Aims. The goal of this study was to construct a single tube molecular diagnostic multiplex assay for the detection of microbial pathogens commonly associated with septicemia, using LATE-PCR and Lights-On/Lights-Off probe technology. Methods and Results. The assay described here identified pathogens associated with sepsis by amplification and analysis of the 16S ribosomal DNA gene sequence for bacteria and specific gene sequences for fungi. A sequence from an unidentified gene in Lactococcus lactis subsp. cremoris served as a positive control for assay function. LATE-PCR was used to generate single-stranded amplicons that were then analyzed at endpoint over a wide temperature range in a specific fluorescent color. Each bacterial target was identified by its pattern of hybridization to Lights-On/Lights-Off probes derived from molecular beacons. Complex mixtures of targets were also detected. Conclusions. All microbial targets were identified in samples containing low starting copy numbers of pathogen genomic DNA, both as individual targets and in complex mixtures. Significance and Impact of the Study. This assay uses new technology to achieve an advance in the field of molecular diagnostics: a single-tube multiplex assay for identification of pathogens commonly associated with sepsis.

1. Introduction

Globally, sepsis affects millions of people, killing at least 1 in 4 [1, 2]. Nucleic-acid-testing- (NAT-) based methods of pathogen identification have for some time been regarded as a desirable alternative to conventional culture-based diagnostic methods for analysis of septicemia specimens [3–23]. Early goal directed therapy within the first 3 hours of the clinical presentation of severe sepsis and septic shock has significantly improved outcomes [1, 24–31]. The use of molecular diagnostic methods is logical because they are rapid, sensitive, specific, and reproducible [32].

We have optimized linear-after-the-exponential PCR (LATE-PCR) to overcome the challenges inherent to construction of a highly informative single-tube multiplex assay for septicemia where an unlimited number of possible pathogens must be detected. LATE-PCR is a form of non-symmetric PCR that generates single-stranded DNA making it possible to probe and quantify these strands at endpoint [33–41]. Utilizing both the expanded temperature and fluorescent space now available for detection of targets at endpoint, LATE-PCR assays can readily be multiplexed [40].

Two conceptually distinct sepsis single tube multiplex assays have been designed and tested in our laboratory. One design used a combination of probes and primers specific to selected genes for each target to differentiate 17 pathogens of interest as well as an internal control [42]. The second design, described here, amplified just three targets, a bacterial 16S rDNA sequence, a sequence in the Candida P450L1A1 gene, and a sequence in Lactococcus lactis subsp. cremoris that served as an internal control. This conceptually simpler assay distinguished different possible bacterial species by virtue of the fact that the target was analyzed at endpoint using a single colored set of Lights-On/Lights-Off probes. Lights-On/Lights-Off probes are a recently described technology that makes it possible to readily distinguish sequence variants among the single-stranded products generated by a LATE-PCR multiplexed reaction [43]. The Candida species, as well as the L. lactis control were distinguished through the use of gene specific probes also analyzed at endpoint in different colors.

2. Materials and Methods

2.1. 16S Sepsis Assay Configuration and Parameters

The 16S sepsis multiplex assay design is shown in Table 1. In this design the 16S bacterial genomic DNA was detected with the Lights-On/Lights-Off probes in the Quasar 670 fluorescent dye channel while the Lactococcus lactis subsp. cremoris control DNA and Candida species of interest were detected in the Cal Org 560 and Cal Red 610 channels, respectively. Figure 1 shows the placement of the primers and Lights-On/Lights-Off probes in the 16S region of choice. The Lights-Off probe locations are highlighted in grey while the Lights-On probe locations are highlighted in red. The full region of 157 bases between the primers was completely covered with Lights-On/Lights-Off probes. The predicted melting temperatures, Tms, of the Lights-On/Lights-Off probes are shown in Table 2.

Table 1. 16S sepsis multiplex assay configuration.

Temperature	Cal Orange	Cal Red	Quasar
High ↓ Low	L. lactis	C. albicans	16S Bacterial Targets
		C. glabratta
		C. parapsilosis
		C. tropicalis

Table 2. 16S On/Off Predicted Probe Tms °C.

Target	Quasar 1 On Probe	Quasar 2 On Probe	Quasar 3 On Probe	Quasar 4 On Probe	Quasar 1 Off Probe	Quasar 2 Off Probe	Quasar 3 Off Probe	Quasar 4 Off Probe
AB	50.2	64.9	18.1	59.5	50.8	42.4	18.3	40.3
EA	69.5	58.6	11.6	69.7	61.5	54.5	18.3	42.1
EC	69.5	58.6	11.6	69.7	61.5	54.5	33	56.4
EFS	24.1	59.7	−2.8	70.6	7.8	34.6	20.6	−3.2
EFM	24.1	59.7	−2.8	70.6	7.8	34.6	20.6	−3.2
KP	70.6	66	13.8	70.6	62.6	64.5	35	57.7
KO	69.5	58.6	11.6	69.7	61.5	54.5	33	56.4
PA	68.9	66	−2.8	58	52	60	35	39.6
SA	54.5	53.8	63.9	34.7	36.8	39.3	20.6	30.3
SE	54.5	53.8	53.9	34.7	36.8	39.3	20.6	30.3
SH	54.5	53.8	50.1	34.7	36.8	38	20.6	30.3
SS	54.5	53.8	58.2	34.7	36.8	0.9	20.6	30.3
SHM	54.5	53.8	56.7	34.7	36.8	38	20.6	30.3

Details are in the caption following the image — **Figure 1**
Open in figure viewer PowerPoint

On/Off Probe placement for the 321–524 bp region of the 16S rDNA gene of *A. baumannii* (NC_010400). The On probes are in red text italics and Off probes highlighted in grey. The primers are in blue text. Distinctions between two adjacent probes are in bold.

Table 3 lists the sequences and the Tms of the primers and probes used in the 16S sepsis multiplex assay. The Candida sp. and control primers and probes were the same as those used in the gene specific version of the assay [42]. Table 4 lists the bacterial and fungal genomic DNA targets of our pathogen test panel.

Table 3. LATE-PCR 16S sepsis multiplex primer and probe sequences.

Primer	Sequence 5′→3′	Bases
16S limiting primer	CCAGACTCCTACGGGAGGCAGCAGT	25
16S excess primer	GTATTACCGCGGCTGTGGCA	20
Candida limiting Primer APT	ACCATTACCTCATTATTGGAGACGTGATGCTGC	33
Candida excess Primer APT	GCAATTTCTTGATCAGTCATTTTTACACCATCTT	34
Candida limiting Primer G	ATGCCCAACAAGCTATCTCTGGTACTTACATGT	33
Candida excess Primer G	CGGATGTTGCAGGGGAAGTATGTTGACCACCCA	33
L. lactis (control) Limiting Primer	CTAAAATCAGGAACTTCGTTATCTTTAGTAGTCACAACCA	40
L. lactis (control) Excess Primer	TAATCATTATTCCTCAAGAAGAGATACAATCGGTCA	36
Control probe	Cal Org 560-ATAAACCTTTCTTAAAAT-BHQ1	18
Candida APT probe	Cal Red 610-ATGTGATATTGATCCAAATCGTGATTTAATAT-BHQ2	32
Candida G probe	Quasar 670-AAACAAGGATGGTACTAGGATGACCGTT-BHQ-2	28
16S Quasar 1 On	Quasar 670-AAGCGAAAGCCTGATGCAGCCATT-BHQ2	24
16S Quasar 2 On	BHQ2-TAGCCGCGTGTGTGAAGAATA-Quasar 670	21
16S Quasar 3 On	Quasar 670-TTATATGTGTAAGTAACTGTGCACATCAA-BHQ2	29
16S Quasar 4 On	Quasar 670-TTGAAGAAGCACCGGCTAACTCCGAA-BHQ2	27
16S Quasar 1 Off	AAGGGGAATATTGCACAATGGTT-BHQ2	23
16S Quasar 2 Off	BHQ2-TTGGCCTTCGGATTGTAAAGCACTTAA-C3 Carbon Linker	27
16S Quasar 3 Off	TATTAGTAGGGAGGAAGTA-BHQ2	19
16S Quasar 4 Off	TTGACGTTACCCGCAA-BHQ2	16

Table 4. Bacterial and fungal genomic DNA targets for 16S sepsis multiplex assay.

Target	Abbreviation	Accession ID	ATCC Acquisition
Bacteria
A. baumannii	AB	NC_010400	17978D-5
E. aerogenes	EA	HM480361	15038D-5
E. cloacae	EC	GU979185.1	13047D-5
E. faecalis	EFS	NC_004668	700802D-5
E. faecium	EFM	AJ301830	BAA-472D-5
K. pneumoniae	KP	NC_011283	BAA-1706D-5
K. oxytoca	KO	NR_041749.1	Received from UC Davis
P. aeruginosa	PA	NC_009656	17933D
S. aureus	SA	NC_002745	Barry Kreiswirth PHRI
S. epidermidis	SE	NC_002976	12228D-5
S. haemolyticus	SH	X66100	29970D-5
S. saprophyticus	SS	EF522127.1	Received from UC Davis
S. hominis	SHM	X66101	Received from UC Davis
L. lactis (Control)	CTL	NC_008527	Received from Smiths
Fungi
C. albicans	CA	AF153846	14053D-5
C. parapsilosis	CP	GQ302972	Received from UC Davis
C. tropicalis	CT	AY942643	Received from UC Davis
C. glabratta	CG	AY942647	Received from UC Davis

2.2. 16S Assay Primer and Probe Design

The 16S sepsis multiplex assay presented an alternative to the archetypal gene specific target approach [42]. The alternating conserved and highly variable regions of the 16S rDNA in bacteria made it possible to amplify the gene in many different species of bacteria while still differentiating between them. These highly conserved regions served as templates for primer design, ensuring that all bacteria of interest would be amplified. The variable region that spanned the sequence between primers was used for identification and differentiation between species using Lights-On/Lights-Off probes in the Quasar 670 fluorescent dye channel.

The Lights-On/Lights-Off probes were designed as consensus probes to bind to as many targets as possible with four On/Off pairs fully coating the region between the primers. The difference in binding Tm of probes to targets allowed for distinction between the 13 bacterial species that were included in our test panel. The output fluorescent composite of all probes rose and fell with temperature and yielded a fluorescent contour that was specific to a pathogen.

Additional specific primer and probe sets were required for the Candida and internal control detection. The four Candida pathogens of our test panel were analyzed with the separate Cal Red 610 dye channel using specific primers and probes. A region of the P450L1A1 gene was used to create two pairs of specific primers made flexible through mis-matches to amplify the four Candida species. Two probes were designed in a similar manner to pick up only the Candida species of interest. In addition to the pathogenic targets in the test panel, specific primers and a probe were designed to amplify an unspecified gene of Lactococcus lactis subsp. cremoris to serve as an internal control detected in Cal Orange 560. Primer and probe sequences were designed for the LATE-PCR assay based on criteria previously described [36].

The primer and probe sequences were put through a series of bioinformatics analyses. The sequences were put through a Basic Local Alignment Search Tools (BLAST) search for comparison to all other sequences in the NCBI Genbank to ensure that there were sufficient nucleotide differences between the target organism and related, non-target organisms (near neighbors). Once the target-specific primers and probes passed the BLAST search evaluation, the monoplex assays were optimized against pathogen genomic DNA targets. After the validation of the monoplex assays, they were combined into a single tube multiplex assay, tested against all pathogen genomic DNA targets and all primer and probe sets.

Table 5 lists the reagents and their concentrations used in the 16S sepsis multiplex assay. The thermal profile used on the Bio Rad IQ5 system for amplification and detection of the assay is as follows: 95°C for 3 min, followed by, 95°C/10 s, 65°C/15 s, 72°C/45 s for 45 cycles followed by a melt starting at 25°C with 1°C/ 30 s increases up to 80°C, followed by, an annealing starting at 80°C with 1°C/ 30 s decreases down to 25°C. Fluorescence was measured in the Cal Orange 560, Cal Red 610 and Quasar 670 channels at each anneal step. All data used in the analysis were taken from the final anneal curve.

Table 5. LATE-PCR 16S sepsis multiplex reagents.

Starting Concentration	Reagent	Final Concentration	Amt/25 uL reaction	Manufacturer
10x	PCR buffer	10 mmol⁻¹	In beads	GE healthcare
10 mmol⁻¹	dNTPs	200 umol⁻¹	In beads	GE healthcare
50 mmol⁻¹	Mg⁺⁺	1.63 mmol⁻¹	1.13 uL + beads	Invitrogen
10 umol⁻¹	Limiting Primer (4)	50 nmol⁻¹	0.125 uL	Sigma
100 umol⁻¹	Excess Primer (4)	1 umol⁻¹	0.250 uL	Sigma
10 mmol⁻¹	On Probe (7)	100 nmol⁻¹	0.250 uL	Biosearch
10 mmol⁻¹	Off Probe (4)	300 nmol⁻¹	0.750 uL	Biosearch
2.5 U/Bead	Pure Taq ready-to-go beads	1.25 U	0.5 bead	GE healthcare
10⁶ genome copies	gDNA	10⁵ genome copies	1 uL	ATCC

2.3. 16S Sepsis Assay: Data Analysis and Making a Clinical Call

The final anneal fluorescence data were exported from the BioRad IQ5 2.1 software into Microsoft Excel. The anneal data were normalized to 75°C to place all of the amplification wells on the same level of background fluorescence and then the no template control (NTC) background was subtracted to get the normalized fluorescence contours. Subsequently, the highest fluorescent peak was then normalized to 1.0 to further put all fluorescence contours on the same scale. We have considered a number of approaches to data analyses that will allow a positive or negative call to be made for a specific pathogen within the error limits of the assay. Here we outline the best way for a software program to make a clinical call. An unknown sample will be amplified by the 16S sepsis multiplex assay and a fixed number of endpoint anneal readings will be taken after the amplification is complete and the probe binding has reached equilibrium, for instance a read every 5°C. The data would then be normalized as indicated above.

The fluorescence values at the temperature points can then be compiled into a table, through which the software can scan. The first scan done by the software determines at which temperature the sample has a value of 1.0. This temperature will correspond to one or more targets in a previously characterized library. Once that temperature is determined and the possible targets narrowed down, the fluorescence level at the temperature point above or below is then compared to the possible targets. This second comparison allows for the determination of the correct bacterial target because of the specific nature of the fluorescent contours.

3. Results

The LATE-PCR 16S sepsis multiplex assay successfully identified all 13 bacterial and four fungal targets in our pathogen test panel in addition to an internal bacterial control in less than three hours. The assay also detects a mix of Gram positive and Gram negative bacterial species as well as fungal Candida species. This is important because sepsis can be due to a wide variety of pathogens. Because of the design of our Lights-On/Lights-Off probes, this assay will also identify bacterial species not included in our test panel.

3.1. LATE-PCR 16S Multiplex Assay

The assay configuration in Table 1 shows the distribution of the bacterial and fungal pathogens of the test panel listed in Table 4. All 13 bacterial targets were detected in a single color using the Lights-On/Lights-Off probe technology. Two remaining channels were used for fungal and internal control detection. Due to the bacterial nature of the control it also gave a fluorescent contour in the Quasar channel along with the other bacterial targets.

The primers were placed in two highly conserved regions of the 16S rDNA that flank a highly variable region (V3). These primers would, theoretically, amplify 98% of the >900,000 16S ribosomal DNA sequences in the Michigan State University’s Ribosomal database [44]. For detection of multiple bacterial pathogens there was no wild-type sequence against which design fluorescent probes, thus consensus probes were the ideal option. The variable region was coated with 4 pairs of Lights-On/Lights-Off consensus probes. The differences in the DNA target sequence for each probe causes each probe/target Tm to vary and this, in turn, results in a unique contour for the set of probes to each bacterial pathogen target.

Figure 2 shows the fluorescent contours of the 13 bacterial targets (referred to according to the abbreviations listed in Table 4). Each fluorescent contour in Figure 2 is the average of three replicate samples. We have previously shown that all three replicates are essentially identical within experimental limits [43]. The EFM was not shown because it gave the same contour as the EFS. This was true despite the fact that the sequences of the two amplicons differ by six bases. But, these sequence differences are not detected because none of the consensus probes targeted to these portions of the two amplicons has a Tm above 25°C. In fact, only three of the eight consensus Lights-On/Lights-Off probes in the set hybridized to these two Enterococcus targets, and the sequence under those three probes yielded the same fluorescent contours. Several possible remedies for this ambiguity are discussed below.

As shown by Figures 3 and 4, the bacterial targets of our test panel also segregated in temperature space on the basis of whether they are Gram positive or Gram negative bacteria. The relatively high GC content of the Gram negative species caused the Tm of their highest normalized fluorescent contours to be above 50°C. The fluorescent contours of the Gram positive bacteria, in contrast, are below 50°C. Figure 3 shows the fluorescent contours of the Gram positive targets. While several contours looked similar there were important nuances in the curves that allowed them to be distinguished from one another. The high reproducibility of the 16S sepsis multiplex assay and Lights-On/Lights-Off probes regardless of the starting concentration of genomic DNA means that these slight nuances are consistent and can be reliably used for species identification. The SA and EFS were the most different from most of the other targets, although the EFS and the CTL had similar contours.

Several Staphylococcal species were among the Gram positive species tested, Figure 5. The fluorescent contours of SHM and SS are distinguishable from each other and from the SE and SH contours between 45°C and 50°C, although SE and SH are not distinguishable from each other at that temperature. But SE and SH are clearly distinguishable from each other between 25°C and 30°C. These results illustrate that multiple pairs of Lights-On/Lights-Off probes generate a high level of information because they test probe/target interactions over a wide temperature space.

Figure 4 shows the fluorescent contours for the Gram negative targets of the test panel. As with the Gram positive targets these contours are highly reproducible, regardless of the starting concentration of genomic DNA. The KO and KP species are distinct from one another because the KO has an extra shoulder indicating the binding of a Lights-On probe at a higher temperature, 60°C, than the binding of its paired Lights-Off probe at 55°C. The two Enterobacter species can also be distinguished because the Lights-On signal arising from EA remains fluorescent down to a lower temperature than the EC signal. The paired Lights-Off probe binds to EA at about 53°C and to EC at about 63°C.

In order to test the limit of detection for each bacterial species, genomic DNA was diluted from 100,000 bacterial genomes down to 10 genomes in tenfold steps. Figure 8 depicts a representative dilution series for SE. All samples were amplified through a total of 45 thermal cycles. Because the 16S rDNA is present from 1 to 15 copies in some bacterial genomes [45], we regard detection at the 10 copy level as indicative of as little as a single bacterial genome present initially in the 25 μL sample. Regardless of how many genomes were present initially all samples exhibit the same fluorescent contours when the highest peak present after 45 cycles is used to normalize the sample across the entire detection temperature range. This result once again confirms that fluorescent contours and fluorescent signatures are highly reproducible features of LATE-PCR analysis with Lights-On/Light-OFF probes [43].

The complete multiplex assay described here also used Cal Red 610 probes (Figure 6) to test for the presence of 10⁵ copies of genomic DNA from Candida sp. and Cal Orange 560 probes (Figure 7) to test for 10⁵ copies of control genomic DNA from Lactococcus lactis.

The 16S sepsis multiplex assay resolved four different Candida species using two pairs of primers to amplify a region of the P450L1A1 gene and two sets of probes to analyze the single-stranded products. The first set of primers amplified three of the four species, C. albicans, C. parapsilosis, and C. tropicalis. The second set of primers amplified both C. glabratta and C. krusei, although the latter species was not actually tested in experiments reported here. The probe sets were designed to generate unique signals for each of the four possible species. These probes were molecular beacon probes and therefore exhibited unique melting temperatures rather than fluorescent contours.

The internal control sequence from L. lactis was used to ensure that the sample preparation protocol did not compromise the integrity of the genomic DNA from any of the bacteria being tested. This sequence was amplified using its own set of primers and detected using a Cal Orange probe. But L. lactis genomic DNA also generated a 16S fluorescent contour in the Quasar 670 channel because it is a bacterial species. In order to avoid this ambiguity in the future we are currently investigating other non-bacterial controls that do not possess a 16S gene target, but still accurately assess the sample preparation protocol.

3.2. Mixtures of Bacterial Targets

The 16S sepsis assay has to detect the presence of more than one bacterial pathogen. Therefore we tested the 16S sepsis multiplex assay against mixtures of targets, specifically focusing on sepsis panel targets versus SE. Figure 9 shows experimental data for a mixture of 10% KP : 90% SE, 50% KP and SE, and 10% SE : 90% KP with pure KP and SE also shown. Figure 10 shows the normalized experimental data for 10% SE : 90% SA, 50% SA and SE, and 10% SA : 90% SE mixtures as well as pure SA and pure SE shown.

All target mixtures had 10,000 copies of total genomic DNA. Mixtures of 50 : 50, 10 : 90, and 1 : 99 were assessed. But, the 1 : 99 mixtures did not differ from the NTC controls by more than three standard deviations and are not shown. The two sets of mixtures shown here illustrate several interesting features of the analytical method. The fluorescent contours for KP and SE do not overlap in temperature space. Thus mixtures of these two organisms demonstrate the greatest possible sensitivity for either minor component, Figure 9. This combination of organisms also represents a mixture of a Gram positive and Gram negative species. The data in Figure 9 show that at least 10% of one pathogen in the presence of 90% of the other can be distinguished from pure samples.

In contrast, SA and SE have very similar fluorescent contours. The data in Figure 10 show that 50 : 50 mixtures of these two Gram positive species can readily be distinguished from pure samples. The 10 : 90 and 90 : 10 mixtures are also resolvable, but have fluorescent contours are similar to the 100% contours.

3.3. 16S Sepsis Assay: Background Human DNA

The presence of human genomic DNA is yet another possible challenge to the robustness of any assay for detection of bacterial 16S genomic DNA. Figure 11 shows the fluorescent contour of a mixture of 10⁵ copies of SE genomic DNA plus 35,000 copies of Promega Human genomic DNA, as compared to pure SE, or pure human genomic DNA separately. It is clear that the human DNA has no effect on the bacterial DNA fluorescent contour.

4. Discussion

Most molecular diagnostic assays make use of symmetric PCR for target amplification and sequence-specific fluorescent probes for real-time detection of the double-stranded DNA products. These NAT based technologies have thus far not lived up to their promise because they lack the capacity to provide all of the needed information in a single-closed tube reaction. As a result, a sepsis sample has to have high numbers of pathogens so that it can be split and run in several tubes in parallel. The solution to this problem lies in use of a single-tube reaction that yields accurate, reliable, relevant information from a sample having low pathogen concentration. The LATE-PCR Sepsis Assay described here begins to address several of these goals.

An alternative, gene specific version LATE-PCR assay described elsewhere is also highly informative and very sensitive [42]. When looking to identify particular pathogens, the gene specific assay is capable of detecting down to a single genome copy of the gene even in the presence of other bacterial targets. The gene specific assay is been tested in coinfection scenarios in a human DNA background with a reliable detection ratio of 99 : 1. The specificity and sensitivity levels of the gene specific assay made it highly useful for reliable detection of pathogens in a clinical setting. The limitation of the gene specific assay is that it cannot detect a pathogen for which it is not designed. For this reason the 16S rDNA LATE-PCR assay described here provides greater coverage than the gene specific assay.

The 16S rDNA sepsis multiplex assay achieves broad coverage by making use of consensus probes together with our novel Lights-On/Lights-Off probe technology. These two components are synergistic, and each can be expanded further to achieve even broader pathogen detection and identification. The primers are to conserved sequences and are therefore nearly universal in their potential to amplify any bacterial 16S gene target. Indeed, the high sensitivity of the primers actually introduces a potential unique limitation of the assay, since it detects E. coli genomic DNA present in many commercial Taq polymerases. As a result the polymerase enzyme has to be highly purified without traces of E. coli rDNA in the background.

The 16S assay is also readily expandable. The additional underutilized fluorescent dye channels can be used to include more probe sets for additional pathogen detection. These probe sets provide further distinction between the increased numbers of targets. For example, we have been able to completely differentiate EFS and EFM fluorescent contours by adding an additional set of Lights-On/Lights-Off probes in the Cal Red 610 channel (data not shown).

Other sepsis molecular diagnostic assays make use of the 16S rDNA target for amplification of multiple pathogens. The SepsiTest, for instance, uses the 16S gene to amplify any bacterial target present in the sample, but the pathogens were not readily distinguished until the amplified products were sequenced [46, 47]. Sequencing adds cost and time to diagnosis, and might result in laboratory contamination from released amplicons. In contrast, the LATE-PCR 16S sepsis multiplex assay described here amplifies and identifies many pathogens in the same closed tube. Only unrecognized pathogens need be sequenced, and once sequenced their unique fluorescent contours are immediately recognizable in future tests.

The SeptiFast Light Cycler assay is able to detect and identify 25 common sepsis pathogens in a short time frame without using sequencing [48]. But, the SeptiFast Light Cycler assay depends on splitting a 50 μL sample into three parallel tubes to identify Gram positive bacteria, Gram negative bacteria, and fungi. The LATE-PCR 16S assay, in contrast, is a triplex assay that makes the same calls in a single-tube having a total reaction volume of just 25 μL.

5. Conclusions

The LATE-PCR 16S sepsis multiplex assay described here reliably detected 13 bacterial species and four Candida species and gave consistent fluorescent contours for the infectious targets of our test panel. We have shown the assay detected down to 10 genome copies, as well as differentiated as little as a 10% mixture when maximizing temperature space. The technology employed to construct this assay is novel and highly flexible.

Acknowledgments

The authors are grateful to Dr. Barry Kreiswirth of PHRI, Newark N. J. for genomic DNA from bacterial cultures of twelve strains of S. aureus. They also thank the UC Davis POC Technologies Center for providing ATCC genomic DNA. This research was supported by the NIH Grants 1RC1EB010543-01 and 5RC1EB010643-02 and also by Smiths Detection Diagnostics, Inc., Watford, UK.

References

1 Angus D. C., Linde-Zwirble W. T., Lidicker J., Clermont G., Carcillo J., and Pinsky M. R., Epidemiology of severe sepsis in the United States: analysis of incidence, outcome, and associated costs of care, Critical Care Medicine. (2001) 29, no. 7, 1303–1310, 2-s2.0-0034958947.
Web of Science® Google Scholar
2 Dellinger R. P., Levy M. M., Carlet J. M., Bion J., Parker M. M., Jaeschke R., Reinhart K., Angus D. C., Brun-Buisson C., Beale R., Calandra T., Dhainaut J. F., Gerlach H., Harvey M., Marini J. J., Marshall J., Ranieri M., Ramsay G., Sevransky J., Thompson B. T., Townsend S., Vender J. S., Zimmerman J. L., and Vincent J. L., Surviving sepsis campaign: international guidelines for management of severe sepsis and septic shock, Critical Care Medicine. (2008) 36, no. 1, 296–327, 2-s2.0-37549020378, https://doi.org/10.1097/01.CCM.0000298158.12101.41.
Google Scholar
3 Chakravorty S., Aladegbami B., Burday M., Levi M., Marras S. A. E., Shah D., El-Hajj H. H., Kramer F. R., and Alland D., Rapid universal identification of bacterial pathogens from clinical cultures by using a novel sloppy molecular beacon melting temperature signature technique, Journal of Clinical Microbiology. (2010) 48, no. 1, 258–267, 2-s2.0-73949134588, https://doi.org/10.1128/JCM.01725-09.
Google Scholar
4 Drancourt M., Bollet C., Carlioz A., Martelin R., Gayral J. P., and Raoult D., 16S ribosomal DNA sequence analysis of a large collection of environmental and clinical unidentifiable bacterial isolates, Journal of Clinical Microbiology. (2000) 38, no. 10, 3623–3630, 2-s2.0-0033775331.
Google Scholar
5 Harris K. A. and Hartley J. C., Development of broad-range 16S rDNA PCR for use in the routine diagnostic clinical microbiology service, Journal of Medical Microbiology. (2003) 52, no. 8, 685–691, 2-s2.0-0043030063, https://doi.org/10.1099/jmm.0.05213-0.
Google Scholar
6 Klausegger A., Hell M., Berger A., Zinober K., Baier S., Jones N., Sperl W., and Kofler B., Gram type-specific broad-range PCR amplification for rapid detection of 62 pathogenic bacteria, Journal of Clinical Microbiology. (1999) 37, no. 2, 464–466, 2-s2.0-0032903242.
Google Scholar
7 Klaschik S., Lehmann L. E., Raadts A., Book M., Hoeft A., and Stuber F., Real-time PCR for detection and differentiation of gram-positive and gram-negative bacteria, Journal of Clinical Microbiology. (2002) 40, no. 11, 4304–4307, 2-s2.0-0036840156, https://doi.org/10.1128/JCM.40.11.4304-4307.2002.
Google Scholar
8 Lehmann L. E., Hunfeld K. P., Emrich T., Haberhausen G., Wissing H., Hoeft A., and Stüber F., A multiplex real-time PCR assay for rapid detection and differentiation of 25 bacterial and fungal pathogens from whole blood samples, Medical Microbiology and Immunology. (2008) 197, no. 3, 313–324, 2-s2.0-42249084460, https://doi.org/10.1007/s00430-007-0063-0.
Google Scholar
9 Lehmann L. E., Alvarez J., Hunfeld K. P., Goglio A., Kost G. J., Louie R. F., Raglio A., Regueiro B. J., Wissing H., and Stüber F., Potential clinical utility of polymerase chain reaction in microbiological testing for sepsis, Critical Care Medicine. (2009) 37, no. 12, 3085–3090, 2-s2.0-73349137967, https://doi.org/10.1097/CCM.0b013e3181b033d7.
Google Scholar
10 Lehmann L. E., Herpichboehm B., Kost G. J., Kollef M. H., and Stüber F., Cost and mortality prediction using polymerase chain reaction pathogen detection in sepsis: evidence from three observational trials, Critical Care. (2010) 14, no. 5, article R186, 2-s2.0-77957897126, https://doi.org/10.1186/cc9294.
Google Scholar
11 Ley B. E., Linton C. J., Bennett D. M. C., Jalal H., Foot A. B. M., and Millar M. R., Detection of bacteraemia in patients with fever and neutropenia using 16S rRNA gene amplification by polymerase chain reaction, European Journal of Clinical Microbiology and Infectious Diseases. (1998) 17, no. 4, 247–253, 2-s2.0-0031850998.
Google Scholar
12 Bispo P. J. M., de Melo G. B., Hofling-Lima A. L., and Pignatari A. C. C., Detection and gram discrimination of bacterial pathogens from aqueous and vitreous humor using real-time PCR assays, Investigative Ophthalmology and Visual Science. (2011) 52, no. 2, 873–881, 2-s2.0-79953272220, https://doi.org/10.1167/iovs.10-5712.
Google Scholar
13 Mohammadi T., Reesink H. W., Vandenbroucke-Grauls C. M. J. E., and Savelkoul P. H. M., Optimization of real-time PCR assay for rapid and sensitive detection of eubacterial 16S ribosomal DNA in platelet concentrates, Journal of Clinical Microbiology. (2003) 41, no. 10, 4796–4798, 2-s2.0-0141958212, https://doi.org/10.1128/JCM.41.10.4796-4798.2003.
Google Scholar
14 Ohlin A., Bäckman A., Björkqvist M., Mölling P., Jurstrand M., and Schollin J., Real-time PCR of the 16S-rRNA gene in the diagnosis of neonatal bacteraemia, Acta Paediatrica, International Journal of Paediatrics. (2008) 97, no. 10, 1376–1380, 2-s2.0-51349126199, https://doi.org/10.1111/j.1651-2227.2008.00924.x.
Google Scholar
15 Rantakokko-Jalava K., Nikkari S., Jalava J., Eerola E., Skurnik M., Meurman O., Ruuskanen O., Alanen A., Kotilainen E., Toivanen P., and Kotilainen P., Direct amplification of rRNA genes in diagnosis of bacterial infections, Journal of Clinical Microbiology. (2000) 38, no. 1, 32–39, 2-s2.0-0033986735.
Google Scholar
16 Shang S., Chen Z., and Yu X., Detection of bacterial DNA by PCR and reverse hybridization in the 16S rRNA gene with particular reference to neonatal septicemia, Acta Paediatrica, International Journal of Paediatrics. (2001) 90, no. 2, 179–183, 2-s2.0-0035107089, https://doi.org/10.1080/080352501300049389.
Google Scholar
17 Shigemura K., Shirakawa T., Okada H., Tanaka K., Kamidono S., Arakawa S., and Gotoh A., Rapid detection and differentiation of Gram-negative and Gram-positive pathogenic bacteria in urine using TaqMan probe, Clinical and Experimental Medicine. (2005) 4, no. 4, 196–201, 2-s2.0-17644405799, https://doi.org/10.1007/s10238-004-0056-x.
Google Scholar
18 Schuurman T., De Boer R. F., Kooistra-Smid A. M. D., and Van Zwet A. A., Prospective study of use of PCR amplification and sequencing of 16S ribosomal DNA from cerebrospinal fluid for diagnosis of bacterial meningitis in a clinical setting, Journal of Clinical Microbiology. (2004) 42, no. 2, 734–740, 2-s2.0-1242336853, https://doi.org/10.1128/JCM.42.2.734-740.2004.
Google Scholar
19 Warwick S., Wilks M., Hennessy E., Powell-Tuck J., Small M., Sharp J., and Millar M. R., Use of quantitative 16S ribosomal DNA detection for diagnosis of central vascular catheter-associated bacterial infection, Journal of Clinical Microbiology. (2004) 42, no. 4, 1402–1408, 2-s2.0-16544388318, https://doi.org/10.1128/JCM.42.4.1402-1408.2004.
Google Scholar
20 Wolk D. M., Struelens M. J., Pancholi P., Davis T., Della-Latta P., Fuller D., Picton E., Dickenson R., Denis O., Johnson D., and Chapin K., Rapid detection of Staphylococcus aureus and methicillin-resistant S. aureus (MRSA) in wound specimens and blood cultures: multicenter preclinical evaluation of the cepheid Xpert MRSA/SA skin and soft tissue and blood culture assays, Journal of Clinical Microbiology. (2009) 47, no. 3, 823–826, 2-s2.0-62749094404, https://doi.org/10.1128/JCM.01884-08.
Google Scholar
21 Wu Y. D., Chen L. H., Wu X. J., Shang S. Q., Lou J. T., Du L. Z., and Zhao Z. Y., Gram stain-specific-probe-based real-time PCR for diagnosis and discrimination of bacterial neonatal sepsis, Journal of Clinical Microbiology. (2008) 46, no. 8, 2613–2619, 2-s2.0-53149153019, https://doi.org/10.1128/JCM.02237-07.
Google Scholar
22 Yang S., Ramachandran P., Hardick A., Hsieh Y. H., Quianzon C., Kuroki M., Hardick J., Kecojevic A., Abeygunawardena A., Zenilman J., Melendez J., Doshi V., Gaydos C., and Rothman R. E., Rapid PCR-based diagnosis of septic arthritis by early gram-type classification and pathogen identification, Journal of Clinical Microbiology. (2008) 46, no. 4, 1386–1390, 2-s2.0-42449156780, https://doi.org/10.1128/JCM.02305-07.
Google Scholar
23 Zucol F., Ammann R. A., Berger C., Aebi C., Altwegg M., Niggli F. K., and Nadal D., Real-time quantitative broad-range PCR assay for detection of the 16S rRNA gene followed by sequencing for species identification, Journal of Clinical Microbiology. (2006) 44, no. 8, 2750–2759, 2-s2.0-33747186194, https://doi.org/10.1128/JCM.00112-06.
Google Scholar
24 Rivers E., Nguyen B., Havstad S., Ressler J., Muzzin A., Knoblich B., Peterson E., and Tomlanovich M., Early goal-directed therapy in the treatment of severe sepsis and septic shock, The New England Journal of Medicine. (2001) 345, no. 19, 1368–1377, 2-s2.0-0035829842, https://doi.org/10.1056/NEJMoa010307.
Google Scholar
25 Micek S. T., Roubinian N., Heuring T., Bode M., Williams J., Harrison C., Murphy T., Prentice D., Ruoff B. E., and Kollef M. H., Before-after study of a standardized hospital order set for the management of septic shock, Critical Care Medicine. (2006) 34, no. 11, 2707–2713, 2-s2.0-33750237410, https://doi.org/10.1097/01.CCM.0000241151.25426.D7.
Google Scholar
26 Thiel S. W., Asghar M. F., Micek S. T., Reichley R. M., Doherty J. A., and Kollef M. H., Hospital-wide impact of a standardized order set for the management of bacteremic severe sepsis, Critical Care Medicine. (2009) 37, no. 3, 819–824, 2-s2.0-62149143664, https://doi.org/10.1097/CCM.0b013e318196206b.
Google Scholar
27 Funk D. J. and Kumar A., Antimicrobial therapy for life-threatening infections: speed is life, Critical Care Clinics. (2011) 27, no. 1, 53–76, 2-s2.0-78649914143, https://doi.org/10.1016/j.ccc.2010.09.008.
Google Scholar
28 Kollef M. H., Sherman G., Ward S., and Fraser V. J., Inadequate antimicrobial treatment of infections: a risk factor for hospital mortality among critically III patients, Chest. (1999) 115, no. 2, 462–474, 2-s2.0-0032911760, https://doi.org/10.1378/chest.115.2.462.
Google Scholar
29 Kost G. J., Tang Z., Tran N. K., Curd E. E., Louie R. F., Albertson T. E., Derlet R. W., and Azari R., Economic implications of optimal diagnosis and treatment of sepsis—work in progress: marginal penalties, antibiotic alterations, and outcome hypotheses, Scandinavian Journal of Clinical and Laboratory Investigation, Supplement. (2003) 63, no. 239, 16–26, 2-s2.0-0043234608.
Google Scholar
30 Kumar A., Roberts D., Wood K. E., Light B., Parrillo J. E., Sharma S., Suppes R., Feinstein D., Zanotti S., Taiberg L., Gurka D., Kumar A., and Cheang M., Duration of hypotension before initiation of effective antimicrobial therapy is the critical determinant of survival in human septic shock, Critical Care Medicine. (2006) 34, no. 6, 1589–1596, 2-s2.0-33744527833, https://doi.org/10.1097/01.CCM.0000217961.75225.E9.
Web of Science® Google Scholar
31 Wisplinghoff H., Bischoff T., Tallent S. M., Seifert H., Wenzel R. P., and Edmond M. B., Nosocomial bloodstream infections in US hospitals: Analysis of 24,179 cases from a prospective nationwide surveillance study, Clinical Infectious Diseases. (2004) 39, no. 3, 309–317, 2-s2.0-3943093972, https://doi.org/10.1086/421946.
Web of Science® Google Scholar
32 Louie R. F., Tang Z., Albertson T. E., Cohen S., Tran N. K., and Kost G. J., Multiplex polymerase chain reaction detection enhancement of bacteremia and fungemia, Critical Care Medicine. (2008) 36, no. 5, 1487–1492, 2-s2.0-42949089382, https://doi.org/10.1097/CCM.0b013e31816f487c.
Google Scholar
33 Sanchez J. A., Pierce K. E., Rice J. E., and Wangh L. J., Linear-After-The-Exponential (LATE)-PCR: an advanced method of asymmetric PCR and its uses in quantitative real-time analysis (Proceedings of the National Academy of Sciences of the United States of America, Proceedings of the National Academy of Sciences of the United States of America. (2009) 106, no. 6, 2-s2.0-60549117292, https://doi.org/10.1073/pnas.0811993106.
Google Scholar
34 Hartshorn C., Anshelevich A., and Wangh L. J., Laser zona drilling does not induce hsp70i transcription in blastomeres of eight-cell mouse embryos, Fertility and Sterility. (2005) 84, no. 5, 1547–1550, 2-s2.0-27644587710, https://doi.org/10.1016/j.fertnstert.2005.05.023.
Google Scholar
35 Hartshorn C., Anshelevich A., and Wangh L. J., Rapid, single-tube method for quantitative preparation and analysis of RNA and DNA in samples as small as one cell, BMC Biotechnology. (2005) 5, article 2, 2-s2.0-13244265562, https://doi.org/10.1186/1472-6750-5-2.
Google Scholar
36 Pierce K. E., Sanchez J. A., Rice J. E., and Wangh L. J., Linear-After-The-Exponential (LATE)-PCR: primer design criteria for high yields of specific single-stranded DNA and improved real-time detection, Proceedings of the National Academy of Sciences of the United States of America. (2005) 102, no. 24, 8609–8614, 2-s2.0-20844433243, https://doi.org/10.1073/pnas.0501946102.
Google Scholar
37 Sanchez J. A., Abramowitz J. D., Salk J. J., Reis A. H., Rice J. E., Pierce K. E., and Wangh L. J., Two-temperature LATE-PCR endpoint genotyping, BMC Biotechnology. (2006) 6, article 44, 2-s2.0-33845604058, https://doi.org/10.1186/1472-6750-6-44.
Google Scholar
38 Salk J. J., Sanchez J. A., Pierce K. E., Rice J. E., Soares K. C., and Wangh L. J., Direct amplification of single-stranded DNA for pyrosequencing using linear-after-the-exponential (LATE)-PCR, Analytical Biochemistry. (2006) 353, no. 1, 124–132, 2-s2.0-33646362745, https://doi.org/10.1016/j.ab.2006.02.012.
Google Scholar
39 Hartshorn C., Eckert J. J., Hartung O., and Wangh L. J., Single-cell duplex RT-LATE-PCR reveals Oct4 and Xist RNA gradients in 8-cell embryos, BMC Biotechnology. (2007) 7, article 87, 2-s2.0-39549088479, https://doi.org/10.1186/1472-6750-7-87.
Google Scholar
40 Rice J. E., Sanchez J. A., Pierce K. E., Reis A. H., Osborne A., and Wangh L. J., Monoplex/multiplex linear-after-the-exponential-PCR assays combined with PrimeSafe and Dilute-′N^′-Go sequencing, Nature protocols. (2007) 2, no. 10, 2429–2438, 2-s2.0-38449116138, https://doi.org/10.1038/nprot.2007.362.
Google Scholar
41 Pierce K. E., Mistry R., Reid S. M., Bharya S., Dukes J. P., Hartshorn C., King D. P., and Wangh L. J., Design and optimization of a novel reverse transcription linear-after-the-exponential PCR for the detection of foot-and-mouth disease virus, Journal of Applied Microbiology. (2010) 109, no. 1, 180–189, 2-s2.0-77953562685, https://doi.org/10.1111/j.1365-2672.2009.04640.x.
Google Scholar
42 Rice L. M., ReisA. H.Jr., Ronish B., Carver-Brown R. R., Czajka J. W., Carver-Brown N., and Wangh L. J., Design of a single-tube, endpoint, LATE-PCR assay for 17 pathogens associated with sepsis, Journal of Applied Microbiology. In press.
Google Scholar
43 Rice J. E., ReisA. H.Jr., Rice L. M., Carver-Brown R. R., and Wangh L. J., Fluorescent signatures for variable DNA sequences, Nucleic Acids Research. (2012) 40, no. 21.
Google Scholar
44 Cole J. R., Wang Q., Cardenas E., Fish J., Chai B., Farris R. J., Kulam-Syed-Mohideen A. S., McGarrell D. M., Marsh T., Garrity G. M., and Tiedje J. M., The Ribosomal Database Project: improved alignments and new tools for rRNA analysis, Nucleic Acids Research. (2009) 37, no. 1, D141–D145, 2-s2.0-58149200948, https://doi.org/10.1093/nar/gkn879.
Web of Science® Google Scholar
45 Klappenbach J. A., Saxman P. R., Cole J. R., and Schmidt T. M., Rrndb: the ribosomal RNA operon copy number database, Nucleic Acids Research. (2001) 29, no. 1, 181–184, 2-s2.0-0035173421.
Google Scholar
46 Wellinghausen N., Wirths B., Franz A. R., Karolyi L., Marre R., and Reischl U., Algorithm for the identification of bacterial pathogens in positive blood cultures by real-time LightCycler polymerase chain reaction (PCR) with sequence-specific probes, Diagnostic Microbiology and Infectious Disease. (2004) 48, no. 4, 229–241, 2-s2.0-1942520935, https://doi.org/10.1016/j.diagmicrobio.2003.11.005.
Google Scholar
47 Wellinghausen N., Kochem A. J., Disqué C., Mühl H., Gebert S., Winter J., Matten J., and Sakka S. G., Diagnosis of bacteremia in whole-blood samples by use of a commercial universal 16S rRNA gene-based PCR and sequence analysis, Journal of Clinical Microbiology. (2009) 47, no. 9, 2759–2765, 2-s2.0-69949087599, https://doi.org/10.1128/JCM.00567-09.
Google Scholar
48 Lucignano B., Ranno S., Liesenfeld O., Pizzorno B., Putignani L., Bernaschi P., and Menichella D., Multiplex PCR allows rapid and accurate diagnosis of bloodstream infections in newborns and children with suspected sepsis, Journal of Clinical Microbiology. (2011) 49, no. 6, 2252–2258, 2-s2.0-79957533179, https://doi.org/10.1128/JCM.02460-10.
Google Scholar

Citing Literature

All articles

Design and Construction of a Single-Tube, LATE-PCR, Multiplex Endpoint Assay with Lights-On/Lights-Off Probes for the Detection of Pathogens Associated with Sepsis

Abstract

1. Introduction

2. Materials and Methods