2.1 Cell culture, transfection, and EGF stimulation

Human embryonic kidney 293T (HEK293T) cells were procured from American Type Culture Collection (ATCC, Rockville, MD) and cultured in Dulbecco's modified Eagle's medium (#SH30243; Hyclone, Logan, UT) supplemented with 10% fetal bovine serum (FBS; #SH30070; Hyclone) and 1% antibiotic/antimycotic (#SV30010, Hyclone) at 37°C with 5% CO₂. A549 (lung adenocarcinoma line) were procured from ATCC and cultured in RPMI (#SH30027; Hyclone) supplemented with 10% FBS and 1% antibiotic/antimycotic. Small interfering RNA (siRNA) transfections were performed as described previously.¹⁸ Briefly, 48 hours after transfection, cells were serum starved (SS) for 3 hours, incubated with protein synthesis inhibitor cycloheximide (CH, 10 µM) for 1 hour before supplementing serum-free (SF) media with 25 or 50 ng/mL EGF (#PHG0314; Thermo Fisher Scientific, Waltham, MA), as indicated in the experiments. Three hours after ligand stimulation, cells were harvested and probed for EGFR (total and phosphorylated) protein by Western blot analysis. For dose and time-dependent studies, cells were stimulated and/or incubated for doses and time points indicated in respective figures. Densitometry analyses of Western blot band images were performed using NIH ImageJ software, following the steps described here http://www.navbo.info/DensitometricAnalysys-NIHimage.pdf.

2.2 Plasmid construction

As described previously, constructs with deleted domains of UBQLN1 (Figure 1A) were developed using Q5 Site-Directed Mutagenesis Kit as per manufacturer's protocol (#E0554; New England Biolabs, Ipswich, MA) and confirmed by sequencing.^{6, 27}

2.3 Immunoprecipitation, protein estimation, and Western blot

Immunoprecipitation (IP) was performed as described previously.⁶ Briefly, harvested cells for each procedure (IP and/or transfection) were lysed with 1% CHAPS lysis buffer and total protein was estimated using the bicinchoninic acid quantification method.⁶ Western blot analyses were performed in Bolt Bis-Tris gels (#BG4120BOX; Life Technologies, Grand Island, NY) as per manufacturer's protocol using antibodies GAPDH #sc47724 (Santa Cruz, Dallas, TX); Actin #A5316 (Sigma-Aldrich, St. Louis, MO); UBQLN polyclonal was made by inoculating rabbits with a peptide specific to UBQLN1 (Yenzym Antibodies LLC, South San Francisco, CA); and UBQLN1 #14526, FLAG #14793, EGFR #4267, and pEGFR Tyr1068 #3777 (Cell Signaling, Danvers, MA).

2.4 Cell viability and migration assay

Cell viability and migration assays were performed as described earlier.⁷ Briefly, A549 cells were cultured in 60-mm culture plates. After 12 hours of transfection with siRNA, cells were trypsinized, counted, and 2000 cells were reseeded per well in 96-well plates in complete media. Twelve hours after reseeding in complete media, cells were SS for 3 hours followed by stimulation with EGF, and were cultured in media containing 2% FBS. Cell viability was analyzed for four successive days using AlamarBlue (#DAL1100; Thermo Fisher Scientific). At the same time following transfection, 5000 cells were seeded in Transwell cell culture inserts (#CLS3464; Corning Inc, Corning, NY) in triplicate for each condition as described previously.⁹ Briefly, cells were allowed to grow on Transwell cell culture insert in SF media, SF media supplemented with EGF (50 ng/mL), and SF media supplemented with both EGF and erlotinib (1 µM). After 24 hours, membranes were washed once with PBS, fixed with ethanol, stained with Giemsa stain (#R03055; Sigma-Aldrich), and cells were counted on the microscope.

2.5 Live cell imaging

A549 cells were transfected with siRNA against UBQLN1 and non-targeting (NT) control. Twenty-four hours after transfection, cells were trypsinized, counted, and 10 000 cells were reseeded per well in 12-well plates, coated with thin layer commercial extracellular matrix (ECM; #E6909; Sigma-Aldrich) at a concentration of 1 µg/cm² for 12 hours (overnight) in complete media. The next day, all wells were SS for 3 hours. Cells were then maintained in media with 2% FBS or 2% media supplemented with EGF (25 ng/mL). Cells were imaged for 48 hours on a time interval of 15 minutes on Keyence BZ-X810. All pictures were stitched together to produce a video with a speed of 14 fps. For dynamic tracking, five single cells were analyzed on Keyence BZ-X810 software to generate a Chemotaxis plot and to calculate the movement and speed of cells.

2.6 RNA interference sequences

All RNA interference (siRNAs) used for the study were ordered from Thermo Fisher Scientific Biosciences Inc (Lafayette, CO) and transfections were done using Dharmafect1 as per the supplier's instructions. (a) NT control, UAAGGCUAUGAAGAGAUACAA and (b) UBQLN1, siU1¹: GAAGAAAUCUCUAAACGUUUUUU and siU1²: GUACUACUGCGCCAAAUUUUU.

2.7 Statistical analysis

All statistics were performed using GraphPad Prism 8 software. Unless otherwise specified, significance was determined by one-way or two-way analysis of variance, using a cut off of P < .05.

3.1 UBQLN1 and UBQLN2 interact with EGFR

Our previous data described that UBQLN1 interacts with IGF1R. In this study, we aimed to explore the possibility that UBQLN proteins might interact with and regulate additional RTK family member, EGFR. We first performed a co-IP of UBQLNs to identify interacting proteins (Figure 1). We transiently transfected HEK293T cells with UBQLN1-FLAG or UBQLN2-FLAG constructs, then pulled down UBQLN-interacting proteins using anti-FLAG-conjugated agarose beads. Western blot analysis of these FLAG-IP samples revealed that UBQLN1 and UBQLN2 interacted with total EGFR (Figure 1B). Like UBQLN1, UBQLN2 has an n-terminus UBL, a c-terminus UBA, and four STI (STI1-STI4) domains, plus UBQLN2 has an additional unique PXX (12 tandem repeats) domain (Figure 1A). To determine the interacting domain of UBQLN1, we created two constructs as described in Figure 1A and performed a similar co-IP experiment. For one construct, we deleted the UBA domain of UBQLN1 (labeled 542X), and for the second construct, we deleted the UBL domain (labeled 112X). Our results indicated that the UBL domain is the primary site of interaction with EGFR. The deletion of the UBA domain did not cause a loss of interaction between UBQLN1 and EGFR (Figure 1C).

3.2 UBQLN1 regulates expression and activity of EGFR

Next, we investigated whether the loss of UBQLN1 regulated EGFR expression and activity in lung adenocarcinoma cells (Figure 2). A549 cells were transiently transfected with NT siRNA and two UBQLN1-specific siRNAs (Figure 2A). Cells were then SS to synchronize the cell cycle and remove all confounding growth factors present in serum. Then, cells were treated with CH to prevent the synthesis of new EGFR protein. Upon loss of UBQLN1, there was a decrease in total EGFR expression compared to the NT control. This decrease in total EGFR expression was significantly enhanced when the receptor was stimulated with EGF ligand. Next, we tested the regulation of total EGFR when stimulated with different doses of EGF ligand (Figure 2B). There was significantly increased degradation of total EGFR in cells lacking UBQLN1 compared to controls at 10 ng/mL, which was enhanced at 100 ng/mL. Interestingly, the expression of phosphorylated-EGFR (p-EGFR) was not as sensitive to the loss of UBQLN1. Therefore, in cells lacking UBQLN1, there was an EGF dose-dependent degradation of EGFR.

Next, we performed experiments to determine the temporal regulation of EGFR by UBQLN1 (Figure 2D,E). Lung adenocarcinoma cells were transfected with NT or UBQLN1-specific siRNAs. Two days posttransfection, cells were SS for 3 hours, then stimulated with EGF (50 ng/mL) for indicated time points. Upon stimulation with EGF, we observed degradation of total EGFR as time progressed. However, in cells lacking UBQLN1, there was significantly increased degradation compared to control as time progressed.

3.3 UBQLN1-deficient cells exhibit increased cell viability and migration potential

EGFR proteins play a role in maintaining cell viability and stimulating the migratory potential of lung adenocarcinoma cells. We investigated the influence of loss of UBQLN1 on these EGFR-mediated processes (Figure 3). A549 cells were transiently transfected with siRNA for UBQLN1 and NT control and cultured in different conditions as indicated (complete media, SS for 3 hours, SS + EGF [50 ng/mL], and SS + EGF + erlotinib, a p-EGFR inhibitor [1 µM]). Cells were harvested after 3 hours and analyzed by Western blot. When stimulated with EGF, UBQLN1-deficient cells showed almost complete loss of total EGFR and increased expression of p-EGFR, which was blocked by erlotinib (Figure 3A). Next, A549 cells were transfected with NT or UBQLN1-specific siRNAs, and cell viability was measured for 4 consecutive days using alamarBlue (Figure 3B). Consistent with our previous findings, loss of UBQLN1 resulted in increased cell growth in lung adenocarcinoma cell lines. Interestingly, there was an increase in the relative number of cells in UBQLN1-deficient cells stimulated with EGF, compared to controls. Next, we determined the effects of loss of UBQLN1 on cell migration (Figure 3C,D). Using a Transwell migration plate, we seeded A549 cells that had been transfected with either NT or UBQLN1-specific siRNAs and cultured the cells under three conditions—SF media; SF media supplemented with EGF; and SF media supplemented with EGF and erlotinib, a p-EGFR inhibitor. Consistent with our previous data using this migration model, UBQLN1-deficient cells exhibited an approximately threefold increase in migration when stimulated with EGF. Erlotinib decreased the migration of cells in both control and UBQLN1-deficient cells.

3.4 Loss of UBQLN1 results in increased cell movement and speed

We examined individual cell movement and speed to explore the increased migratory potential in cells lacking UBQLN1 (Figure 4). We utilized live-cell imaging equipped with image analysis software (Keyence). A549 lung adenocarcinoma cells were transfected with NT or UBQLN1-specific siRNAs for 24 hours after which they were SS for another 24 hours. At this point, 10 000 cells per well (12-well plates) were seeded on a thin layer of commercial ECM in the presence or absence of EGF (25 ng/mL) to yield the following conditions: siNT (+/−) EGF and siUBQLN1 (+/−) EGF. Live-cell images were captured for 48 hours using a Keyence microscope. All captured images were stitched together to make a representative video (Figure S1). As evident from the videos, loss of UBQLN1 resulted in increased movement of A549 cells which was further enhanced by EGF stimulation. These data are represented as chemotaxis plots (Figure 4A). In addition, we quantified the distance traveled and the rate of travel (speed) for each cell (Figure 4B). These data show that cells lacking UBQLN1 travel further and move faster as compared to the NT controls. These differences were enhanced in the presence of EGF.