Insulin-like growth factor I enhances the developmental competence of yak embryos by modulating aquaporin 3
Funding information
This research was supported by the National Natural Science Foundation of China (Grant No. 31472244).
Contents
The objective of our present study was to determine the effects of insulin-like growth factor I (IGF-I) on the development of yak (Bos grunniens) embryos after cumulus–oocyte complex (COC) vitrification and warming followed by in vitro fertilization (IVF). In Experiment 1, the yak COCs underwent vitrification and then IVF. Embryos were incubated in synthetic oviductal fluid (SOF) supplemented with four concentrations (0, 50, 100 and 200 ng/ml) of IGF-I, while the yak COCs without vitrification or IGF-I supplementation acted as the control group; the BAX, BCL-2, AQP3mRNA and aquaporin 3 (AQP3) protein expression levels in the five groups of blastocysts were evaluated using quantitative real-time PCR and immunofluorescence analyses. In Experiment 2, the groups described above were fertilized and incubated. The cleavage rate, blastocyst rate, total cell count per blastocyst and the rate of growth of the inner cell mass (ICM) and trophectoderm (TE) were evaluated. The results were as follows: (1) the AQP3 gene expression and protein expression in the control and 100 ng/ml IGF-I treatment groups were the highest. (2) The BAX gene expression was the lowest and the BCL-2 gene expression was the highest in the control and 100 ng/ml IGF-I treatment groups. (3) The rates of cleavage and blastocysts in the control and 100 ng/ml IGF-I groups were higher than those in the other three groups. The total cell count per blastocyst in the vitrified and warmed 100 ng/ml IGF-I group (106.7 ± 4.9) and the control group (107.3 ± 4.2) was higher than that in the vitrified and warmed 0 ng/ml IGF-I (91.2 ± 3.1), 50 ng/ml IGF-I (92.3 ± 3.7) and 200 ng/ml IGF-I (92.4 ± 3.7) groups. Therefore, we conclude that IGF-I can improve yak blastocyst developmental ability, cytomembrane permeability and formation of the blastocyst cavity after COC vitrification by improving the BAX, BCL-2 and AQP3 expression levels.
1 INTRODUCTION
The yak (Bos grunniens) belongs to the subfamily Bovinae of Bovidae, and it is a domestic animal that survives on minimal food resources and lives at cold, high altitudes (altitude >3000 m, average annual temperature <0°C) throughout the entire Tibetan plateau north of the Himalayas. Currently, it is found in remote areas of the Tibetan plateau and adjacent highlands, including Gansu Province, China (Zi, 2003). The yak fills an important role in Tibetan life, although its reproductive rate is low (30%–60%); hence, it is pivotal to increase the reproductive efficiency of the yak by in vitro embryo production (Barcroft, Offenberg, Thomsen, & Watson, 2003).
Since the first successful cryopreservation of embryos discovered in 1972 (Whittingham, Leibo, & Mazur, 1972), various protective agents have been developed to cryopreserve cumulus–oocyte complexes (COCs) and embryos in mammals, and vitrification is a viable, traditional freezing method. Cryopreservation of yak COCs has great importance because of seasonal breeding (June to December) and the seasonal supply of yak ovaries from the slaughter house (September to December) (Niu et al., 2014), but the reproductive rate after vitrification is also lower than natural. Therefore, it is necessary to improve culture conditions after vitrification to enhance the embryo developmental rate, although the survival rate for embryos in vitro is lower than in vivo.
The aquaporin 3 (AQP3) can improve the permeability of the cytomembrane, which transports water molecules and glycerol, as well as other tiny neutral solutes, between embryos and the external environment, promoting the capacity for blastocyst cavity formation. The AQP3 is thought to contribute to high survival rates in embryos; therefore, it is vital to enhance the AQP3 expression in mammalian embryos to improve cytomembrane permeability and blastocyst cavity formation (Edashige et al., 2007). Thus, an analysis of AQP3 levels in yak blastocysts after COC vitrification will provide information about the permeability of the cytomembrane and the capacity for blastocyst cavity formation.
Many studies have reported that the addition of IGF-I is beneficial for pre-implantation embryo progression by increasing cell proliferation and decreasing apoptosis in mouse (Doherty, Temeles, & Schultz, 1994), rabbit (Herrler, Krusche, & Beier, 1998) and human blastocysts (Lighten, Moore, Winston, & Hardy, 1998). Insulin-like growth factor I provokes the cellular multiplication and differentiation of various somatic cell types. Insulin-like growth factor I increases total blastocyst cell count, including the number of ICM and TE cells, relative to that in control groups. The expression of apoptosis-related genes would be the most pivotal index of the embryo developmental rate after embryo transfer (Hardy, 1997). Decreased total cell count and expression of anti-apoptotic genes, such as BCL-2, and increased expression of apoptotic index genes, including BAX, indicate that the blastocysts are of poor quality. Recent studies have shown that IGF-1 concentrations of 100 ng/ml increased the BCL-XL/BAX transcript expression ratio (Wasielak et al., 2013). Insulin-like growth factor I also enhanced the yak sperm warming vitality and the cleavage rate of blastocysts (Pan, Cui, Baloch et al., 2015a). insulin-like growth factor I enhances the expression of cold-inducible RNA-binding protein (CIRP) to protect cells from vitrification and warming (Pan, Cui, He, et al., 2015). Therefore, the aim of present study was to examine the effect of IGF-I on the cultivation of yak COCs with IVF after vitrification by detecting the expression of BAX, BCL-2 and AQP3 in blastocysts.
2 MATERIALS AND METHODS
All chemical reagents used in this study were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless specified otherwise. The yak ovaries and oocytes were handled according to the experimental practices and standards approved by the Animal Welfare and Research Ethics Committee at Gansu agriculture University.
2.1 In vitro embryo production
2.1.1 COC collection and IVM
The yak ovaries were immediately gathered from yaks that were butchered in a slaughter house in Xining, Qinghai Province; then, the ovaries were transported at 33–36°C in normal saline (0.9% NaCl) containing 1% streptomycin and penicillin for 3 hr. The ovaries were washed four times with normal saline (0.9% NaCl) at 33–36°C. The follicular fluid was aspirated with 18–21-gauge needles and matching 10 ml injection syringes to capture the dominant follicles that are 4–10 mm in diameter. Cryopreserve cumulus–oocyte complexes were chosen from the follicular fluid and washed three times in TCM-199 with Earle's balanced salts, sodium bicarbonate and l-glutamine with 3% sterile foetal bovine serum (FBS). These COCs with favourable morphologies were chosen under a stereomicroscope. In groups of 45–50 COCs, at least five layers of granulosa cells displaying a uniform cytoplasm were placed in 400 μl of TCM-199 (M4530; Sigma) mixed culture with 10% FBS, 200 mM pyruvate, 50 mg/ml gentamycin, 25 ng/ml follicle-stimulating hormone (FSH), 0.5 μg/ml estradiol (E2) and 0.25 IU/ml luteinizing hormone (LH) in four-well dishes (176740; Thermo Scientific, MA, USA). Then, they were cultured with a 200 μl mineral oil (M 8410-1L; Sigma) overlay for 24 hr at 37°C in 5% CO2 with humidified air in an incubator (Thermo Scientific). The yak COCs were matured after 24-hr cultivation.
2.2 Vitrification and warming
Vitrification was selected using the cryotop (CT) method according to a previous method (Hwang, Hara, Chung, Hirabayashi, & Hochi, 2013). In brief, the yak COCs in each group were equilibrated with a base medium for 3 min at room temperature (RT, 20°C–25°C) for transition. The base medium included 7.5% dimethyl sulfoxide (DMSO, Solarbio, D8371) and 7.5% ethylene glycol (EG; Sigma) in Hepes-buffered TCM-199 with 20% FBS. Then, COCs were transferred into a vitrification solution with 15% DMSO, 15% EG and 0.5 M sucrose in the base medium for 1 min at RT. Within this 1-min period, up to 20 COCs were loaded into a polypropylene cryogenic strip in a minimum amount of vitrification solution (100 μl). The cryogenic strip was directly immerged in liquid nitrogen (LN) and placed in non-woven fabric bags. While warming, the cryogenic strip containing the COCs and vitrification solution was placed directly in a water bath for 1 min at 37°C; then, the COCs that were separated from the cryogenic strip were transferred into the solution (0.5 M sucrose in TCM-199/20% FBS) and incubated for 3 min.
2.3 Recovery culture
After warming and incubation for 3 min, the COCs were washed three times with Dulbecco's phosphate-buffered saline (DPBS) and then cultivated in 400 μl of TCM-199 with 10% FBS, 200 mM pyruvate, 50 mg/ml gentamycin, 25 ng/ml FSH, 0.5 μg/ml E2 and 0.25 IU/ml LH covered with 200 μl of mineral oil in four-well dishes for 6 hr at 37°C at 5% CO2 with humidified air (40 COCs/well) in an incubator (Thermo Scientific). The remaining, excellent COCs were evaluated by their morphological appearance and used in subsequent experiments.
2.4 Fertilization of COCs
After recovery culture for 6 hr, the COCs were fertilized with frozen–thawed yak semen (Xining, Qinghai, China) preserved in liquid nitrogen and prepared by a swim-up for 1 hr. The COCs in groups of 40 were transferred into four-well dishes containing 400 μl of insemination medium (Fert-TALP) and fertilized by the excellent capability of the spermatozoa at a density of 3 × 106 spermatozoa/ml. Spermatozoa were co-cultured with COCs in TALP medium for 22–24 hr at 37°C in 5% CO2 with humidified air in an incubator. The TALP medium consisted of Tyrode's medium with 25 mM sodium bicarbonate, 30 mg/ml heparin, 10 mM lactate, 0.2 mM pyruvate, 50 mg/ml gentamycin, 6 mg/ml fatty acid-free BSA and 100 IU/ml penicillin.
2.5 Culture of embryos
During cultivation, after 22–24 hr of IVF, the assumed zygotes were deviated from the surrounding cumulus granulosa cells and spermatozoa. After three washes in DPBS, zygotes that had no cumulus cells were picked and transferred in groups of 30 in a 100 μl droplet of G-1™ PLUS, which is a bicarbonate-buffered medium containing human serum albumin, hyaluronan and gentamicin as an antibacterial agent with an overlay of 200 μl of mineral oil (M8410-1L; Sigma) in a humidified atmosphere with 5% CO2 in the incubator (Thermo Scientific). The zygotes were divided into four groups, and G-1™ PLUS was added with 0, 50, 100 and 200 ng/ml concentrations of IGF-I. The culture medium was replaced every 48 hr. The osmolarity and pH of G1™ PLUS were 265–280 mOsm and 7.1–7.2, respectively.
2.6 Assessment of embryonic development
The 2- to 4-cell, 5- to 8-cell, morula and blastocyst stages were observed and collected at 24, 72, 96 and 192 hr after fertilization in different groups, respectively (Figure 1). The developmental rates at each stage were contrasted after 192 hr. Twenty blastocysts per the four concentration groups were collected and cryopreserved at −80°C for mRNA expression analysis. To count the ICM and TE cells in blastocysts, 30 blastocysts in four concentrations of IGF-I were fixed in 4% paraformaldehyde in PBS at 4°C for cell immunofluorescence staining. Five replicates were evaluated for each experiment.
2.7 Differential staining of blastocysts and cell counting
To confirm the total number of cells at the blastocyst stage and determine the proportion of ICM and TE cells, the ICM and TE cells were marked as described by A. Van Soom and Eline Wydooghe with some revision (Van Soom, Ysebaert, & de Kruif, 1997; Wydooghe et al., 2011). Briefly, the yak blastocysts were permeabilized with 1% Triton X-100 in PBS for 30 min at room temperature (RT); then, DNA was denatured by exposure to 2 N HCl for 20 min followed by exposure to 100 mM Tris-HCl (pH 8.5) for 10 min. After denaturation, the blastocysts were blocked in blocking solution (5% BSA in PBS) for 40 min at RT and then incubated with primary antibodies (ab88129; Abcam) that recognized bovine CDX2 at a 1:100 dilution in antibody dilution (P0103; Beyotime, shanghai, China) for 1 hr at RT. After washing three times for 20 min in PBS at RT, the blastocysts were treated with goat anti-rabbit IgG Alexa Fluor 555 (bs-0295G-AF555; Bioss, Beijing, China) secondary antibodies at 1:500 dilution in antibody dilution (P0108; Beyotime) for 1 hr at RT in lucifuge. After another wash step (3 times 20 min), DNA was stained with 4′-6-diamidino-2-phenylindole (DAPI, 1 mg/mL in PBS) for five min in lucifuge. After another wash step (3 times 20 min), the blastocysts were mounted under a coverslip in mineral oil (M8410-1L; Sigma) on glass slides. The blastocysts were examined and photographed with a fluorescence microscope (Leica, Solms, Germany) equipped with a DFC 350 digital camera (Leica). Both TE and ICM nuclei were stained with DAPI. The CDX2 antibody was indirectly labelled with Texas Red resulting in a red fluorescent signal in TE cells only. The total cell nuclei per blastocyst and number of TE and ICM cells were counted. The experiments were replicated five times. In each replication, five blastocysts were processed per group.
2.8 AQP3 protein immunofluorescence staining
In brief, the blastocysts were permeated with 1% Triton X-100 in PBS for 30 min at RT; then, the blastocysts were washed three times in PBS, blocked with blocking solution (P0102; Beyotime) for 30 min at RT and incubated with primary antibodies (Abcam, ab125219) that identified yak AQP3 protein at a 1:100 dilution in antibody dilution (P0103; Beyotime) for 1 hr at RT. The following procedures from “washing after the primary antibody effect” to “blastocysts were examined and photographed” were the same as described in the “Differential staining of blastocysts and cell counting” section. Immunofluorescence had the same following conditions: same exposure time, contrast, gamma value and saturation using a red edge filter and green excitation light filter. The experiments were repeated five times, and 20 blastocysts were evaluated in each replication.
2.9 AQP3 protein expression analysis
Immunofluorescence had the following conditions: same exposure time, contrast, and gamma value and saturation using a red edge filter and green excitation light filter. Then, the protein grey value in immunofluorescence pictures was analysed by image-pro plus (Media Cybernetics, USA). The blastocyst group without vitrification and IGF-I treatment was used as a control group. The experimental procedures were identical with “AQP3 protein immunofluorescence staining.” The grey value of protein expression was evaluated by relative quantitation.
2.10 Gene expression analysis
2.10.1 Primer design
Primer sequences for glyceraldehyde phosphate dehydrogenase (GAPDH), BCL-2, BAX and AQP3 were designed according to the published Bos taurus mRNA sequences in GenBank, which was designed by the free access program primer Premier 6.0 software (Premier Biosoft International, Palo Alto, CA). A Basic Local Alignment Search Tool (BLAST) search was designed to confirm the specificity of the primers (http://www.ncbi.nlm.nih.gov/BLAST) from the National Centre for Biotechnology Information (NCBI, Bethesda, MD, USA). The relative transcript level of GAPDH was used as a reference and did not change in these experimental conditions, as confirmed by semi-quantitative RT-PCR.
2.11 RNA isolation and reverse transcription PCR (RT-PCR)
Total RNA was extracted from each group of 20 blastocysts (three replicates) using the RNeasy Micro Kit (Qiagen, Valencia, CA, USA) following the operating instructions. RNA samples were stored in a refrigerator (−80°C) until analysis. For reverse transcription, complementary DNA (cDNA) was synthesized using 1 μl of RNA with a GoScript™ Reverse Transcription System (Promega, Madison, WI, USA). RT-PCRs were conducted in two steps. In the first step, 4 μl of RNA and 1 μl of oligo (dT) 15 were heated to 70°C for 5 min and immediately placed on ice for at least 5 min. In the second step, 4 μl of GoScript™ 5 × Reaction Buffer, 3 μl of MgCl2, 1 μl of PCR Nucleotide Mix, 0.5 μl of Recombinant RNasin Ribonuclease Inhibitor, 1 μl of GoScript™ Reverse Transcriptase and 5.5 μl of DEPC-treated water were added to the reaction mixture. Reverse transcription was performed at 25°C for 5 min, 42°C for 1 hr and 70°C for 15 min.
2.12 Real-time PCR in yak blastocysts
After RT-PCR and PCR, the mRNA sizes were confirmed by gel electrophoresis on a 1.5% agarose gel stained with ethidium bromide (EB) in a TAE buffer solution and observed under an ultraviolet light. The mRNA levels were quantified by real-time PCR (ABIViiA™ 7; Applied Biosystems, Foster City, CA, USA). The reaction conditions contained 1 μl of cDNA equivalent to 1 blastocysts, 0.5 μl of forward- and reverse-specific gene primers (Table 1), 10 μl of SYBR® Premix Ex Taq™ II, 0.4 μl of ROX Reference Dye II and 7.6 μl of water, with a total volume of 20 μl. The real-time PCR were performed in the following three stages: the first hold stage was 95°C for 20 s, the second stage was 40 cycles of denaturation at 95°C for 5 s followed by annealing and extension at 60°C for 34 s and the melt curve stage was 60°C for 1 min.
| Gene | Sequence 5′ to 3′ | Tm (°C) | Fragment size (bp) | GenBank accession no |
|---|---|---|---|---|
| AQP3 |
CCGACGAGGAGAATGTGAAGTT AGGTCCTGCTGGGTCCTATTTC |
60 | 233 | NM_001079794.1 |
| BAX |
CTGAAGCGCATCGGAGATGAAT GAAAACATTTCAGCCGCCACT |
61 | 116 | NM_173894.1 |
| BCL-2 |
CCTGTGGATGACCGAGTACC GGCCTGTGGGCTTCACTTAT |
60 | 211 | NM_001166486.1 |
| GAPDH |
TGGCCTCCAAGGAGTAAGGT GATGGTACACAAGGCAGGG |
60 | 188 | NM_001034034.2 |
In each quantitative real-time PCR, cDNA of yak blastocysts was detected four times and repeated at least twice. The Ct values of the reference gene (GAPDH) in each treatment had a coefficient of variance of 1.62% with an average of 26.31 ± 0.31. The fluorescent signals were acquired at 60°C followed by subsequent acquisition at 10-s intervals until the temperature reached 95°C (Sales et al., 2014). The relative quantification of gene expression was performed by the 2−ΔΔCt method (Livak & Schmittgen, 2001).
2.13 Experimental design
In Experiment 1, the effect of IGF-I on BAX, BCL-2 and AQP3 expression in yak blastocysts derived from COCs cultivated with vitrification and control group was evaluated. Yak zygotes were divided into the following five groups: (i) the control group, for which COCs were cultivated without vitrification and zygotes, were cultured in TCM-199 and G-1™ PLUS with 0 ng/ml IGF-I and (ii) the other four groups, for which COCs were cultivated with vitrification and zygotes, were cultured in G-1™ PLUS with 0, 50, 100 or 200 ng/ml IGF-I. After cultivation, the blastocyst in five groups was used to assess the BAX, BCL-2 and AQP3 mRNA expression, and the protein expression of AQP3.
In Experiment 2, the blastocysts were divided into the following five groups: (i) the COCs that were cultivated without vitrification was the control group and (ii) the COCs that were randomly divided into four groups after vitrification and warming were then fertilized and cultured in four IGF-I concentrations as in Experiment 1. The cleavage and blastocyst rates were evaluated for each group. The total number per blastocyst and the rate of ICM and TE were evaluated for the vitrification and control groups.
2.14 Statistical analysis
Yak COCs that were cultivated, vitrified and warmed were stochastically allocated to each group. The averages of the total cell number and ICM per blastocyst in each treatment group were evaluated. The data were processed and analysed using ANOVA by Statistical Product and Service Solutions (IBM SPSS statistics 20, Chicago, IL, USA) and presented as the mean and SEM; a, b and c in different letters on the data indicate values that differ significantly (p < .05). The relative quantification of the BAX, BCL-2 and AQP3 gene expression levels was analysed using the 2−ΔΔCt method. Real-time PCR was repeated four times. Aquaporin 3 protein expression was analysed with relative quantitation using protein grey values. The experiments were repeated four times.
3 RESULTS
The mRNA expression in Experiment 1 of AQP3, BAX, BCL-2 and GAPDH in yak blastocysts detected using PCR and gel electrophoresis in five groups was shown in Figure 2.
3.1 Gene expression of AQP3 in yak blastocysts
In Experiment 1, we obtained the gene expression of AQP3 in blastocysts in five groups based on real-time PCR (Figure 3). The AQP3 expression levels in blastocysts cultured in the control and 100 ng/ml IGF-I groups were significantly higher than those in the other three groups (p < .05). However, the AQP3 gene expression levels were not significantly different between the 50 ng/ml IGF-I and 200 ng/ml IGF-I groups (p > .05), and AQP3 gene expression in the group with 0 ng/ml IGF-I with vitrification was the lowest of the five groups. The AQP3 gene expression in the group with 0 ng/ml IGF-I with vitrification had a significant difference to the non-vitrified group as well (p < .05).
3.2 Protein expression of AQP3 in yak blastocysts
In Experiment 1, immunofluorescence analysis was used to investigate the AQP3 protein expression in the five groups, and the results are shown in Figure 4; AQP3 protein was detected by specific antibodies showed in red. During the protein grey value analysis by image-pro plus (Media Cybernetics), the AQP3 protein expression levels in the control and 100 ng/ml IGF-I groups were significantly higher than in the other three groups (p < .05). Furthermore, the AQP3 protein expression was not significantly different between the 50 ng/ml IGF-I and 200 ng/ml IGF-I groups (p > .05), and AQP3 protein expression in the group with 0 ng/ml IGF-I with vitrification was the lowest of the five groups. The results of AQP3 protein expression were coincident with the results of AQP3 gene expression. The specific consequence was showed in Figure 5.
3.3 Gene expression levels of BAX and BCL-2 in yak blastocysts
In Experiment 1, we obtained the gene expression levels of BAX and BCL-2 determined by real-time PCR in five groups (Figure 6). BAX expression levels in the control group and the group cultured with 100 ng/ml IGF-I were lower than those in the other three groups (p < .05). The BCL-2 gene expression levels in the control group and the 100 and 200 ng/ml IGF-I groups were higher than those in the other two groups (p < .05), while the expression in the 50 ng/ml group was higher than that in the 0 ng/ml IGF-I group. In conclusion, in the 100 ng/ml IGF-I-treated group, BAX gene was downregulated and the BCL-2 gene was upregulated comparing to the 0 ng/ml IGF-I-treated group.
3.4 The distribution of ICM and TE in five groups
The distributions of TE cells and total cells are shown in Figure 7. In this figure, teams A, B, C and D represent yak blastocysts produced in vitro and treated with 0, 50, 100 and 200 ng/ml IGF-I after COC vitrification. Team E represents the fresh control group without vitrification. TE cells could be isolated with CDX2 protein stained with labelled specifically immune antibody shown in red fluorescence (A1-E1). Both TE and ICM cell nuclei were stained with DAPI shown in blue fluorescence (A2–E2). There was no significant difference (p > .05) in the total cell count per blastocyst between the group of vitrified-warmed in the 100 ng/ml IGF-I and the group without vitrification. The total cell count of these two groups was higher than other three groups, respectively, adding 0 ng/ml, 50 ng/ml and 200 ng/ml IGF-I after vitrification; these three groups had no significant differences (p > .05) in the total cell count per blastocyst. Nevertheless, the rate of ICM/total cells was not significantly different (p > .05) in the five groups in Experiment 2 (Table 2).
| Treatment (ng/ml) | No. of Total cells | No. of TE cells | No. of ICM cells | Rate of ICM in Total cells (%) |
|---|---|---|---|---|
| Fresh Control | 107.3 ± 4.2a | 83.2 ± 1.4a | 24.1 ± 2.8a | 22.5 ± 1.5a |
| IGF-I 0 | 91.2 ± 3.1b | 70.3 ± 1.8b | 20.9 ± 1.3b | 22.9 ± 1.9a |
| IGF-I 50 | 92.3 ± 3.7b | 71.8 ± 2.2b | 20.5 ± 1.5b | 22.2 ± 1.6a |
| IGF-I 100 | 106.7 ± 4.9a | 82.1 ± 3.2a | 24.6 ± 1.7a | 23.1 ± 2.8a |
| IGF-I 200 | 92.4 ± 3.7b | 71.0 ± 2.2b | 21.4 ± 1.5b | 22.9 ± 1.7a |
- The superscript letters a, b within columns for a particular parameter differ significantly (p < .05).
- The experiments were replicated five times. In each replication, five embryos in each treatment were processed.
3.5 Developmental competence of yak embryos in Experiment 2
In Experiment 2, there were no significant differences (p > .05) in the cleavage and blastocyst rates between the 100 ng/ml IGF-I group after vitrification and the group without vitrification (Table 3). The rates of these two groups were significantly higher (p < .05) than those in other three groups: 0 ng/ml IGF-I, 50 ng/ml IGF-I and 200 ng/ml IGF-I groups. However, there was no significant difference (p > .05) in the cleavage and blastocyst rates in these three groups after vitrification.
| Treatment (ng/ml) | NO of COCs | NO/Cleavage rate (%) | NO/Blastocyst rate (%) |
|---|---|---|---|
| Fresh Control | 199 | 153 (76.88 ± 0.32)a | 28 (14.07 ± 0.45)a |
| IGF-I 0 | 203 | 128 (63.05 ± 0.98)b | 17 (8.37 ± 1.12)b |
| IGF-I 50 | 212 | 136 (64.15 ± 1.13)b | 20 (9.43 ± 0.86)b |
| IGF-I 100 | 198 | 152 (76.77 ± 1.09)a | 29 (14.65 ± 1.12)a |
| IGF-I 200 | 187 | 121 (64.71 ± 1.25)b | 17 (9.09 ± 1.02)b |
- The superscript letters a, b within columns for a particular parameter differ significantly (p < .05).
- The cleavage rate: number of cleavage embryos/number of COCs observed × 100%.
- The blastocyst rate: number of blastocyst/number of COCs observed × 100%.
4 DISCUSSION
The yak, a seasonally oestrous mammal, provides the principal meat and dairy animal in Qinghai–Tibet plateau. Cryopreservation of yak oocytes has become an essential assistive technology of breeding because that the breeding season of yak ranges from June to August, while the supply season of yak ovaries (the peak season of slaughter) ranges from September to December. To conquer the mismatching problem of these two seasons, various new techniques available for cryopreservation of mammalian embryos and oocytes spring up in recent years, of which the vitrification could afford several advantages over conventional equilibrium methods. Yet, there are still some influences of embryo development in vitro after vitrification. Curcio has demonstrated that oocytes after vitrification could decrease the expression of IGF-I (Curcio & Da, 2014). Moreover, vitrification could decrease blastocyst formation and glucose uptake by activating the glucose transporter (GLUT) and AMPK (Carayannopoulos et al., 2000; Eng et al., 2007). Consequently, there is an urgent necessity to researching and developing more preferable methods of vitrification with few disadvantages so as to improve the reproductive rate of yak.
It is well known that the main challenges of developing cryopreservation procedures are ice crystal formation, cryoprotectant (CPA) toxicity and osmotic stress. In the process of cryopreservation, the embryo cells have to sustain the great physical change of the dehydration as well as the rehydration caused by CPAs permeation. Hence, the cell viability greatly depends on the water and solutes movement transforming between the embryos and the external environment in vitro cultured (Woods, Benson, Agca, & Critser, 2004). The AQP3 channel is a member of the aquaglyceroporins. Several independent investigations have demonstrated that AQP3 is highly expressed in murine embryos at all early developmental stages (Offenberg et al., 2000). The mechanism of channel-mediated trans-cellular water molecule movements in AQP3 proteins within the nascent mice blastocyst cavity establishes the apical and basolateral orientation within the trophectoderm (Offenberg & Thomsen, 2005). Aquaporin 3 is expressed at the basolateral membrane of principal cells in the distal segments of the collecting duct of kidney, while too much AQP3 protein expression can lead to water molecule reabsorption. Water molecule reabsorption contributes to the common fluid overload states found in patients with congestive heart failure or pregnancy (Gobe & Johnson, 2007). In our study, the addition of 100 ng/ml IGF-I significantly enhanced AQP3 gene and AQP3 protein expression after COC vitrification in yak blastocysts, which was not significantly different from the group without vitrification. A 100 ng/ml concentration of IGF-I can promote the formation of the yak blastocyst cavity and enhance the cytomembrane permeability between yak blastocysts and the external environment.
As a significant growth factor, IGF-I has a high expression in mammalian embryos, especially in blastocysts (Pan, Cui, Baloch, et al., 2015). Therefore, it is important to evaluate the role of IGF-I on yak embryo development in vitro after vitrification. Cryopreserve cumulus–oocyte complexes after vitrification are a part of assisted reproductive technologies (ART) and the conventional method for cryopreservation in mammals. Some experiments have demonstrated that IGF-I can contribute to COCs and embryo development. Specifically, the addition of IGF-I in vitrified-warmed mature yak COCs can enhance the expression of CIRP after vitrification and warming (Pan, Cui, He, et al., 2015). Cold-inducible RNA-binding protein is a stress-inducible protein that participates in the cellular response to cold shock, and the expression of CIRP can enhance the adaption of COC vitrification. IGF-I in supplemented medium can reduce the DNA fragmentation index and apoptosis occurrence (the TUNEL index) in bovine blastocysts (Dhali et al., 2011; Makarevich, Kubov, Hegedu, Pivko, & Louda, 2012). Vitrification can induce the TUNEL index in bovine blastocysts, and the CT group can decrease the relative BCL-2, P53 and C-MYC expression levels compared to those in the control group in sheep COCs (Ebrahimi, Valojerdi, Eftekhari-Yazdi, & Baharvand, 2010). IGF-I also enhances the yak sperm warming vitality and the cleavage rate of blastocysts by downregulating the expression level of BAX and upregulating the expression level of BCL-2 (Pan, Cui, Baloch, et al., 2015). In our study, the addition of 100 ng/ml IGF-I to embryo culture media can significantly enhance the BCL-2 gene expression and reduce BAX gene expression after COC vitrification in yak blastocysts, same as the result in porcine pre-implantation embryos (Kim et al., 2010). IGF-I increases the blastocyst rate and total blastocyst cell number in murine embryo culture as well as facilitates the establishment of a stem cell (Lin, Yen, Gong, Hsu, & Chen, 2003). High IGF-I-induced apoptosis is decreased downstream of IGF-I receptor signalling (Chi, Schlein, & Moley, 2000). The DNA fragmentation in the trophectoderm and speed of re-expansion were affected after cryopreservation (Inaba et al., 2016), while the addition of 100 ng/ml IGF-I in embryo culture media enhanced the numbers of ICM and TE after COC vitrification in yak blastocysts in Experiment 2. IGF-I with LIF added to the culture medium was found to be beneficial for bovine embryonic development after vitrification and warming in terms of the cleavage, morula and blastocyst yields (Kocyigit & Cevik, 2015). In conclusion, IGF-I can protect the COCs and embryos after vitrification.
Recently, different vitrification methods for cryopreservation of COCs have been reported in yaks (Pan, Cui, He, et al., 2015), pigs (Uchikura, Matsunari, Nakano, Hatae, & Nagashima, 2016), sheep (Hosseini et al., 2015), rabbits (Lavara, Baselga, Marco-Jimnez, & Vicente, 2015) and mice (Mazur & Paredes, 2016). Vitrification methods include the cryoloop (Lane, Schoolcraft, Gardner, & Phil, 1999), solid surface (Dinnys, Dai, Jiang, & Yang, 2000) and CT methods (Kuwayama, 2007). A lower level of AQP3 gene expression was found in the vitrified-warmed bovine embryos compared with fresh controls (Camargo et al., 2011). In the presence of hypertonic CPA, AQP3 promotes sufficient CPA entry into zebrafish embryos for protection (Hagedorn et al., 2002), while the murine embryos provide an exclusive membrane that inhibits cryopreservation. However, the expression of AQP3 overcomes this barrier. Aquaporin 3 can help accumulate fluid to form a nascent blastocoel cavity (Barcroft et al., 2003). The embryo AQP3 gene expression after vitrification was lower than before vitrification in the 8-cell and blastocyst stages in mice; yet, at the morulae stage, the expression of AQP3 was increased after vitrification (Nong, Liu, Chen, & Wang, 2013). Another experiment demonstrated that immature mouse oocytes were injected with AQP3 cRNA and cultured for 12 hr. After cryopreservation in a glycerol-based solution, 74% of AQP3 cRNA-injected oocytes survived, while none of the water-injected oocytes survived. This showed that artificial AQP3 expression of a water/solute channel in COCs improves its survival after cryopreservation (Edashige, Yamaji, Kleinhans, & Kasai, 2003). Our experiments evaluate whether the addition of IGF-I affects AQP3 and apoptosis-related gene expression after vitrification.
This is the first study to demonstrate the use of IGF-I for yak embryos after yak COC vitrification and fertilization. In this study, we could deduce that the addition of IGF-I could raise the AQP3 gene and protein expression in the yak embryo stage, while this addition might improve cytomembrane permeability and the capacity to form a blastocyst cavity. In the meantime, IGF-I could enhance the BCL-2 gene expression and reduce the BAX gene expression in the yak embryo stage. Conclusively, these alterations of the AQP3 protein expression and BAX and BCL-2 gene expression caused by the addition of IGF-I might have a certain positive effect on the cleavage and blastocyst rates and the numbers of ICM and TE increase in the yak embryo. Thus, the yak embryo might obtain a more superior development by adding an appropriate concentrate of IGF partially depending on this molecular mechanism.
ACKNOWLEDGEMENTS
This study designed by Sijiu Yu and Ping Chen, the analysed data were performed by Ping Chen, Yangyang Pan, Zexing Wen, Penggang Liu, Honghong He, Qin Li, Xiumei Peng and Tian Zhao, drafted paper was performed by Ping Chen, Yangyang Pan and Sijiu Yu and Yan Cui.
CONFLICT OF INTEREST
None of the authors have any conflict of interest to declare.
AUTHOR CONTRIBUTIONS
Sijiu Yu and Ping Chen performed study designed; Ping Chen, Yangyang Pan, Zexing Wen, Penggang Liu, Honghong He, Qin Li, Xiumei Peng and Tian Zhao analysed data; Ping Chen, Yangyang Pan and Sijiu Yu and Yan Cui drafted the manuscript.
