls. Immunoreactive bands were visualized using an enhanced chemiluminescence reagent and were detected by exposing the blots to X-ray film (Roche Applied Science).

2.7 Nuclear DNMT activity assay

Nuclear protein was extracted using a Cytoplasm Protein and Nuclear Protein Extraction kit (KeyGEN Biotech, Nanjing, China). The activity of DNMTs was measured by a commercially available nuclear DNMT activity assay (GENMED Scientifics, Shanghai, China) according to the manufacturer's instructions with approximately 20 µg of nuclear protein. The absorbance was determined at 510 nm using a microplate reader. In addition, the results were calculated according to the manufacturer's instructions.

2.8 Plasmid construction

Specific small interfering RNAs (siRNAs) against DNMT1 and control siRNA were synthesized by GenePharma (Shanghai, China). The CFs were transfected with either siDNMT1 or siRNA using Lipofectamine RNAi Max transfection reagent (Invitrogen). The siRNA gene sequences used to specifically target DNMT1 were as follows: siDNMT1-1 sense: 5′-GACCATGATTGAAGCTTCATCTAGT-3′; siDNMT1-2 sense: 5′-GCTGTCTATGAAGACTTGATCAATA-3′; and siDNMT1-3 sense: 5′-GACAAGAAGTTCGTTAGCAACATTA -3′.

A DNMT1 expression vector was constructed based on the lentivirus vector pLVX-puro-EGFP. The DNA fragment of DNMT1 was amplified from the rat DNMT1 cDNA purchased from Thermo Fisher Scientific Inc.

2.9 Dual-luciferase assay

The CFs were plated in 24-well plates and cultured overnight. Lipofectamine transfection reagent (Invitrogen) was used to transfect cells according to the manufacturer's protocol. To normalize the luciferase activity, the pRL-TK control vector encoding Renilla luciferase was cotransfected with the pGL4.17 plasmids. The cells were then cultured for 48 hr after transfection and lysed with passive lysis buffer (Promega). The lysates were analyzed using a Dual-Luciferase Reporter Assay System Kit (Promega). Luminescence was measured on a luminometer (Turner Biosystems Instrument).

2.10 Bisulfite sequencing analysis

Genomic DNA was extracted using a Genomic DNA Mini Preparation Kit with a Spin Column (Beyotime Biotech) and converted using the Bisulfite Conversion Kit (Active Motif, 55016), according to the manufacturer's instructions. The primers for sodium bisulfite DNA sequencing were designed using METHPRIMER (http://www.urogene.org/methprimer/) and synthesized by Sangon Biotech (Shanghai, China) as follows: forward primer: 5′-TTTTGGTTTGTAGGAGGGAAGTAG-3′ and reverse primer: 5′-TTTAACCACAAAAATAACCCATTAC-3′. The products of the methylation PCR were then cloned directly into the pUCm-T vector using the pUCm-T Vector Cloning Kit (Sangon Biotech) and sequenced.

2.11 Cell counting kit-8 assay

CFs were seeded in 96-well plate, then treated with TGF-β₁ and transfected with pcDNA-DNMT1, siDNMT1, or inhibitors of a relative signaling pathway for 48 hr. Ten-microlitre CCK-8 solution was added to each well and incubated at 37°C for 2 hr in a 5% CO₂ incubator, and the absorbance of each well was read at a wavelength of 450 nm using a microplate reader. The presented as viability =(absorbance of the samples)/(absorbance of the control).

2.12 5-Ethynyl-2′-deoxyuridine incorporation assay

5-Ethynyl-2′-deoxyuridine (EdU) assay is available from Donghuan (Shanghai, China). The cells were seeded in a 24-well plate. Twenty-four hours after culture, the cells were washed with PBS, followed by treatment with TGF-β₁, and transfected with pcDNA-DNMT1, siDNMT1, or inhibitors of a relative signaling pathway for 48 hr. Then, cells were incubated with serum-free DMEM supplemented with 10 μM EdU for an additional 2 hr at 37°C, and then were fixed with 4% formaldehyde for 30 min, followed by the addition of 150 μl glycine. After 5 min, the cells were incubated with 0.5% Triton X-100 for 10 min at room temperature. After washing with PBS for 5 min, 1× Apollo reaction reagent was added and incubated at room temperature in the dark for 30 min, and then the cells were stained with 300 μl Hoechst 33342 (5 μg/ml) for an additional 30 min in the dark. Cells labeled and unlabeled by EdU were counted under a microscope (TE2000-U; Nikon) and pictures were taken.

2.13 Immunohistochemistry

Immunohistochemical staining was performed on paraffin-embedded heart tissue sections of 5 mm thickness, which were deparaffinized, and treated with 0.3% endogenous peroxidase blocking solution for 20 min. Sections were treated sequentially with 3% hydrogen peroxidase in methanol for 10 min at room temperature and washed with PBS for 5 min three times to block the endogenous peroxidase activity. After high pressure-cooking retrieval and 5% bovine serum albumin blocking, sections were incubated overnight at 4°C with one of the following primary antibodies: proliferating cell nuclear antigen antibody (PCNA; Biolegend, CA), α-SMA antibody, and Vimentin antibody (AF1975, Beyotime Biotechnology); nuclei were identified by 4′-6-diamidino-2-phenylindole (DAPI; C1005, Beyotime Biotechnology). Primary antibodies were detected by rabbit anti-mouse and goat anti-rabbit nonbiotinylated regents (Donghuan), according to the instructions of the manufacturer. Pictures were taken with a Photo and Image Auto Analysis System (Image-Pro-Plus, China)

2.14 Statistical analysis

Quantitative data are presented as the mean ± standard deviation. Student's t test was performed by using SPSS (v.13.0.0; SPSS Inc., Chicago, IL) to determine statistical significance between two groups. *p < 0.05 was considered a statistically significant difference, and **p < 0.01 was considered a highly statistically significant difference.

3.1 Greater collagen density and increased fibrosis-related molecule expression in the infarct area after MI

As shown by Masson trichrome staining, 6 weeks after the operation, the degree of cardiac collagen deposition (Figure 1a) was increased in the MI group compared with the control group. In addition, in MI rats, the plasma PICP level was significantly increased (Figure 1b). We analyzed the expression levels of TGF-β, connective tissue growth factor (CTGF), Collagen I (COL I) and COL III by qPCR and determined that the expression of these fibrosis-related messenger RNA (mRNA) was enhanced after MI (Figure 1c). By using immunohistochemistry, we found a lot of cardiac myofibroblasts, coexpressing vimentin and α-SMA, were accumulated in the infarct zone (Figure 1d). These results showed that the cardiac fibrosis model was successfully constructed by left coronary ligation in rats.

3.2 α-SMA expression was increased by epigenetic modification

qPCR and western blot analysis demonstrated that the mRNA and protein expression levels of α-SMA were both significantly increased in the infarct area of ischemic heart tissue (Figure 2a,b). Meanwhile, in the cardiac fibrosis zone, the number of PCNA⁺ cells were increased in comparison with the sham group (Figure 2c). In addition, these results were confirmed in CFs activated by treatment with 10 ng/ml TGF-β₁ (Figure 2d,e). The results of CCK-8 and EDU assay also indicated that TGF-β₁ could promote CF proliferation (Figure 5f). The dual-luciferase reporter assay also showed that the relative α-SMA promoter activity was significantly increased in CFs treated with TGF-β₁ (Figure 2f). Then, CFs were treated with the DNMT inhibitor 5-aza-dC to identify whether DNA methylation affected α-SMA expression. qPCR and western blot analysis indicated that α-SMA mRNA and protein were overexpressed after 48 hr of incubation with 5-aza-dC (Figure 2g,h). These results indicated that α-SMA expression may be regulated by DNA methylation. To further confirm this finding, we used the sodium bisulfite DNA sequencing assay to examine the methylation status of CpGs upstream of the α-SMA promoter region in CFs treated with TGF-β₁. As expected, the result showed that the level of CpG methylation in the α-SMA promoter region was reduced in CFs treated with TGF-β₁ (12.5%) compared with control cells (37.5%) (Figure 2i). Therefore, these data indicated that epigenetic mechanisms may regulate the phenotype during CF differentiation.

3.3 DNMT activity and expression are decreased in activated CFs and fibrotic tissue

To determine whether DNMTs affected α-SMA expression, we examined the DNMT expression level and activity in both fibrotic tissue and activated CFs. In vivo, the DNMT activity assay kit showed that DNMT activity was significantly reduced after MI (Figure 3a). Then, qPCR revealed that the mRNA expression level of DNMT1 was downregulated after MI. However, no differences were observed in the DNMT3A and DNMT3B mRNA expression levels (Figure 3b). Western blot also demonstrated that the DNMT1 protein expression level in fibrotic tissue was significantly decreased in the MI group compared with the control group (Figure 3c).

In vitro, the expression level of DNMT1 mRNA was decreased after TGF-β₁ treatment, and no difference was observed in DNMT3A and DNMT3B mRNA expression levels (Figure 3d). However, western blot showed that the protein expression levels of all the DNMT isoforms were decreased after incubation, especially DNMT1 (Figure 3e). These results demonstrated that DNMT1 may play a key role in CF differentiation.

3.4 DNMT1 regulates α-SMA expression

To explore whether α-SMA expression was regulated by DNMT1, CFs were transfected with pcDNA-DNMT1 to overexpress DNMT1 (Figure 4a), we found that overexpression of DNMT1 led to inhibition of α-SMA expression (Figure 4c,d). In contrast, the expression level of α-SMA was significantly increased (Figure 4e,f) after the cells were transfected with siDNMT1 (Figure 4b). These data indicated that DNMT1 may regulate α-SMA expression in CFs.

3.5 TGF-β₁ promotes CF differentiation and proliferation and mediates DNA methylation of the α-SMA promoter by suppressing the DNMT1

The CFs were treated with TGF-β₁ and transfected with either pcDNA-DNMT1 or siDNMT1 for 48 hr to explore the relationship between DNMT1 and α-SMA and to further verify the contribution of DNMT1 on TGF-β₁-induced myofibroblast differentiation. We found that DNMT1 overexpression significantly abrogated the TGF-β₁-induced increase in α-SMA expression (Figure 5a,b), whereas DNMT1 downregulation supported the TGF-β₁-induced increase in α-SMA expression (Figure 5c,d). By using DNA methylation analysis, we verified that DNMT1 overexpression prevented TGF-β₁-induced demethylation of the α-SMA promoter (33.3%) (Figure 2i). Therefore, these results revealed a direct relationship between TGF-β₁ and α-SMA expression that was regulated by DNMT1 and suggested that DNMT1 significantly contributed to α-SMA overexpression. Meanwhile, by using CCK-8, we found that TGF-β₁ could significantly promote the CFs proliferation. Compared with the TGF-β₁ group, we found that DNMT1 overexpression significantly abrogated the TGF-β₁-induced proliferation, whereas DNMT1 downregulation promoted the TGF-β₁-induced proliferation (Figure 5e). The results of EdU incorporation assay are consistent with the CCK-8 assay (Figure 5f). These results indicated that TGF-β₁ was able to promote the proliferation of CFs through DNMT1, and DNA methylation of the α-SMA promoter region by DNMT1 likely plays an essential role in CF differentiation.

3.6 Both the Smad and MAPK pathways are involved in DNMT1-mediated CF differentiation and proliferation

Previous studies have documented that TGF-β₁ could induce cell differentiation via the classical TGF-β/Smad signaling pathway or noncanonical MAKP signaling pathway. Therefore, we investigated whether Smad or mitogen-activated protein kinase (MAPK) signaling pathways are involved in TGF-β₁-induced CF differentiation. We performed western blot analysis to detect the protein levels of Smad 2/3 and the three well-characterized MAPK subfamilies, JNK, p38, and ERK, as well as their phosphorylated forms in CFs with TGF-β₁ alone or coupled with Smad inhibitor SB431542, p-JNK inhibitor SP100625, p-p38 inhibitor SB203580, or p-ERK inhibitor AZD6244. The western blot results demonstrated increased protein expression levels of p-Smad 2/3, p-JNK, p-p38, and p-ERK, but without alterations in Smad 2/3, JNK, p38, and ERK protein expression levels in CFs treated with 10 ng/ml TGF-β₁ (Figure 6a–d). Meanwhile, activation of relative phosphorylated forms was repressed by their corresponding inhibitors (Figure 6a–d). It was noteworthy that treatment with the inhibitors could restore the TGF-β₁-induced downregulation of DNMT1 and overexpression of α-SMA (Figure 6a–d). To investigate whether Smad or MAPK signaling pathway is involved in TGF-β1-induced CFs proliferation. We performed the CCK-8 and EdU assays to detect the cell viability in CFs treated with TGF-β₁ alone or coupled with p-Smad2 inhibitor SB431542, p-JNK inhibitor SP100625, p-p38 inhibitor SB203580, or p-ERK inhibitor AZD6244 for 48 hr. The CCK-8 assay results demonstrated that treatment with the inhibitors could restore the TGF-β₁-induced cell proliferation compared with the TGF-β₁ group (Figure 6e); the results of the EdU assay is consistent with the CCK-8 assay (Figure 6f). These results indicated that TGF-β₁ promote the proliferation of CFs through both Smad and MAPK signaling pathways, and both of these pathways were involved in the regulation of DNMT1 and α-SMA expression by TGF-β₁.