Volume 112, Issue 11-12 pp. 785-807

Free Access

Molecular genetic methods for the diagnosis of fastidious microorganisms^†

FLORENCE FENOLLAR,

FLORENCE FENOLLAR

Unité des Rickettsies, Faculté de Médecine, Université de la Méditerranée, Marseille, France

Search for more papers by this author

DIDIER RAOULT,

Corresponding Author

DIDIER RAOULT

Unité des Rickettsies, Faculté de Médecine, Université de la Méditerranée, Marseille, France

Didier Raoult, Unité des Rickettsies CNRS UMR-6020, Faculté de Médecine, Université de la Méditerranée, 27, Boulevard Jean Moulin, 13385 Marseille Cedex 05, France. E-mail: [email protected]Search for more papers by this author

FLORENCE FENOLLAR,

FLORENCE FENOLLAR

Unité des Rickettsies, Faculté de Médecine, Université de la Méditerranée, Marseille, France

Search for more papers by this author

DIDIER RAOULT,

Corresponding Author

DIDIER RAOULT

Unité des Rickettsies, Faculté de Médecine, Université de la Méditerranée, Marseille, France

First published: 09 October 2008

https://doi.org/10.1111/j.1600-0463.2004.apm11211-1206.x

Citations: 88

^†

Invited Review.

Share a link

Email
Wechat
Bluesky

Abstract

Technological innovations in the detection and identification of microorganisms using molecular techniques such as polymerase chain reaction (PCR) have ushered in a new era with respect to diagnostic microbiology. PCR using universal or specific primers followed by identification of amplified product, mainly by sequencing, has enabled the rapid identification of cultured or uncultured bacteria. Thus, PCR may allow quick diagnosis of infections caused by fastidious pathogens for which culture could be extremely difficult. However, several pitfalls, such as false positives, have been observed with PCR, underlining the necessity to interpret the results obtained with caution. At present, certain improvements in the molecular genetic methods may be helpful for the diagnosis of infectious diseases. Indeed, the recent development of bacterial genome sequencing has provided an important source of potential targets for PCR, allowing rational choice of primers for diagnosis and genotyping. In addition, the development of new techniques such as real-time PCR offers several advantages in comparison to conventional PCR, including speed, simplicity, reproducibility, quantitative capability and low risk of contamination. Herein, we review the general principles of PCR-based diagnosis and molecular genetic methods for the diagnosis of several hard-to-culture bacteria, such as Rickettsia spp., Ehrlichia spp., Coxiella burnetii, Bartonella spp., Tropheryma whipplei and Yersinia pestis.

One of the most important advances in the clinical practice of infectious diseases has been the discovery of nucleic acids (1). The ability to detect and identify the nucleic acid molecules of microorganisms, mainly through nucleic acid amplification by polymerase chain reaction (PCR), has created a powerful means of rapid detection of cultured and uncultured bacteria. Indeed, a limitation of conventional laboratory methods such as culture-based assays is the extremely prolonged times for the fastidious pathogens. The development of molecular microbiology has also been linked to the development of online databases. Of the databases that are available at present, GenBank (2) is the largest and most versatile, containing 32,549,400 DNA sequences as of June 2004. Another useful database is the Genomes OnLine Database (GOLD), which was established in 1997 as a web resource that collects and provides information for all genome projects (3). Using this resource we could establish as of 25 June 2004 that 171 complete prokaryotic genome projects (152 bacterial and 19 archeal) have been published and 508 projects (480 bacterial and 28 archeal) are ongoing. PCR using universal primers followed by sequencing of the amplification products is now available in many laboratories. The notion of a universal bacteria detection and identification system has been proposed by using the 16S rRNA gene, an evolutionary conserved gene seen exclusively in bacterial species (4). By designing primers that are complementary to these regions, the presence of any bacteria can theoretically be established. One significant role for this broad-range PCR has been its use to identify emerging or existing infectious causes of disease. The DNA amplified using this approach may contain sequence information that is phylogenetically specific to unique bacteria when compared with existing genetic databases. For example, sequencing of the 16S rRNA gene amplified via highly conserved sets of primers has led to the identification of Bartonella species in bacillary angiomatosis (5), and Tropheryma whipplei in Whipple's disease (6).

At present, two significant improvements due to more widely available data and to rapid advances in biotechnology allow a new vision of molecular diagnosis. The increasing number of genomes of bacteria being sequenced allows a rational in silico approach to choosing DNA targets for diagnosis and genotyping (7). A significant advance in PCR technology is quantitative real-time PCR in a closed system, in which amplification and detection of amplified products are coupled in a single reaction vessel. This process eliminates the need for post-amplification processing conventionally needed for amplicon detection, and allows for measurement of product simultaneously with DNA synthesis. Two approaches exist for real-time monitoring: the use of fluorescent DNA intercalating dyes which bind non-specifically to double-stranded-DNA generated during amplification and the use of a fluorescent-labeled internal DNA probe which specifically anneals within the target-amplified region (8). Regardless of the format chosen, the internal probe emits a fluorescent signal during each amplification cycle only in the presence of target sequences, with signal intensity increasing in proportion to the amount of amplified products generated. This technique presents several advantages over conventional PCR, including speed, simplicity, reproducibility, quantitative capacity and low risk of contamination.

In this review, we provide an up-to-date look at the general principles of PCR-based diagnosis and at advances within molecular methods for the diagnosis of several hard-to-culture bacteria, such as the bacteria which historically have belonged to the order Rickettsiales (Rickettsia spp., Ehrlichia spp., Coxiella burnetii, Bartonella spp.) (9–12), Tropheryma whipplei and Yersinia pestis.

GENERAL PRINCIPLES OF PCR-BASED DIAGNOSIS

Choice of primers

Initially, the choice of primers was completely empirical. Primers targeting universal gene or genes found at random, or genes coding for known outer membrane protein were used. The recent development of bacterial genome sequencing has provided an important source of potential targets for PCR. Currently, the choice of primers depends on the query in question (Fig. 1).

Strategies for the choice of primers.

Choice of primer for identification

At the genus and species level

The rRNA genes are particularly suitable for such identification purposes as they are ubiquitous to all living bacteria. Thus, for identification at the genus level it is necessary to use broad-spectrum PCR targeting of the 16S rRNA gene (4) or the 23S rRNA gene (13). The DNA amplified using these broad-range approaches may contain sequence information that allows bacterium identification as compared with the existing genetic database (GenBank) (2). The RNA polymerase beta-subunit-encoding gene (rpoB) has been shown to be superior to the 16S rRNA gene for the identification of enterobactia (14), Staphylococcus spp. (15), Streptococcus spp. (16), and identification of spirochetes from the genera Borrelia, Treponema, and Leptospira (17). The superoxide dismutase gene (SOD) also enables the reliable identification to species level of Streptococcus spp. (18, 19). The citrate synthase gene (gltA) is currently used for the diagnosis of rickettsiosis (10, 20), ehrlichiosis (21), and bartonellosis (22).

For specific identification

If only one specific bacterium species is searched, primers designed to specifically amplify this bacterium should be chosen for the PCR assay. In this case, the use of primers targeting specific repetitive elements should be envisaged. The analysis of bacterial genomes has revealed the occurrence of repeated sequences in various species (23). Thus, it has been speculated that targeting repeated sequences would increase the detection sensitivity of PCR. Indeed, for Coxiella burnetii and Tropheryma whipplei, PCR assays targeting repetitive elements are more sensitive (7, 24). A rational strategy for choosing DNA targets when performing PCR assays has been proposed. First, the presence of repeated sequences must be searched in priority within the bacterial genome of interest. Second, the in silico specificity must be verified by comparing the chosen sequences with all sequences available in Genbank. Third, the in vitro sensitivity must be verified with repeat-PCR and regular-PCR using DNA extracted from 10-fold dilutions of a suspension of the targeted bacterium. Fourth, the in vitro specificity must be tested using DNA extracted from a large bank of several bacteria. Finally, the in vivo specificity and sensitivity must be verified on human samples. PCR targeting outer membrane protein (OMP) genes could also be used because these antigenic proteins are highly specific. This approach has been applied for Brucella spp. (25), Chlamydia spp. (26, 27), Neisseriameningitidis (28), Rickettsia spp. (12, 29–31) and Ehrlichia spp. (32).

Choice of primers for epidemiology

Following bacterial identification, it is sometimes critical to determine whether one or more isolates are of the same strain. This strain typing in investigations of disease outbreaks, antibiotic resistance, nosocomial infections or suspected bioterrorism attacks requires the use of appropriate tools.

16–23S rDNA spacer (ITS)

In many bacterial species, including Tropheryma whipplei and Bartonella spp. (33–37), the intergenic 16S-23S rDNA spacer has been shown to have great variability, not only in its sequence and length but also in the number of alleles per genome (38, 39). However, sequencing of the 16S–23S rDNA sequence of various strains of C. burnetii revealed very high levels of sequence similitary (>99%) although they had different geographic origins and phenotypic characteristics (40). Thus, ITS could be used for identification of the bacterium but is not applicable to epidemiology studies. In addition, studying the 16S-23S rDNA spacer of rickettsiae is not possible as the 16S rRNA gene is separated from the 23S and 5S rRNA genes, which are tightly held together (41).

Multilocus locus sequence typing (MLST)

Multilocus locus sequence typing (MLST) is a molecular typing method based on the comparison of nucleotide sequences of 450–500 bp internal fragments of a number (usually seven) of housekeeping genes (42, 43). For each gene, the different sequences obtained are assigned as alleles; alleles at the seven loci provide an allelic profile, allowing nonambiguous determination of sequence type (42). MLST was first developed for Neisseiria meningitidis (42, 43) and Streptococcus pneumoniae (42, 44). It has now been described for numerous other human pathogens, including B. henselae (45).

Multi spacer typing (MST)

Intergenic sequences are more variable than gene sequences. Thus, a new molecular typing method based on primers targeting the sequences of intergenic zones (spacers) has recently been proposed to develop a single and reproducible genotyping method based on highly polymorphic sequence regions. This genotyping strategy has been successfully applied for the first time to the analysis of Yersinia pestis DNA isolates and further applied to dental pulp collected from individuals attributed to the first and second pandemics of plague (46).This new typing technique has been named multi spacer typing (MST).

Variable number tandem repeat (VNTR)

Repeats representing a single locus and showing inter-individual length variability are designated as variable number of tandem repeats (VNTR) (47). Changes in the number of repeats in a given genetic locus are an important source of DNA variability in eukaryotes (48). Most bacterial genomes examined also contain numerous VNTRs and, in combination, have been used to develop a PCR-based marker typing system in bacteria (35, 49–51).

Genome level-informed PCR (GLIP)

A new approach, based on the hypothesis that deletions can be detected by a single round of genomic microarray, has been shown to provide useful strain-specific markers during a tuberculosis outbreak (52). Mycobacterium tuberculosis strain CH, the index isolate linked to a major tuberculosis outbreak, was characterized by microarray analysis using a PCR product array representative of the genome of M. tuberculosis strain H37Rv. Seven potential genomic deletions were identified in CH, five of which were confirmed by PCR analysis across the predicted deletion points. The panel of five PCRs required to individually interrogate these loci was collectively referred to as the genome level-informed PCR (GLIP) assay. All the outbreak-linked isolates showed a profile corresponding to the presence of all five deletions and none of the non-outbreak-associated isolates exhibited the five-deletion profile.

Specificity

The widespread use of PCR has been hampered largely by background contamination from exogenous sources of DNA. Despite the fact that this risk can be lowered by following strict rules in the laboratory, even single-use plasticware tubes have been shown to be contaminated with human DNA (53). In our laboratory, we have processed more than 6,000 specimens in 5 years using 16S rRNA PCR and observed a 5–7% rate of contamination. As for cardiac valves, the contamination rate was 18.7%, in agreement with published data (54, 55). The sources of contaminant microbial DNA may be vertical contamination from tubes, pipettes, laboratory surfaces, technician's hair or clothes, and caused by previous amplicons in the laboratory (53). PCR may also be subject to lateral contamination during the assay, i.e. cross-contamination from one positive sample to another (carryover). Besides, when using broad-spectrum PCR (such as 16S rRNA PCR), contaminant bacterial DNA from water and reagents can be amplified. This contamination generally involves α and γ proteobacteria. In our experience, bacterial species previously amplified in the laboratory or present in water and reagents used for DNA extraction caused most of the observed contamination. To prevent contamination, it is thus necessary to carefully follow standard recommendations (Fig. 2).

Risks of PCR contamination and their prevention.

Negative controls

The introduction of negative controls helps to detect PCR contamination. Samples must be separated every five samples by a negative control, including water and DNA extracted from human control tissue (intestinal, cardiac valve, cutaneous specimen) (56). These negative control samples should be subjected in parallel to the same process with the tested samples (i.e. from DNA extraction to assay run).

Sources of contamination and solutions

Vertical contamination

Since vertical contamination with previous amplicons is a highly probable source of contamination, PCR and post-PCR experiments should be performed in separate rooms using disposable equipment and newly prepared reagents that have been irradiated with ultraviolet light (56). Bench workers should wear disposable caps, gloves and coats. In closed-system real-time PCR assays, amplification and product detection are carried out in the same reaction vessel, allowing a substantial reduction of the risk of contamination with previously amplified material. Finally, as PCR can produce millions of copies of potentially contaminant target DNA, we – and others – advocate running experiments with very high significance without using a positive control. The presence of a positive control is useful only for the validity of negative results. With this aim we have set up a “suicide-PCR”, which is a nested-PCR performed using single-use primers targeting single-use gene fragments, never before used in our laboratory, without including any positive control to avoid contamination (57, 58). Thus, this assay is highly specific and prevents the risk of vertical contamination from previous amplifications because the targeted sequence is used for the first time in the laboratory with no possible risk of contamination with previously amplified DNA (57). At present, analyses of the complete sequences of genome have provided a wide choice of potential targets and have improved the versatility of “suicide-PCR”. Vertical contamination can be controlled by the use of the uracil-DNA-glycosylase/dUTP approach (59, 60) and commercial diagnostic tests using this system are currently available (53). In all PCR products, dUTP is incorporated substituting dTTP. All subsequent fully preassembled starting reactions were treated with uracil DNA glycosylase (UDG), followed by thermal inactivation of UDG. UDG cleaves the uracil-containing DNA, but has no effect on natural (i.e., thymine-containing) DNA. The resulting apyrimidinic sites block replication by DNA polymerases. Contamination of PCRs can be controlled effectively if the contaminants contain uracils instead of thymines (59, 60). This approach is limited by the possibility of poor PCR efficiency (53). Besides, UDG is not completely inactivated at the elevated temperature (53). So, following thermal cycling, prolonged incubation at either 4 °C or 25 °C increases the risk of degradation (53).

Horizontal contamination

As horizontal contamination or carryover may also be a significant source of cross-contamination, it is important to strictly apply basic rules such as changing cotton-filtered tips between each specimen. Closed-system real-time PCR assays are also preferable to regular PCR assays to prevent carryover contamination. To detect a problem with contamination from the positive control, we usually try to use as positive control a bacterium from the same species as those searched but which are not usual pathogens, such as Rickettsia montanensis for rickettsiosis and Bartonella elizabethae for bartonellosis.

Bacterial DNA in reagents

Contamination in PCR-reagent mixtures is often linked to aquatic bacteria. This is particularly a problem for broad-spectrum PCR targeting the 16S rRNA gene. A pretreatment protocol is then necessary. Several kinds of enzymes for destroying DNA in PCR-reagent mixtures have been described, such as Dnase I, exonuclease III, and restriction enzymes (59). DNA is degraded whereas other components such as the Taq polymerase remain unaffected. After inactivation of the nucleases by heating, target DNA must be added. This implies that tubes have to be reopened, which increases the risk of environmental contamination. In our laboratory, to avoid the risk of misinterpretation of PCR results due to contamination, two different PCR assays with independent targets are performed for the tested sample. Both PCR performed with both set of primers must be positive to conclude that the test is positive (56). Interpretative guidelines based on the correlation of test results with clinical presentation will be required before a definitive diagnosis can be reached.

Neighboring contamination

Several examples show that it is also very important to know how the specimens have been sampled and to be aware of all activities taking place in other laboratories within the same building. Bordetella pertussis false-positive PCR was linked to the fact that the B. pertussis vaccinations were given in rooms located just beside the examination rooms where patient samples were taken for diagnostic purposes (61). Thus, contamination was due to droplets from a whole-cell pertussis vaccine. Cytomegalovirus (CMV) false-positive PCR results have also been linked to contamination from a laboratory situated one floor below the PCR laboratory, where CMV culture material was autoclaved before disposal (62). It turned out that the autoclaved positive material included small DNA fragments that were contaminating the environment and may have produced positive signals in the PCR assays. Another problem with contamination of a diagnostic test in which PCR was used to detect TEM β-lactamases in clinical isolates has been described in the literature (53). At a certain time, all negative controls started to become false positive. Extensive cleaning of the working areas and the use of new reagents could not resolve this problem. A research group sharing the same laboratory areas were using cloning- and expression systems for the production of proteins and the vector applied in their systems contained a commonly used ampicillin-resistance selection marker, which is a TEM β-lactamase gene. No one realized that the protein preparations were highly contaminated with vector-associated DNA. All these examples lead us to the conclusion that communication is very important, especially in larger laboratories where several research groups are using the same rooms and equipment.

Interpretation of positive results

Identification of a microorganism requires a minimum amount of sequence information, extensive controls and careful attention to sequence alignments and analysis. Amplicons could be analyzed, whether by agarose gel electrophoresis, restriction fragment length polymorphism analysis, direct sequence determination or hybridization of a specific oligonucleotide probe (63). However, amplified bands of appropriate fragment length may be nonspecific and it is important to perform a second identification step to confirm this result. In reality, to control the specificity of an amplified product, identification of bacteria must be based on the sequencing or hybridization techniques of the different genes that are used for detection. As PCR may detect bacteria at concentrations below those of previously established gold standard reference methods, distinguishing whether this result represents a false-positive finding, and establishing the clinical significance of this finding, is challenging. Thus, for each PCR assay, the positive and negative controls must be correct to validate and interpret the PCR results. If there is any doubt regarding a positive PCR result, it should be confirmed by using a PCR targeting another gene or in another laboratory.

SensitivityDNA extraction

Various chaotropic, enzymatic, or thermal methods of cell lysis to effectively liberate microbial DNA content are available, such as the phenol/chloroform/ethanol method, Chelex suspension (Biotechnology-grade chelatin resin-Chelex 100; Bio-Rad, Richmond, CA, USA), QIAamp DNA binding columns (QIAGEN, Hilden, Germany), and MagNA Pure LC instrument and DNA Isolation Kit (Roche Molecular Biochemicals, Manheim, Germany) (63, 64). Efforts to secure improvements may have to be individually adjusted based on the assay's clinical application and the bacterium concerned.

Positive control

The use of positive control (extracted bacterial DNA) during PCR assay allows us to be sure that the PCR process was correct. In addition, when using quantitative real-time PCR, the quantification of the sensitivity level has been established. The sensitivity level of each PCR assay must then always be retrieved to validate the PCR process.

Detection of the efficiency

The sensitivity of standard PCR amplification using clinical specimens may be reduced by several factors, including small sample volume permissible for PCR reactions, poor DNA recovery after extraction and purification steps, presence of DNA inhibitors, DNA degradation during sample transport, and antibiotic therapy prior to sampling. The efficiency of DNA extraction and the absence of inhibitors in the samples could be tested by amplifying a fragment of a human gene such as β-globin, HLA-DQA, or insulin growth factor II (63).

Inhibitors

The usefulness of PCR-based detection of microorganisms in biological samples is limited in part by the presence of substances that inhibit the PCR or reduce the amplification efficiency. A number of components are well known to be PCR inhibitors, namely, bile salts and complex polysaccharides in feces (65), heme in blood (66), proteinases in milk (67), urea in urine (68), and sodium polyanetholesulfonate (SPS), a common additive to blood culture media (69). Since PCR may be limited by the presence of inhibitors in biological samples, different pre-PCR treatments could be used to reduce their effects. At present, one of the most efficient is bovine serum albumin (BSA), which enhances the amplification capacity (70).

MOLECULAR DIAGNOSIS OF HIGHLY FASTIDIOUS BACTERIA

Rickettsia sp.

Bacteria (including molecular characterization)

Rickettsiae are strictly intracellular parasites. The genus Rickettsia was subdivided into three subgroups: the typhus group (TG), the spotted fever group (SFG), and the scrub typhus group (STG). Rickettsia tsutsugamushi, the only member of the STG, has recently been reclassified in a new genus and is now named Orientia tsutsugamushi (71). Rickettsial genome sizes are small and consist of a single circular chromosome (72, 73). The complete 1.1 Mb genome of R. prowazekii, which is currently considered a potential warfare agent, and the 1.3 Mb genome of R. conorii have been sequenced (72–74). The genome of R. conorii exhibits 804 of the 834 genes of the previously determined R. prowazekii genome plus 552 supplementary open reading frames and a 10-fold increase in the number of repetitive elements. Despite this difference, the two genomes exhibit a nearly perfect colinearity that has allowed the clear identification of different stages of gene alterations with gene remnants and genes splits (73). Their analyses have also revealed the original occurrence of a previously undescribed palindromic repeat throughout the genome (72). This repeat was found inserted in-frame within different open reading frames likely to encode functional proteins. The finding of a mobile element inserted in many unrelated genes has suggested the potential role of selfish DNA in the creation of new protein sequences.

Clinical aspects

Most human rickettsiosis is diagnosed on the basis of clinical evidence in association with careful examination and epidemiological investigation of patients (75–77). The signs and symptoms of rickettiosis currently recognized are summarized in Table 1.

Table 1. Clinical symptoms, etiological agent and distribution of currently recognized rickettsiosis

Disease	Etiological agent	Arthropod associated	Distribution	Rash presence (% of subjects)	Eschar (% of subjects)	Local nodes	Mortal- ity (%)
RMSF¹ MSF² Astrakhan spotted fever Israeli spotted fever Rickettsialpox Queensland tick typhus Flinders Island spotted fever Japanese spotted fever African tick bite fever Siberian tick typhus TIBOLA LARD Unnamed spotted fever Unnamed spotted fever Epidemic typhus Murine typhus Scrub typhus	R. rickettsii R. conorii R. conorii complex R. conorii complex R. akari R. australis R. honei R. japonica R. africae R. sibirica R. slovaca R. mongo- lotimonae R. helvetica R. aeschli- mannii R. prowa- zekii R. typhi O. tsutsu- gamushi	Dermacentor spp. Rhipicephalus sanguineus Rhipicephalus pumilo Rhipicephalus sanguineus Allodermanyssus spp. Ixodes holocyclus ? Haemophysalis spp. Amblyoma spp. Dermacentor spp. Dermacentor marginatus Hyalomma asiaticum Ixodes ricinus Hyalomma marginatum Pediculus humanus corporis Xenopsylla cheopsis Leptotrombidium deliense	America Mediterranean countries Astrakhan Israël United States, Ukraine, Slovenia Australia Tasmania Japan Africa Siberia, Russia, China Slovakia, France, Portugal Mongolia, France Switzerland, France Morocco, South Africa Worldwide Worldwide Asia, Pacific	90 97 100 100 100 100 85 100 30 100 ? Yes ? Yes 40 50 50	Very rare 72 23 No 83 (ME³) 65 28 48 100 (ME) 77 Yes Yes ? Yes No No Yes	No Rare No No Yes Yes Yes No Yes Yes Yes Yes No ? No No Yes	1–5 1 No <1 Low Low Low Low Very low Low No No Yes No 2–30 Low 2–5

¹ =RMSF: Rocky Mountain spotted fever;
² =MSF: Mediterranean spotted fever;
³ =Multiple eschars.

Molecular diagnosis

Because of the nonspecific clinical manifestations of rickettsial diseases, laboratory testing is necessary to confirm the diagnosis. Usually, the microbiological diagnosis relies upon serology. However, although highly reliable, this technique provides only indirect evidence of infection, and antibodies are absent in the early phase of the disease. Besides, the isolation of rickettsiae organisms must be done in cell culture only in biosafety level 3 laboratories due to their extreme infectivity. Several samples can be used for the diagnosis of rickettsiosis by PCR, such as blood sample, biopsy specimens of the eschar, and arthropods (ticks, flea, lice) (78–81). This specimen collection should be carried out as early as possible in the course of the illness. Fresh tissues are preferred for PCR amplification but paraffin-embedded tissues and even slide-fixed specimens may be useful (82). Blood must be obtained on EDTA or sodium citrate for PCR diagnosis because heparin inhibits PCR and is difficult to neutralize. Molecular detection in serum could also be realized but since a lack of sensitivity was observed using regular PCR, we performed “suicide-PCR” on sera (57). This technique has also shown itself to be useful when used on eschar biopsies taken prior to antibiotic therapy (58). Classically, detection strategies based on recognition of sequences within the 16S rRNA gene (11), and those encoding a 17-kDa protein (83, 84), citrate synthase (gltA) (29, 85, 86), the Rickettsia-specific outer membrane protein (rOmpB) (29, 31) the Rickettsia-specific outer membrane protein (rOmpA) (for SFG rickettsiae) (12, 87), and the gene D which encodes a surface-exposed high-molecular-weight PS120 (32) have been described. In our laboratory, amplification of the rOmpA and gltA genes is routinely used. Molecular identification of Rickettsia sp. should be based on the sequencing or hybridization techniques of the different genes that are used for detection. It should be noted that the relation between R. helvetica and human disease has only been suggested by positive PCR results (88). No isolates have been obtained from human samples. Thus, these data must be confirmed. A recent study carried out in our laboratory has shown the usefulness of MST for strain genotyping of R. conorii (unpublished data).

Ehrlichia spp.

Bacteria

The ehrlichiae are obligate intracellular bacteria which infect phagocytic bone marrow-derived cells in mammalian hosts (89, 90). Until recently, morphological and epidemiological features classified the ehrlichiae. Recent genetic analyses of 16S rRNA genes, groESL and surface protein genes have indicated that the existing taxon designations are flawed and have resulted in the recent reclassification of several species previously known as erhlichiae (91). Therefore, it has been proposed that all members of the tribes Ehrlichieae and Wolbachieae be transferred to the family Anaplasmataceae and that the tribe structure of the family Rickettsiaceae be eliminated. The genus Anaplasma has been emended to include Anaplasma (Ehrlichia) phagocytophilum (which also encompasses the former E. equi and the human granulocytic Ehrlichiosis), Anaplasma (Ehrlichia) bovis and Anaplasma (Ehrlichia) platys, the genus Ehrlichia has been emended to include Ehrlichia (Cowdria) ruminantium and the genus Neorickettsia has been emended to include Neorickettsia (Ehrlichia) risticii and Neorickettsia (Ehrlichia) sennetsu. The genome sizes are small, from 0.8 to 1.6 Mb (92). The entire genome of A. phagocytophilum has now been sequenced.

Clinical aspects

The clinical and epidemiological characteristics of the main ehrlichioses are summarized in Table 2 (93–98).

Table 2. Main clinical and epidemiological characteristics of human ehrlichiosis

Characteristics	Sennetsu fever	Human monocytic ehrlichiosis	Human granulocytic ehrlichiosis or anaplasmosis
Etiological agent Vector Reservoir Geographic distribution Tick bite	Neorickettsia sennetsu Grey mulet fish Not known Japan No	Ehrlichia chaffeensis Amblyomma americanum White-tailed deer USA Yes	Anaplasma phagocytophilum Ixodes spp. Small mammals USA, Europe Yes
Fever Rash Headaches Myalgia Arthralgia Sweats Adenopathy Hepatomegaly Splenomegaly	+++ − + + +/− +/− +++ ++ ++	+++ ++ (child) + + +/− +/− ++ + +	+++ ? +++ ++ ++ ++ +/− +/− +/−

Molecular diagnosis

PCR was the first diagnostic tool (with blood smear examination) developed for the diagnosis of human ehrlichiosis. Peripheral blood or bone marrow is the sample of choice. Blood should be collected in EDTA or citrate anticoagulant. The most widely used target is the gene encoding the 16S rRNA. For E. chaffeensis, primers HE1 and HE3, which define a 389-bp product located near the 5′ end of the 16S rRNA gene, are largely used for the detection of this pathogen (99–101). For the diagnosis of anaplasmosis, the initial PCR assay used the specific primer set ge9f/ge10r, which amplifies a 919-bp DNA sequence in the 16S rRNA gene (102). Other recently described tools for molecular phylogenetic studies of Ehrlichia spp. and Anaplasma spp. include amplification of gltA (citrate synthase) (21), rpoB (RNA polymerase β subunit) (103), GroESL (heat shock operon) (104) and ftsZ (the cell cycle component gene) (105). Targets unique to A. phagocytophilum are also increasingly employed, such as ankA (previously called epank1), which encodes a 160 kDa cytoplasmic protein and msp2, also called p44 or hge-44, which encodes the 40 to 49 kDa major immunodominant surface protein of A. phagocytophilum (30, 106). Moreover, evidence shows that both of these genes exist in multicopies and many more paralogs may exist for msp2. Molecular identification of Ehrlichia spp. should be based on the sequencing or hybridization techniques of the different genes used for detection. At present, no genotyping work on Ehrlichia using VNTR, MLST or MST has been performed.

Coxiella burnetii

Bacteria (including molecular characterization)

C. burnetii is a short, pleomorphic rod, intracellular bacterium (107). On the basis of molecular phylogeny, C. burnetii has been replaced in the γ subgroup of Proteobacteria near Legionella pneumophila (108). This bacterium is currently considered as a potential warfare agent (109). The sequencing of the complete genome of C. burnetii Nine Mile phase I revealed a 1.9 Mb genome which encodes 2,094 predicted protein-coding genes (110). Previously uncharacterized genes implicated in adhesion, invasion, intracellular trafficking, host modulation, detoxification, and other virulence-related functions have been identified. Notably, a previously uncharacterized 13-member family of ankyrin repeat-containing proteins has been observed and may be implicated in host-cell attachment. Genome analysis has also revealed the presence of pseudogenes, indicating plasticity and ongoing genome degradation.

Clinical aspects

C. burnetii is the agent of Q fever, a worldwide zoonosis (111). The most commonly identified sources of human infections are cattle, goats and sheep. Organisms can be excreted by these mammals in urine, feces, milk, and especially in birth products (112). Humans are infected by inhalation of contaminated aerosols. Q fever may occur either in an acute or in a chronic form. In acute infection, the clinical signs are often mild (113). A self-limited flu-like syndrome, pneumonia or hepatitis can be observed. The main clinical presentation of chronic form is represented by blood culture-negative endocarditis, which occurs usually in patients with previous valvular damage after an episode of Q fever. Acute or chronic forms of Q fever have been reported in pregnant women. Most of the cases are asymptomatic but complications may be observed, such as in utero fetal death or hypotrophia (114).

Molecular diagnosis

Usually, the microbiological diagnosis of Q fever relies upon serology. However, although highly reliable, this technique only provides indirect evidence of infection, and antibodies are absent in the early phase of the disease. In addition, the isolation of C. burnetii must be done in cell culture only in biosafety level 3 laboratories due to its extreme infectivity. PCR has been successfully used to detect C. burnetii DNA in various clinical samples, including cardiac valves or vascular aneurysm biopsies, liver biopsy, milk, placenta, fetal specimens, ticks and blood samples (115). Blood can be obtained using EDTA, sodium citrate or serum. Various genes and derived primers are available for PCR detection of C. burnetii (Table 3), even in paraffin-embedded tissues (82, 115). In our laboratory, we routinely use primers derived from the htpAB-associated repetitive element (24, 116). This element exists in at least 19 copies in the C. burnetii Nine Mile I genome, and PCR based upon this gene is very sensitive (24). Recently, a rapid nested PCR called LightCycler Nested-PCR (LCN-PCR), that uses serum sampled early during the disease as a specimen and the LightCycler as a thermal cycler, has been compared to serology by indirect immunofluorescence for the diagnosis of acute Q fever (117). In the LCN-PCR assay, the two pairs of primers had different hybridization temperatures, reaction tubes, were not opened during the whole amplification process preventing amplicon carryover, and we used one of the Light-Cycler's advantages, i.e., its rapidity, since both amplification and reamplification were performed whithin 90 min. The LCN-PCR presents a specificity of 100% and a sensitivity of one C. burnetii DNA copy. The sensitivity was 26% when the serology was negative but only 5% with seropositive patients. The method was more efficient in the 2 first weeks following onset of symptoms, when its sensitivity was 24% compared with 14% for serology. Thus, this PCR assay performed on sera may help reduce the delay in diagnosing early acute Q fever during outbreaks or in the case of bioterrorism attack. Genotyping of C.burnetii based on MST strategy is ongoing in our laboratory.

Table 3. Genes and derived primers available for PCR amplification of Coxiella burnetii

Gene	Primers (sequences)	Ref(s)
16S rRNA 23S rRNA 16S-23S rRNA internal transcribed spacer Superoxide dismutase Plasmid QpRS Plasmid QpH1 CbbE HtpAB IS 11–11	16S1 (5′-CTC CTG GCG GCG AGA GTG GC-3′) 16S2N (5′-GTT AGC TTC GCT ACT AAG AAG GGA ACT TCC C-3′) 976F (5′-AGG TCC TGG TGG AAA GGA ACG-3′) 1446R (5′-TCT CAT CTG CCG AAC CCA TTG C-3′) 16SF (5′-TTG TAC ACA CCG CCC GTC A-3′) 23SR (5′-GGG TT (CGT) CCC CAT TCG G-3′) 16SS (5′-GAA GTC GTA ACA AGG TA-3′) 23SS (5′-TCT CGA TGC CAA GGC ATC CAC C-3′) CB1 (5′-ACT CAA CGC ACT GGA ACG GC-3′) CB2 (5′-TAG CTG AAG CCA ATT CGC C-3′) QpRS01 (5′-CTC GTA CCC AAA GAC TAT GAA TAT ATC-3′) QpRS02 (5′-CAC ATT GGG TAT CGT ACT GTC CCT-3′) QpH11 (5′-TGA CAA ATA GAA TTT CTT CAT TTT GAT-3′) QpH12 (5′-GCT TAT TTT CTT CCT CGA ATC TAT GAA T-3′) G4131 (5′-CTG ATG TGT CAA GTA ATG TCG G-3′) G4132 (5′-CTT CAT GGT TAT GAT TCT GCG-3′) Trans1 (5′-TAT GTA TCC ACC GTA GCC AGT C-3′) Trans2 (5′-CCC AAC AAC ACC TCC TTA TTC-3′) Trans 3 (5′-CAACTGTGTGGAATTGATGAG-3′) Trans 5 (5′-GCGCCATGAATCAATAACGT-3′)	(175) (176) (177) (40) (115) (175) (175) (175) (175) (24)

Bartonella species

Bacteria

Members of the genus Bartonella are fastidious organisms within the α2 subgroup of the class of proteobacteria (118). They have a close evolutionary homology with members of the genera Brucella, Agrobacterium, and Rhizobacterium. The Bartonella species grow on axenic medium enriched on blood with 5% CO₂ but can also grow in broth with fetal calf serum and in cell culture. All Bartonella sp. grow slowly on blood agar, with primary isolates appearing after 15 days but sometimes requiring 45 days to be visible. The genus Bartonella contains 19 species, most of which have been reclassified from the genus Rochalimea (B. quintana, B. henselae, B. elizabethae, and B. vinsonii) and from the genus Granhamella (B. talpae, B. peromysci, B. grahamii, B. taylorii, and B. doshiae) (118). B. bacilliformis was the first reported in 1909, and before recent taxonomic changes it was the only member of the genus. The 1.6 Mb genome of B. quinatana was recently sequenced and found to be a derivate of the larger 1.9 Mb genome of B. henselae, with the main difference among the two species residing in the absence of genomic island in the trench fever agent (119).

Clinical aspects

Until recently there were only two recognized human diseases caused by Bartonella spp.: Trench fever due to B. quintana and Carrion's disease caused by B. bacilliformis (120). Since then, Bartonella spp. have been recognized as causative agents of further human diseases, which are summarized in Table 4 (120).

Table 4. Bartonella and related clinical infections in humans

Disease	Clinical presentation	Species involved
Carrion's disease Oroya fever Verruga peruana	Acute febrile hemolytic anemia Exophytic or miliary skin eruption	B. bacilliformis
Chronic bacteremia	Fever, headache, leg pain, thrombocytopenia	B. quintana
Endocarditis	Blood culture-negative endocarditis	B. quintana B. henselae B. elizabethae B. vinsonii
Trench fever	Relapsing fever	B. quintana
Bacillary angiomatosis	Red and papular cutaneous lesion	B. quintana B. henselae
Bacillary peliosis	Abdominal pain, fever, hepatosplenomegaly	B. henselae
Cat scratch disease	Lymphadenopathy	B. henselae

Molecular diagnosis

Several samples can be used for the diagnosis of bartonellosis by PCR: blood, lymph node biopsy, cardiac valve specimen, hepatic biopsy, spleen biopsy, and cutaneous biopsy of skin lesions. Blood can be obtained using EDTA, sodium citrate or serum. Fresh tissues are preferred for PCR amplification but paraffin-embedded tissues may be used (121). Detection strategies based on recognition of sequences within the 16S rRNA gene have been applied in early work (122, 123). However, the 16S rRNA gene of Bartonella spp. shares more than 97.8% similarities and differences between them are not sufficient for confident species discrimination. New targets have been successfully used to detect Bartonella spp. from clinical samples such as the citrate synthase gene (gltA) (22, 124), the 16S-23S rRNA intergenic spacer region (ITS) (125–127), the riboflavin synthase α chain gene (ribC) (128, 129), the heat shock protein (groEL) (130, 131), the RNA polymerase beta-subunit-encoding gene (rpoB) (132), the gene encoding the PAP31 and 35-kDa proteins (133, 134), and the cell division protein gene (ftsZ) (135). As the gene encoding the PAP31 is present in multicopy, the PCR targeting this gene is more sensitive. Molecular identification of Bartonella spp. should be based on the sequencing or hybridization techniques of the different genes that are used for detection. A new tool has recently been proposed for the diagnosis of Bartonella endocarditis by real-time nested PCR assay performed on a LightCycler apparatus (LCN-PCR) using serum (136). This LCN-PCR is a valuable tool that could shorten the delay in the diagnosis of Bartonella endocarditis. Moreover, it has been suggested that this technique might be useful for other systemic Bartonella infections, in particular, chronic bacteremia, bacillary angiomatosis, peliosis hepatitis, and cat scratch disease with visceral involvement. A MLST strategy has been realized for B. henselae, enabling the identification of 7 sequences types among a total of 37 human and feline isolates (45). Using a MST strategy based on 4 intergenic spacers, 5 genotypes of B. quintana have been identified among a total of 71 human and lice isolates and 10 human and lice PCR-positive samples (unpublished data). However, the strain variants suggested by the spacer sequence did not correlate with the results of pulsed-field gel electrophoresis (PFGE), which suggests a higher degree of genomic variability. Modification of the PFGE profile of an isolate after subculture confirmed that rearrangement frequencies are high in this species, making PFGE unreliable for epidemiological purposes (unpublished data).

Tropheryma whipplei

Bacteria (including molecular characterization)

For a long time the etiology of Whipple's disease was unknown. In 1991, Wilson sequenced for the first time an original fragment of 16S rRNA from a patient with Whipple's disease (6). One year later, these data were confirmed (137) and the bacterium was named «Tropheryma whippelii». In 2001, after the first culture and characterization of the bacterium, the bacterium was officially named Tropheryma whipplei (138). The genome of two different strains of T. whipplei has recently been entirely sequenced (139). Sequencing of T. whipplei Twist and sequencing of T. whipplei TW08/27 revealed a 0.92 Mb genome which encodes 808 and 784 predicted protein-coding genes, respectively (139, 140). T. whipplei presents a unique circular chromosome and is the only known reduced genome species (<1 Mb) within the Actinobacteria (139, 140). The two genomic sequences of the two strains are mostly (>99% identical at the nucleotide sequence level), and encode quasi-identical gene complements. One of the specific genome features includes deficiencies in amino acid metabolisms. This information has allowed the design of a comprehensive medium, supplemented with amino acids, in which T. whipplei grows axenically (141). The alignment of the two-genome sequences revealed a large chromosomal inversion, the extremities of which are located within two paralogous genes (140). These genes belong to a large cell-surface protein family defined by the presence of a common repeat highly conserved at the nucleotide level. The repeats appear to trigger fragment genome rearrangements in T. whipplei, potentially resulting in the expression of different subsets of cell-surface protein (140). This phenomenon might represent a new mechanism developed to evade the host's immune response during the course of this chronic disease.

Clinical aspects

The clinical picture of Whipple's disease is often polymorphic and nonspecific (142). In the past, Whipple's disease was often considered responsible for diarrhea. It is now established that nearly every organ system (especially the heart and central nervous system) can be involved without gastrointestinal involvement. The initial complaint is mostly arthralgia.

Molecular diagnosis

One of the limits of the histological analysis of biopsies using the periodic acid-Schiff staining is the lack of specificity (142). PCR assays could be carried out on various biopsies (duodenum, adenopathy, cardiac valve, brain, synovial biopsy), liquid samples (cerebrospinal fluid, joint fluid, aqueous humor), blood, saliva or stools (63). The DNA extraction is a clue step and different protocols have been proposed (63), which could be applied to fresh samples or included in paraffin. PCR targeting the 16S rDNA sequence was the first molecular tool for the diagnosis of Whipple's disease. Before the genome sequencing, the other available sequence targets were the intergenic region 16S-23S, the 23S rDNA, the gene RpoB or the gene hsp65 (63, 143). The availability of the genome has offered the possibility of choosing rationally DNA targets. Indeed, a real-time PCR assay targeting repeated sequences of T. whipplei performed in samples from patients with Whipple's disease and in a control group has allowed the significant enhancement of PCR sensitivity without altering its specificity as compared to regular PCR (7). All the primers available and published for the specific diagnosis of Whipple's (except those targeting the 16S rDNA sequence) are summarized in Table 5. The identification of T. whipplei should be confirmed with sequencing techniques or hybridization. The main problem with PCR is that of specificity, notably due to the studied samples. Indeed, some divergences have been observed between laboratories. Positive results have been reported in saliva, gastric liquids and duodenal biopsies in patients without suspicion of Whipple's disease (142, 144). It is of note that in a study of 40 healthy people, 35% showed evidence of T. whipplei DNA in their saliva by using PCR (145). However, in this work, the use of negative controls was not precise and only six amplified products have been sequenced to confirm the identification. Furthermore, these data have not been confirmed by other teams (142, 143). Therefore, we recommend for the definite molecular diagnosis of Whipple's disease, notably for atypical cases, the use of at least two pairs of primers targeting two different sequences to avoid false positives. Genotyping could be performed using the 16S-23S interregion and the 23S rRNA gene (146–148). The existence of two genomes allowed a MST strategy for T. whipplei genotyping which is currently ongoing in our laboratory.

Table 5. Genes and derived primers available for Tropheryma whipplei

Primers Forward/Reverse	Primers sequences Forward/Reverse	Gene target	Ref (s)
tws3,f/ tw1857r1 tw1662f/ tw1857r1 tws1,f/ tws2,r tws3,f/ tw1857r1 tws3,f/ tws4,r TW-23InsF/ TW-23InsR2 Whipp-frw1/ Whipp-rev Whipp-frw2/ Whipp-rev TwrpoB.F/ TwrpoB.R 53.3F 53.3R	5′CCGGTGACTTAACCTTTTTGGAGA3′/ 5′TCCCGAGCCTTATCCGAGA3′ 5′ACTATTGGGTTTTGAGAGGC3′/ 5′TCCCGAGCCTTATCCGAGA3′ 5′ATCGCAAGGTGGAGCGAATCT3′/ 5′CGCATTCTGGCGCCCCAC3′ 5′CCGGTGACTTAACCTTTTTGGAGA3′/ 5′TCCCGAGCCTTATCCGAGA3′ 5′CCGGTGACTTAACCTTTTTGGAGA3′/ 5′CTCCCGTGAGCTTGTGCCCAAAC3′ 5′GGTTGATATTCCCGTACCGGCAAA G3′/ 5′GCATAGGATCACCAATTTCGCGCC3′ 5′TGACGGGACCACAACATCTG3′/ 5′ACATCTTCAGCAATGATAAGAAGTT3′ 5′CGCGAAAGAGGTTGAGACTG3′/ 5′ACATCTTCAGCAATGATAAGAAGTT3′ 5′ AAAAAGGCCGCACGCGAGTT'/ 5′AAAGAGGCTCCAACGCCACG3′ 5′AGAGAGATGGGGTGCAGGAC3′/ 5′AGCCTTTGCCAGACAGACAC 3′	ITS ITS ITS ITS ITS 23S rDNA hsp65 hsp65 rpoB Repeat	(178) (178) (178) (178) (178) (179) (180) (180) (181) (7)

Yersinia pestis

Bacteria (including molecular characterization)

The Gram-negative bacterium Yersinia pestis is primarily a rodent pathogen, usually transmitted subcutaneously to humans through the bite of an infected flea, but also by air, especially during pandemics of disease (149). Y. pestis is very closely related to the gastrointestinal pathogen Yersinia pseudotuberculosis and it has been proposed that Y. pestis is a clone that evolved from Y. pseudotuberculosis 1,500–20,000 years ago (150). Thus, Y. pestis seems to have rapidly adapted from being a mammalian enteropathogen widely found in the environment to a blood-borne pathogen of mammals that can also parasitise insects and has limited capability for survival outside these hosts. Y. pestis strains have been subdivided into three subtypes, or biovars, on the basis of their abilities to ferment glycerol and to reduce nitrate: Antiqua, Medievalis, and Orientalis, each of which has been associated with a major pandemic (150). Two complete genome sequences of two different strains of Y. pestis, one biovar Orientalis and one biovar Medievalis, have been published (149, 151, 152). A third whole-genome sequence of Y. pestis 91001 was also completed but has not been published (153). The genome consists of a 4.6 Mb chromosome and three plasmids of 92.2/100.9 kb, 70.3/70.5 kb and 9.6/9.5 kb. The genome is unusually rich in insertion sequences and displays atypical GC base-composition bias, indicating frequent intragenomic recombinations (149). Many genes seem to have been acquired from other bacteria and viruses (including adhesins, secretion systems and insecticidal toxins) (149). The genome contains around pseudogenes, many of which are remnants of a redundant enteropathogenic lifestyle (149). Gene acquisition has been important in the evolution of Y. pestis. In addition to the 70-kb virulence plasmid (pYV/pCD1) found in all pathogenic Yersinia, Y. pestis has acquired two unique plasmids that encode a variety of virulence factors (149, 154). A 9-kb plasmid (pPst/pPCP1) encodes the plasminogen activator Pla, a putative invasin that is essential for virulence by the subcutaneous route (149). A 100-kb plasmid (pFra/pMT1) encodes murine toxin Ymt and the F1 capsular protein, which have been shown to have a role in the transmission of plague (149). The genome sequence of Y. pestis revealed a pathogen that has undergone considerable genetic flux, with evidence of genetic expansion by lateral gene transfer of plasmid and chromosomal genes, and subsequent initial stages of genome size reduction. The comparison of the two published genomes also reveals homologous sequences but a remarkable amount of genome rearrangement for strains so closely related. The differences appear to result from multiple inversions of genome segments at insertion sequences, in a manner consistent with present knowledge of replication and recombination. There are few differences attributable to horizontal gene transfer. The recent identification of strains resistant to multiple drugs and the potential use of Y. pestis as an agent of biological warfare means that plague still poses a threat to human health.

Clinical aspects

Y. pestis is the cause of plague, an illness that may manifest itself in bubonic, pneumonic, or septicemic form (155). Plague has killed an estimated 200 million human beings throughout history and has been responsible for three human pandemics: the human Justinian plague (sixth to eighth centuries), the Black death (fourteenth to nineteenth centuries) and modern plague (nineteenth century to the present day) (149). Currently, plague is endemic in many areas of the world (156). Approximately 2,000 cases of plague are reported each year to the World Health Organization (156). Case-fatality rate for untreated bubonic plague is ≥50% (156).

Molecular diagnosis

Although the presentation of bubonic plague may be less of a problem, the septicemic and pneumonic forms present challenges to early diagnosis and prompt treatment (157). PCR assays could be performed on various samples, such as bubo aspirates, blood samples, sputum, dental pulp, rats and fleas (158–161). Before the genome sequencing, the available sequence targets were the 16S rRNA gene (162), the O-antigen gene (163), the Y. pestis plasminogen activator gene (158, 162, 164, 165), the Y. pestis fraction 1 capsular antigen (159, 162, 164) and the Y. pestis murin toxin gene (162). The three genomes of Y. pestis have allowed improved choice of primers. Indeed, 28 signature genes of Y. pestis have been discovered in three chromosomal regions by DNA microarray-based comparative genome hybridization in conjunction with PCR validation (153). Three pairs of Y. pestis-specific primers designed from signature sequence were demonstrated to have the expected specificity for this target bacterium without cross-reaction with the closely related Y. pseudotuberculosis or a large collection of genomic DNAs from other microorganisms. Variable-number tandem repeat (VNTR) sequences are common in the Y. pestis genome (166). Thus, VNTR analysis has been the first method based on the entire genome sequencing successfully applied for the genotyping of Y. pestis in 2001 (166). Recently, a new study based on VNTR analysis has allowed the genotyping of 180 Y. pestis isolates using 25 markers described in the previous works (166, 167). The three biovars were distributed into three main branches, with some exceptions. In particular, the Medievalis phenotype is clearly heterogeneous. Finally, a subset of seven markers has been proposed for a quick comparison of a new strain with the collection typed here. An original genotyping system based on intergenic spacer sequencing (MST) has been developed for the first time in our laboratory to verify the hypothesis that the first pandemic plague was due to the Antiqua biovar of Y. pestis and the second was due to the Medievalis biovar. First, MST was found to discriminate every biovar on a collection of 36 Y. pestis isolates representative of the three biovars. When applied to the dental pulp collected from eight individuals attributed to the first and second pandemics, MST identified original sequences matching with Y. pestis Orientalis. Thus, these data indicate that Y. pestis Orientalis, the agent of the last pandemics, also caused the Justinian plague and Black death.

REMAINING PROBLEMS

Molecular testing has been heralded as the “diagnostic tool for the new millenium”, whose ultimate potential could render other traditional hospital methods obsolete (168). However, several limitations have been encountered. One of the pitfalls of PCR is the interpretation of the results when DNA sequences from aquatic bacteria are retrieved on human samples. For example, the DNA sequence from aquatic bacteria such as Pseudomonas species has been retrieved using PCR targeting the 16S rRNA gene from the cerebrospinal fluid of patients with culture-negative aseptic meningitis following craniotomy (169). A water laboratory contamination is a possible explanation for these surprising results. Another example is the claim that nanobacteria exists based on 16S rRNA sequencing. However, complete analysis of the data suggests an aquatic contamination. These bacteria have been detected in commercial serum used for cell culture, in blood and blood products derived from horses, as well as in blood from human blood donors and in human kidney stones (170). Two strains, one of Nanobacteriumsanguineum and the other of Nanobacterium sp., were identified using the 16S rRNA gene (170). Two other teams did not confirm this previous work (171, 172). Notably, no evidence for the presence of the specific 16S rDNA sequence using primers derived from the published Nanobacterium sp. sequences in human kidney stones or serum evidence was found (171). It is of interest that phylogenetic analysis based on comparison of 16S rRNA sequence has placed these nanobacteria in the α₂ subgroup of Proteobateria (170), closely related to Thiobacillus, a water contaminant, and Agrobacterium and Rhizobium, which are plant-associated bacteria. Besides Nanobacterium spp. 16S rDNA sequences shares 97.8% to 99% similarity with those of Phyllobacterium myrsinacearum, a bacterium known to be a source of contamination in 16S rDNA PCR studies (173, 174). Therefore, these observations support the hypothesis of laboratory contamination as a possible explanation for the discrepancies regarding demonstration of the presence of Nanobacterium spp. DNA. At present we do not know exactly what the nanobacteria are. These data underline once again one of the limits of PCR assays, and the necessity of using controls when performing PCR and of interpreting the results obtained carefully.

CONCLUDING REMARKS

PCR is a great step forward in the diagnosis of infectious diseases. Moreover, this tool will be able to evolve in line with advances in genomic data. However, it is necessary to be cautious, and technical procedures must be strictly applied and controls systematically used. It is also necessary to apply a rigorous strategy when interpreting the results. If an original sequence is obtained, the result must be confirmed either in another laboratory or by using another gene with a new DNA extraction from the sample.

REFERENCES

1 Raoult D, Fournier PE, Drancourt M. What does the future hold for clinical microbiology? Nat Rev Microbiol 2004; 2: 151–9.
10.1038/nrmicro820
CAS PubMed Web of Science® Google Scholar
2 Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J, Wheeler DL. GenBank: update. Nucleic Acids Res 2004; 32: D23–6.
10.1093/nar/gkh045
CAS PubMed Web of Science® Google Scholar
3 Bernal A, Ear U, Kyrpides N. Genomes OnLine Database (GOLD): a monitor of genome projects world-wide. Nucleic Acids Res 2001; 29: 126–7.
10.1093/nar/29.1.126
CAS PubMed Web of Science® Google Scholar
4 Greisen K, Loeffelholz M, Purohit A, Leong D. PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid. J Clin Microbiol 1994; 32: 335–1.
10.1128/JCM.32.2.335-351.1994
CAS PubMed Web of Science® Google Scholar
5 Relman DA, Loutit JS, Schmidt TM, Falkow S, Tompkins LS. The agent of bacillary angiomatosis. An approach to the identification of uncultured pathogens. N Engl J Med 1990; 323: 1573–80.
10.1056/NEJM199012063232301
CAS PubMed Web of Science® Google Scholar
6 Wilson K, Blitchington R, Frothingham R, Wilson J. Phylogeny of the Whipple's-disease- associated bacterium. Lancet 1991; 338: 474–5.
10.1016/0140-6736(91)90545-Z
CAS PubMed Web of Science® Google Scholar
7 Fenollar F, Fournier P, Robert C, Raoult D. Use of genome selected repeated sequences increases the sensitivity of PCR detection of Tropheryma whipplei. J Clin Microbiol 2004; 42: 401–3.
10.1128/JCM.42.1.401-403.2004
CAS PubMed Web of Science® Google Scholar
8 Mege JL, Maurin M, Capo C, Raoult D. Coxiella burnetii: the ‘query’ fever bacterium. A model of immune subversion by a strictly intracellular microorganism. FEMS Microbiol Rev 1997; 19: 209–17.
10.1111/j.1574-6976.1997.tb00298.x
CAS PubMed Web of Science® Google Scholar
9 Fournier PE, Roux V, Raoult D. Phylogenetic analysis of spotted fever group rickettsiae by study of the outer surface protein rOmpA. Int J Syst Bacteriol 1998; 48: 839–49.
10.1099/00207713-48-3-839
CAS PubMed Web of Science® Google Scholar
10 Roux V, Rydkina E, Eremeeva M, Raoult D. Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the rickettsiae. Int J Syst Bacteriol 1997; 47: 252–61.
10.1099/00207713-47-2-252
CAS PubMed Web of Science® Google Scholar
11 Roux V, Raoult D. Phylogenetic analysis of the genus Rickettsia by 16S rDNA sequencing. Res Microbiol 1995; 146: 385–96.
10.1016/0923-2508(96)80284-1
CAS PubMed Web of Science® Google Scholar
12 Roux V, Fournier PE, Raoult D. Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. J Clin Microbiol 1996; 34: 2058–65.
10.1128/JCM.34.9.2058-2065.1996
CAS PubMed Web of Science® Google Scholar
13 Van Camp G, Chapelle S, De Wachter R. Amplification and sequencing of variable regions in bacterial 23S ribosomal RNA genes with conserved primer sequences. Curr Microbiol 1993; 27: 147–51.
10.1007/BF01576012
CAS PubMed Web of Science® Google Scholar
14 Mollet C, Drancourt M, Raoult D. rpoB sequence analysis as a novel basis for bacterial identification. Mol Microbiol 1997; 26: 1005–11.
10.1046/j.1365-2958.1997.6382009.x
CAS PubMed Web of Science® Google Scholar
15 Drancourt M, Raoult D. rpoB gene sequence-based identification of Staphylococcus species. J Clin Microbiol 2002; 40: 1333–8.
10.1128/JCM.40.4.1333-1338.2002
CAS PubMed Web of Science® Google Scholar
16 Drancourt M, Roux V, Fournier PE, Raoult D. rpoB gene sequence-based identification of aerobic Gram-positive cocci of the genera Streptococcus, Enterococcus, Gemella, Abiotrophia, and Granulicatella. J Clin Microbiol 2004; 42: 497–504.
10.1128/JCM.42.2.497-504.2004
CAS PubMed Web of Science® Google Scholar
17 Renesto P, Lorvellec-Guillon K, Drancourt M, Raoult D. rpoB gene analysis as a novel strategy for identification of spirochetes from the genera Borrelia,Treponema, and Leptospira. J Clin Microbiol 2000; 38: 2200–3.
CAS PubMed Web of Science® Google Scholar
18 Poyart C, Berche P, Trieu-Cuot P. Characterization of superoxide dismutase genes from gram-positive bacteria by polymerase chain reaction using degenerate primers. FEMS Microbiol Lett 1995; 131: 41–5.
10.1111/j.1574-6968.1995.tb07751.x
CAS PubMed Web of Science® Google Scholar
19 Poyart C, Quesne G, Coulon S, Berche P, Trieu-Cuot P. Identification of streptococci to species level by sequencing the gene encoding the manganese-dependent superoxide dismutase. J Clin Microbiol 1998; 36: 41–7.
10.1128/JCM.36.1.41-47.1998
CAS PubMed Web of Science® Google Scholar
20 Fournier PE, Xeridat B, Raoult D. Isolation of a rickettsia related to Astrakhan fever rickettsia from a patient in Chad. Ann N Y Acad Sci 2003; 990: 152–7.
10.1111/j.1749-6632.2003.tb07356.x
PubMed Web of Science® Google Scholar
21 Inokuma H, Brouqui P, Drancourt M, Raoult D. Citrate synthase gene sequence: a new tool for phylogenetic analysis and identification of Ehrlichia. J Clin Microbiol 2001; 39: 3031–9.
10.1128/JCM.39.9.3031-3039.2001
CAS PubMed Web of Science® Google Scholar
22 Joblet C, Roux V, Drancourt M, Gouvernet J, Raoult D. Identification of Bartonella (Rochalimaea) species among fastidious gram-negative bacteria on the basis of the partial sequence of the citrate-synthase gene. J Clin Microbiol 1995; 33: 1879–3.
CAS PubMed Web of Science® Google Scholar
23 Parkhill J, Achtman M, James K, Bentley S, Churcher C, Klee R, et al. Complete DNA sequence of a serogroup A strain of Neisseria meningitidis Z2491. Nature 2000; 404: 502–6.
10.1038/35006655
CAS PubMed Web of Science® Google Scholar
24 Willems H, Thiele D, Frolich-Ritter R, Krauss H. Detection of Coxiella burnetii in cow's milk using the polymerase chain reaction (PCR). Zentralbl Veterinarmed B 1994; 41: 580–7.
10.1111/j.1439-0450.1994.tb00267.x
CAS PubMed Web of Science® Google Scholar
25 Leal-Klevezas DS, Martinez-Vazquez IO, Lopez-Merino A, Martinez-Soriano JP. Single-step PCR for detection of Brucella spp. from blood and milk of infected animals. J Clin Microbiol 1995; 33: 3087–90.
CAS PubMed Web of Science® Google Scholar
26 Solomon AW, Holland MJ, Burton MJ, West SK, Alexander ND, Aguirre A, et al. Strategies for control of trachoma: observational study with quantitative PCR. Lancet 2003; 19; 362: 198–204.
Google Scholar
27 Murdoch DR. Nucleic acid amplification tests for the diagnosis of pneumonia. Clin Infect Dis 2003; 36: 1162–70.
10.1086/374559
CAS PubMed Web of Science® Google Scholar
28 Whiley DM, Crisante ME, Syrmis MW, Mackay IM, Sloots TP. Detection of Neisseria Meningitidis in clinical samples by a duplex real-time PCR targeting the porA and ctrA genes. Mol Diagn 2003; 7: 141–5.
10.2165/00066982-200307030-00001
PubMed Google Scholar
29 Raoult D, Roux V, Ndihokubwayo JB, Bise G, Baudon D, Marte G, et al. Jail fever (epidemic typhus) outbreak in Burundi. Emerg Infect Dis 1997; 3: 357–60.
10.3201/eid0303.970313
CAS PubMed Web of Science® Google Scholar
30 Dumler JS, Brouqui P. Molecular diagnosis of human granulocytic anaplasmosis. Expert Rev Mol Diagn. In press.
Google Scholar
31 Gilmore RD Jr, Cieplak W Jr, Policastro PF, Hackstadt T. The 120 kilodalton outer membrane protein (rOmp B) of Rickettsia rickettsii is encoded by an unusually long open reading frame: evidence for protein processing from a large precursor. Mol Microbiol 1991; 5: 2361–70.
10.1111/j.1365-2958.1991.tb02082.x
CAS PubMed Web of Science® Google Scholar
32 Sekeyova Z, Roux V, Raoult D. Phylogeny of Rickettsia spp. inferred by comparing sequences of ‘gene D’, which encodes an intracytoplasmic protein. Int J Syst Evol Microbiol 2001; 51: 1353–60.
10.1099/00207713-51-4-1353
CAS PubMed Web of Science® Google Scholar
33 Hassan AA, Khan IU, Abdulmawjood A, Lammler C. Inter- and intraspecies variations of the 16S-23S rDNA intergenic spacer region of various streptococcal species. Syst Appl Microbiol 2003; 26: 97–103.
10.1078/072320203322337371
CAS PubMed Web of Science® Google Scholar
34 Hill KE, Davies CE, Wilson MJ, Stephens P, Lewis MA, Hall V, et al. Heterogeneity within the gram-positive anaerobic cocci demonstrated by analysis of 16S-23S intergenic ribosomal RNA polymorphisms. J Med Microbiol 2002; 51: 949–57.
10.1099/0022-1317-51-11-949
CAS PubMed Web of Science® Google Scholar
35 Stamm LV, Bergen HL, Walker RL. Molecular typing of papillomatous digital dermatitis-associated Treponema isolates based on analysis of 16S-23S ribosomal DNA intergenic spacer regions. J Clin Microbiol 2002; 40: 3463–9.
10.1128/JCM.40.9.3463-3469.2002
CAS PubMed Web of Science® Google Scholar
36 Maiwald M, Lepp PW, Relman DA. Analysis of conserved non-rRNA genes of Tropheryma whipplei. Syst Appl Microbiol 2003; 26: 3–12.
10.1078/072320203322337254
CAS PubMed Web of Science® Google Scholar
37 Roux V, Raoult D. Inter- and intraspecies identification of Bartonella (Rochalimea) species. J Clin Microbiol 1995; 33: 1573–9.
CAS PubMed Web of Science® Google Scholar
38 Shaver YJ, Nagpal ML, Fox KF, Rudner R, Fox A. Variation in 16S-23S rRNA intergenic spacer regions among Bacillus subtilis 168 isolates. Mol Microbiol 2001; 42: 101–9.
10.1046/j.1365-2958.2001.02600.x
CAS PubMed Web of Science® Google Scholar
39 McClelland M, Petersen C, Welsh J. Length polymorphisms in tRNA intergenic spacers detected by using the polymerase chain reaction can distinguish streptococcal strains and species. J Clin Microbiol 1992; 30: 1499–504.
CAS PubMed Web of Science® Google Scholar
40 Stein A, Kruszewska D, Gouvernet J, Raoult D. Study of the 16S-23S ribosomal DNA internal spacer of Coxiella burnetii. Eur J Epidemiol 1997; 13: 471–5.
10.1023/A:1007389315808
CAS PubMed Web of Science® Google Scholar
41 Andersson SG, Zomorodipour A, Winkler HH, Kurland CG. Unusual organization of the rRNA genes in Rickettsia prowazekii. J Bacteriol 1995; 177: 4171–5.
10.1128/jb.177.14.4171-4175.1995
CAS PubMed Web of Science® Google Scholar
42 Enright MC, Spratt BG. Multilocus sequence typing. Trends Microbiol 1999; 7: 482–7.
10.1016/S0966-842X(99)01609-1
CAS PubMed Web of Science® Google Scholar
43 Maiden MC, Bygraves JA, Feil E, Morelli G, Russell JE, Urwin R, et al. Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms. Proc Natl Acad Sci U S A 1998; 95: 3140–5.
10.1073/pnas.95.6.3140
CAS PubMed Web of Science® Google Scholar
44 Enright MC, Spratt BG. A multilocus sequence typing scheme for Streptococcus pneumoniae: identification of clones associated with serious invasive disease. Microbiology 1998; 144: 3049–60.
10.1099/00221287-144-11-3049
CAS PubMed Web of Science® Google Scholar
45 Iredell J, Blanckenberg D, Arvand M, Grauling S, Feil EJ, Birtles RJ. Characterization of the natural population of Bartonella henselae by multilocus sequence typing. J Clin Microbiol 2003; 41: 5071–9.
10.1128/JCM.41.11.5071-5079.2003
CAS PubMed Web of Science® Google Scholar
46 Drancourt M, Roux V, Dang LV, Tran-Hung L, Castex D, Chenal-Francisque V, et al. Orientalis-like Yersinia pestis found by spacer genotyping during historical plague pandemics. Emerg Infect Dis. In press.
PubMed Google Scholar
47 Van Belkum A, Scherer S, Van Alphen L, Verbrugh H. Short-sequence DNA repeats in prokaryotic genomes. Microbiol Mol Biol Rev 1998; 62: 275–93.
10.1128/MMBR.62.2.275-293.1998
CAS PubMed Web of Science® Google Scholar
48 Turner BJ, Elder JF Jr, Laughlin TF, Davis WP. Genetic variation in clonal vertebrates detected by simple-sequence DNA fingerprinting. Proc Natl Acad Sci U S A 1990; 87: 5653–7.
10.1073/pnas.87.15.5653
CAS PubMed Web of Science® Google Scholar
49 Farlow J, Smith KL, Wong J, Abrams M, Lytle M, Keim P. Francisella tularensis strain typing using multiple-locus, variable-number tandem repeat analysis. J Clin Microbiol 2001; 39: 3186–92.
10.1128/JCM.39.9.3186-3192.2001
CAS PubMed Web of Science® Google Scholar
50 Farlow J, Postic D, Smith KL, Jay Z, Baranton G, Keim P. Strain typing of Borrelia burgdorferi, Borrelia afzelii, and Borrelia garinii by using multiple-locus variable-number tandem repeat analysis. J Clin Microbiol 2002; 40: 4612–8.
10.1128/JCM.40.12.4612-4618.2002
CAS PubMed Web of Science® Google Scholar
51 Spurgiesz RS, Quitugua TN, Smith KL, Schupp J, Palmer EG, Cox RA, et al. Molecular typing of Mycobacterium tuberculosis by using nine novel variable-number tandem repeats across the Beijing family and low-copy-number IS6110 isolates. J Clin Microbiol 2003; 41: 4224–30.
10.1128/JCM.41.9.4224-4230.2003
CAS PubMed Web of Science® Google Scholar
52 Rajakumar K, Shafi J, Smith RJ, Stabler RA, Andrew PW, Modha D, et al. Use of genome level-informed PCR as a new investigational approach for analysis of outbreak-associated Mycobacterium tuberculosis isolates. J Clin Microbiol 2004; 42: 1890–6.
10.1128/JCM.42.5.1890-1896.2004
CAS PubMed Web of Science® Google Scholar
53 Borst A, Box AT, Fluit AC. False-positive results and contamination in nucleic acid amplification assays: suggestions for a prevent and destroy strategy. Eur J Clin Microbiol Infect Dis 2004; 23: 289–99.
10.1007/s10096-004-1100-1
CAS PubMed Web of Science® Google Scholar
54 Gauduchon V, Chalabreysse L, Etienne J, Célard M, Benito Y, Lepidi H, et al. Molecular diagnosis of infective endocarditis by PCR amplification and direct sequencing of DNA from valve tissue. J Clin Microbiol 2003; 41: 763–6.
10.1128/JCM.41.2.763-766.2003
CAS PubMed Web of Science® Google Scholar
55 Grijalva M, Horvath R, Dendis M, Erny J, Benedik J. Molecular diagnosis of culture negative infective endocarditis: clinical validation in a group of surgically treated patients. Heart 2003; 89: 263–8.
10.1136/heart.89.3.263
CAS PubMed Web of Science® Google Scholar
56 Bauerfeind P, Koelz H, Altwegg M. PCR for Tropheryma whippelii. Lancet 1999; 354: 1476.
10.1016/S0140-6736(05)77620-0
PubMed Web of Science® Google Scholar
57 Raoult D, Fournier P, Fenollar F, Jensenius M, Prioe T, De Pina J, et al. Rickettsia africae, a tick-borne pathogen in travellers to Sub-Saharan Africa. N Engl J Med 2001; 344: 1504–10.
10.1056/NEJM200105173442003
CAS PubMed Web of Science® Google Scholar
58 Fournier PE, Raoult D. Suicide PCR on skin biopsies for the diagnoses of rickettsioses. J Clin Microbiol 2004; 42: 3428–34.
10.1128/JCM.42.8.3428-3434.2004
CAS PubMed Web of Science® Google Scholar
59 Carroll NM, Adamson P, Okhravi N. Elimination of bacterial DNA from Taq DNA polymerases by restriction endonuclease digestion. J Clin Microbiol 1999; 37: 3402–4.
10.1128/JCM.37.10.3402-3404.1999
CAS PubMed Web of Science® Google Scholar
60 Corless CE, Guiver M, Borrow R, Edwards-Jones V, Kaczmarski EB, Fox AJ. Contamination and sensitivity issues with a real-time universal 16S rRNA PCR. J Clin Microbiol 2000; 38: 1747–52.
10.1128/JCM.38.5.1747-1752.2000
CAS PubMed Web of Science® Google Scholar
61 Taranger J, Trollfors B, Lind L, Zackrisson G, Beling-Holmquist K. Environmental contamination leading to false-positive polymerase chain reaction for pertussis. Pediatr Infect Dis J 1994; 13: 936–7.
10.1097/00006454-199410000-00020
CAS PubMed Web of Science® Google Scholar
62 Porter-Jordan K, Garrett CT. Source of contamination in polymerase chain reaction assay. Lancet 1990; 335: 1220.
10.1016/0140-6736(90)92740-9
CAS PubMed Web of Science® Google Scholar
63 Fenollar F, Raoult D. Molecular techniques in Whipple's disease. Expert Rev Mol Diagn 2001; 1: 299–309.
10.1586/14737159.1.3.299
CAS PubMed Google Scholar
64 Wolk D, Mitchell S, Patel R. Principles of molecular microbiology testing methods. Infect Dis Clin North Am 2001; 15: 1157–204.
10.1016/S0891-5520(05)70190-2
CAS PubMed Web of Science® Google Scholar
65 Monteiro L, Bonnemaison D, Vekris A, Petry KG, Bonnet J, Vidal R, et al. Complex polysaccharides as PCR inhibitors in feces: Helicobacter pylori model. J Clin Microbiol 1997; 35: 995–8.
10.1128/JCM.35.4.995-998.1997
CAS PubMed Web of Science® Google Scholar
66 Akane A, Matsubara K, Nakamura H, Takahashi S, Kimura K. Identification of the heme compound copurified with deoxyribonucleic acid (DNA) from bloodstains, a major inhibitor of polymerase chain reaction (PCR) amplification. J Forensic Sci 1994; 39: 362–72.
10.1520/JFS13607J
CAS PubMed Web of Science® Google Scholar
67 Bickley J, Short JK, McDowell DG, Parkes HC. Polymerase chain reaction (PCR) detection of Listeria monocytogenes in diluted milk and reversal of PCR inhibition caused by calcium ions. Lett Appl Microbiol 1996; 22: 153–8.
10.1111/j.1472-765X.1996.tb01131.x
CAS PubMed Web of Science® Google Scholar
68 Mahony J, Chong S, Jang D, Luinstra K, Faught M, Dalby D, et al. Urine specimens from pregnant and nonpregnant women inhibitory to amplification of Chlamydia trachomatis nucleic acid by PCR, ligase chain reaction, and transcription-mediated amplification: identification of urinary substances associated with inhibition and removal of inhibitory activity. J Clin Microbiol 1998; 36: 3122–6.
CAS PubMed Web of Science® Google Scholar
69 Fredricks DN, Relman DA. Improved amplification of microbial DNA from blood cultures by removal of the PCR inhibitor sodium polyanetholesulfonate. J Clin Microbiol 1998; 36: 2810–16.
CAS PubMed Web of Science® Google Scholar
70 Abu Al-Soud W, Radstrom P. Effects of amplification facilitators on diagnostic PCR in the presence of blood, feces, and meat. J Clin Microbiol 2000; 38: 4463–70.
10.1128/JCM.38.12.4463-4470.2000
CAS PubMed Web of Science® Google Scholar
71 Tamura A, Ohashi N, Urakami H, Miyamura S. Classification of Rickettsia tsutsugamushi in a new genus, Orientia gen. nov., as Orientia tsutsugamushi comb. nov. Int J Syst Bacteriol 1995; 45: 589–91.
10.1099/00207713-45-3-589
PubMed Web of Science® Google Scholar
72 Ogata H, Audic S, Barbe V, Artiguenave F, Fournier P, Raoult D, et al. Selfish DNA in protein-coding genes of Rickettsia. Science 2003; 290: 347–50.
10.1126/science.290.5490.347
CAS PubMed Web of Science® Google Scholar
73 Ogata H, Audic S, Renesto-Audiffren P, Fournier PE, Barbe V, Samson D, et al. Mechanisms of evolution in Rickettsia conorii and R. prowazekii. Science 2001; 293: 2093–8.
10.1126/science.1061471
CAS PubMed Web of Science® Google Scholar
74 Andersson SG, Zomorodipour A, Andersson JO, Sicheritz-Ponten T, Alsmark UC, Podowski RM, et al. The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature 1998; 396: 133–40.
10.1038/24094
CAS PubMed Web of Science® Google Scholar
75 Azad AF. Epidemiology of murine typhus. Annu Rev Entomol 1990; 35: 553–69.
10.1146/annurev.en.35.010190.003005
CAS PubMed Web of Science® Google Scholar
76 Raoult D, Roux V. Rickettsioses as paradigms of new or emerging infectious diseases. Clin Microbiol Rev 1997; 10: 694–719.
10.1128/CMR.10.4.694
CAS PubMed Web of Science® Google Scholar
77 Raoult D, Olson J. Emerging Rickettsioses. In: W Scheld, W Craig, J Hughes, editors. Emerging infections. Washington, DC: ASM Press, 1999: 17–31.
10.1128/9781555818418.ch2
Google Scholar
78 Shpynov S, Fournier PE, Rudakov N, Tankibaev M, Tarasevich I, Raoult D. Detection of a rickettsia closely related to Rickettsia aeschlimannii, “Rickettsia heilongjiangensis,”Rickettsia sp. strain RpA4, and Ehrlichia muris in ticks collected in Russia and Kazakhstan. J Clin Microbiol 2004; 42: 2221–3.
10.1128/JCM.42.5.2221-2223.2004
PubMed Web of Science® Google Scholar
79 Labruna MB, Whitworth T, Horta MC, Bouyer DH, McBride JW, Pinter A, et al. Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of Sao Paulo, Brazil, where Brazilian spotted fever is endemic. J Clin Microbiol 2004; 42: 90–8.
10.1128/JCM.42.1.90-98.2004
PubMed Web of Science® Google Scholar
80 Raoult D, La Scola B, Enea M, Fournier PE, Roux V, Fenollar F, et al. A flea-associated Rickettsia pathogenic for humans. Emerg Infect Dis 2001; 7: 73–81.
10.3201/eid0701.010112
CAS PubMed Web of Science® Google Scholar
81 Roux V, Raoult D. Body lice as tools for diagnosis and surveillance of reemerging diseases. J Clin Microbiol 1999; 37: 596–9.
10.1128/JCM.37.3.596-599.1999
CAS PubMed Web of Science® Google Scholar
82 Stein A, Raoult D. A simple method for amplification of DNA from paraffin-embedded tissues. Nucleic Acids Res 1992; 20: 5237–8.
10.1093/nar/20.19.5237
CAS PubMed Web of Science® Google Scholar
83 Anderson BE, Tzianabos T. Comparative sequence analysis of a genus-common rickettsial antigen gene. J Bacteriol 1989; 171: 5199–201.
10.1128/jb.171.9.5199-5201.1989
CAS PubMed Web of Science® Google Scholar
84 Balayeva NM, Eremeeva ME, Tissot-Dupont H, Zakharov IA, Raoult D. Genotype characterization of the bacterium expressing the male-killing trait in the ladybird beetle Adalia bipunctata with specific rickettsial molecular tools. Appl Environ Microbiol 1995; 61: 1431–7.
CAS PubMed Web of Science® Google Scholar
85 Schriefer ME, Sacci JB Jr, Dumler JS, Bullen MG, Azad AF. Identification of a novel rickettsial infection in a patient diagnosed with murine typhus. J Clin Microbiol 1994; 32: 949–54.
10.1128/jcm.32.4.949-954.1994
CAS PubMed Web of Science® Google Scholar
86 Wood DO, Williamson LR, Winkler HH, Krause DC. Nucleotide sequence of the Rickettsia prowazekii citrate synthase gene. J Bacteriol 1987; 169: 3564–72.
10.1128/jb.169.8.3564-3572.1987
CAS PubMed Web of Science® Google Scholar
87 Raoult D, Brouqui P, Roux V. A new spotted fever-group rickettsiosis. Lancet 1996; 348: 412.
10.1016/S0140-6736(05)65037-4
CAS PubMed Web of Science® Google Scholar
88 Nilsson K, Lindquist O, Pahlson. Association of Rickettsia helvetica with chronic perimyocarditis in sudden cardiac death. Lancet 1999; 354: 1169–73.
10.1016/S0140-6736(99)04093-3
CAS PubMed Web of Science® Google Scholar
89 Walker D, Dumler J. Emergence of ehrlichioses as human health problems. Emerg Infect Dis 2001; 2: 1–15.
Google Scholar
90 Dumler J, Bakken J. Ehrlichial diseases of humans: emerging tick-borne infections. Clin Infect Dis 1996; 20: 1102–10.
10.1093/clinids/20.5.1102
Web of Science® Google Scholar
91 Dumler J, Barbet A, Bekker C, Dasch G, Palmer G, Ray S, et al. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and “HGE agent” as subjective synonyms of Ehrlichia phagocytophila. Int J Syst Evol Microbiol 2001; 51: 2145–65.
10.1099/00207713-51-6-2145
CAS PubMed Web of Science® Google Scholar
92 Rydkina E, Roux V, Raoult D. Determination of the genome size of Ehrlichia spp., using pulsed field gel electrophoresis. FEMS Microbiol Lett 1999; 176: 73–8.
10.1111/j.1574-6968.1999.tb13644.x
CAS PubMed Web of Science® Google Scholar
93 Dumler J, Walker D. Tick borne ehrlichioses. Lancet Infect Dis 2001; 21–8.
10.1016/S1473-3099(09)70296-8
PubMed Web of Science® Google Scholar
94 Kelly D, Richards A, Temenak J, Strickman D, Dasch G. The past and present threat of Rickettsiales diseases to Military Medicine and International Public Health. Clin Infect Dis 2002; 34(S 4): S145–69.
10.1086/339908
PubMed Web of Science® Google Scholar
95 Parola P, Raoult D. Ticks and tickborne bacterial diseases in humans: an emerging infectious threat. Clin Infect Dis 2001; 32: 897–928.
10.1086/319347
CAS PubMed Web of Science® Google Scholar
96 Perez M, Rikihisa Y, Wen B. Ehrlichia canis-like agent isolated from a man in Venezuela: antigenic and genetic characterization. J Clin Microbiol 1996; 34: 2133–9.
PubMed Web of Science® Google Scholar
97 Dumler J, Brouqui P, Aronson J, Taylor J, Walker D. Identification of Ehrlichia in human tissue. N Engl J Med 1991; 325: 1109–10.
10.1056/NEJM199110103251517
CAS PubMed Web of Science® Google Scholar
98 Misao T, Kobayashi Y. Studies on infectious mononucleosis (glandular fever). I. Isolation of etiologic agent from blood, bone marrow, and lymph node of a patient with infectious mononucleosis by using mice. Kyushu J Med Sci 1955; 6: 145–52.
Google Scholar
99 Anderson BE, Sumner JW, Dawson JE, Tzianabos T, Greene CR, Olson JG, et al. Detection of the etiologic agent of human ehrlichiosis by polymerase chain reaction. J Clin Microbiol 1992; 30: 775–80.
10.1128/jcm.30.4.775-780.1992
CAS PubMed Web of Science® Google Scholar
100 Everett ED, Evans KA, Henry RB, McDonald G. Human ehrlichiosis in adults after tick exposure. Diagnosis using polymerase chain reaction. Ann Intern Med 1994; 120: 730–5.
10.7326/0003-4819-120-9-199405010-00002
CAS PubMed Web of Science® Google Scholar
101 Standaert SM, Dawson JE, Schaffner W, Childs JE, Biggie KL, Singleton J Jr, et al. Ehrlichiosis in a golf-oriented retirement community. N Engl J Med 1995; 333: 420–5.
10.1056/NEJM199508173330704
CAS PubMed Web of Science® Google Scholar
102 Bakken JS, Krueth J, Wilson-Nordskog C, Tilden RL, Asanovich K, Dumler JS. Clinical and laboratory characteristics of human granulocytic ehrlichiosis. JAMA 1996; 275: 199–205.
10.1001/jama.1996.03530270039029
CAS PubMed Web of Science® Google Scholar
103 Taillardat-Bisch AV, Raoult D, Drancourt M. RNA polymerase beta-subunit-based phylogeny of Ehrlichia spp., Anaplasma spp., Neorickettsia spp. and Wolbachia pipientis. Int J Syst Evol Microbiol 2003; 53: 455–8.
10.1099/ijs.0.02411-0
CAS PubMed Web of Science® Google Scholar
104 Sumner JW, Nicholson WL, Massung RF. PCR amplification and comparison of nucleotide sequences from the groESL heat shock operon of Ehrlichia species. J Clin Microbiol 1997; 35: 2087–92.
10.1128/jcm.35.8.2087-2092.1997
CAS PubMed Web of Science® Google Scholar
105 Lee KN, Padmalayam I, Baumstark B, Baker SL, Massung RF. Characterization of the ftsZ gene from Ehrlichia chaffeensis, Anaplasma phagocytophilum, and Rickettsia rickettsii, and use as a differential PCR target. DNA Cell Biol 2003; 22: 179–86.
10.1089/104454903321655800
CAS PubMed Web of Science® Google Scholar
106 Massung RF, Slater KG. Comparison of PCR assays for detection of the agent of human granulocytic ehrlichiosis, Anaplasma phagocytophilum. J Clin Microbiol 2003; 41: 717–22.
10.1128/JCM.41.2.717-722.2003
CAS PubMed Web of Science® Google Scholar
107 Gim'enez DF. Staining rickettsiae in yolk-sac cultures. Stain Technol 1964; 39: 135–40.
CAS Google Scholar
108 Weisburg W, Dobson M, Samuel J, Dasch G, Mallavia L, Baca O, et al. Phylogenetic diversity of the rickettsiae. J Bacteriol 1989; 171: 4202–6.
10.1128/jb.171.8.4202-4206.1989
CAS PubMed Web of Science® Google Scholar
109 Madariaga MG, Rezai K, Trenholme GM, Weinstein RA. Q fever: a biological weapon in your backyard. Lancet Infect Dis 2003; 3: 709–21.
10.1016/S1473-3099(03)00804-1
PubMed Web of Science® Google Scholar
110 Meier-Willersen H, Maiwald M, Von Herbay A. Morbus Whipple in Assoziation mit opportunistischen Infektionen. Dtsch Med Wschr 1993; 118: 854–60.
10.1055/s-2008-1059397
CAS PubMed Web of Science® Google Scholar
111 Maurin M, Raoult D. Q fever. Clin Microbiol Rev 1999; 12: 518–53.
10.1128/CMR.12.4.518
CAS PubMed Web of Science® Google Scholar
112 Austin L, Dobbins WI. Intraepithelial leukocytes of the intestinal mucosa in normal man and in Whipple's disease: a light-and electron-microscopic study. Dig Dis Sci 1982; 27: 311–20.
10.1007/BF01296750
CAS PubMed Web of Science® Google Scholar
113 Raoult D, Tissot-Dupont H, Foucault C, Gouvernet J, Fournier P, Bernit E, et al. Q fever 1985–1998. Clinical and epidemiologic features of 1,383 infections. Medicine 2000; 79: 109–23.
10.1097/00005792-200003000-00005
CAS PubMed Web of Science® Google Scholar
114 Raoult D, Fenollar F, Stein A. Q fever during pregnancy: diagnosis, treatment, and follow-up. Arch Intern Med 2002; 162: 701–4.
10.1001/archinte.162.6.701
PubMed Web of Science® Google Scholar
115 Stein A, Raoult D. Detection of Coxiella burnetii by DNA amplification using polymerase chain reaction. J Clin Microbiol 1992; 30: 2462–6.
CAS PubMed Web of Science® Google Scholar
116 Hoover T, Vodkin M, Williams J. A Coxiella burnetii repeated DNA element ressembling a bacterial insertion element. J Bacteriol 1992; 174: 5540–8.
10.1128/jb.174.17.5540-5548.1992
CAS PubMed Web of Science® Google Scholar
117 Fournier P, Raoult D. Comparison of PCR and serology for the diagnosis of acute Q fever. J Clin Microbiol 2003; 41: 5094–8.
10.1128/JCM.41.11.5094-5098.2003
CAS PubMed Web of Science® Google Scholar
118 Jacomo V, Kelly PJ, Raoult D. Natural history of Bartonella infections (an exception to Koch's postulate). Clin Diagn Lab Immunol 2002; 9: 8–18.
CAS PubMed Web of Science® Google Scholar
119 Alsmark UC, Frank AC, Kalberg EOLB, Canbäck B, Ardell D, Eriksson AS, et al. The louse-borne human pathogen Bartonella quintana is a genomic derivative of the zoonotic agent Bartonella henselae. Proc Natl Acad Sci U S A. In press.
Google Scholar
120 Greub G, Raoult D. Bartonella: new explanations for old diseases. J Med Microbiol 2002; 51: 915–23.
10.1099/0022-1317-51-11-915
CAS PubMed Web of Science® Google Scholar
121 Mouritsen CL, Litwin CM, Maiese RL, Segal SM, Segal GH. Rapid polymerase chain reaction-based detection of the causative agent of cat scratch disease (Bartonella henselae) in formalin-fixed, paraffin-embedded samples. Hum Pathol 1997; 28: 820–6.
10.1016/S0046-8177(97)90156-8
CAS PubMed Web of Science® Google Scholar
122 Anderson BE, Neuman MA. Bartonella spp. as emerging human pathogens. Clin Microbiol Rev 1997; 10: 203–19.
10.1128/CMR.10.2.203
CAS PubMed Web of Science® Google Scholar
123 Kerkhoff FT, Bergmans AM, Van Der ZA, Rothova A. Demonstration of Bartonella grahamii DNA in ocular fluids of a patient with neuroretinitis. J Clin Microbiol 1999; 37: 4034–8.
10.1128/JCM.37.12.4034-4038.1999
CAS PubMed Web of Science® Google Scholar
124 Patel R, Newell JO, Procop GW, Persing DH. Use of polymerase chain reaction for citrate synthase gene to diagnose Bartonella quintana endocarditis. Am J Clin Pathol 1999; 112: 36–40.
10.1093/ajcp/112.1.36
CAS PubMed Web of Science® Google Scholar
125 Roux V, Raoult D. The 16S-23S rRNA intergenic spacer region of Bartonella (Rochalimaea) species is longer than usually described in other bacteria. Gene 1995; 156: 107–11.
10.1016/0378-1119(94)00919-J
CAS PubMed Web of Science® Google Scholar
126 Jensen WA, Fall MZ, Rooney J, Kordick DL, Breitschwerdt EB. Rapid identification and differentiation of Bartonella species using a single-step PCR assay. J Clin Microbiol 2000; 38: 1717–22.
10.1128/JCM.38.5.1717-1722.2000
CAS PubMed Web of Science® Google Scholar
127 Houpikian P, Raoult D. 16S/23S rRNA intergenic spacer regions for phylogenetic analysis, identification, and subtyping of Bartonella species. J Clin Microbiol 2001; 39: 2768–78.
10.1128/JCM.39.8.2768-2778.2001
CAS PubMed Web of Science® Google Scholar
128 Bereswill S, Hinkelmann S, Kist M, Sander A. Molecular analysis of riboflavin synthesis genes in Bartonella henselae and use of the ribC gene for differentiation of Bartonella species by PCR. J Clin Microbiol 1999; 37: 3159–66.
10.1128/JCM.37.10.3159-3166.1999
CAS PubMed Web of Science® Google Scholar
129 Johnson G, Ayers M, McClure SC, Richardson SE, Tellier R. Detection and identification of Bartonella species pathogenic for humans by PCR amplification targeting the riboflavin synthase gene (ribC). J Clin Microbiol 2003; 41: 1069–72.
10.1128/JCM.41.3.1069-1072.2003
CAS PubMed Web of Science® Google Scholar
130 Marston EL, Sumner JW, Regnery RL. Evaluation of intraspecies genetic variation within the 60 kDa heat-shock protein gene (groEL) of Bartonella species. Int J Syst Bacteriol 1999; 49: 1015–23.
10.1099/00207713-49-3-1015
CAS PubMed Web of Science® Google Scholar
131 Zeaiter Z, Fournier PE, Ogata H, Raoult D. Phylogenetic classification of Bartonella species by comparing groEL sequences. Int J Syst Evol Microbiol 2002; 52: 165–71.
10.1099/00207713-52-1-165
CAS PubMed Web of Science® Google Scholar
132 Renesto P, Gouvernet J, Drancourt M, Roux V, Raoult D. Use of rpoB gene analysis for detection and identification of Bartonella species. J Clin Microbiol 2001; 39: 430–7.
10.1128/JCM.39.2.430-437.2001
CAS PubMed Web of Science® Google Scholar
133 La Scola B, Liang Z, Zeaiter Z, Houpikian P, Grimont PA, Raoult D. Genotypic characteristics of two serotypes of Bartonella henselae. J Clin Microbiol 2002; 40: 2002–8.
10.1128/JCM.40.6.2002-2008.2002
CAS PubMed Web of Science® Google Scholar
134 Zeaiter Z, Fournier PE, Raoult D. Genomic variation of Bartonella henselae strains detected in lymph nodes of patients with cat scratch disease. J Clin Microbiol 2002; 40: 1023–30.
10.1128/JCM.40.3.1023-1030.2002
CAS PubMed Web of Science® Google Scholar
135 Zeaiter Z, Liang Z, Raoult D. Genetic classification and differentiation of Bartonella species based on comparison of partial ftsZ gene sequences. J Clin Microbiol 2002; 40: 3641–7.
10.1128/JCM.40.10.3641-3647.2002
CAS PubMed Web of Science® Google Scholar
136 Zeaiter Z, Fournier P, Greub G, Raoult D. Diagnosis of Bartonella endocarditis by a real-time nested-PCR assay using serum. J Clin Microbiol 2003; 41: 919–25.
10.1128/JCM.41.3.919-925.2003
CAS PubMed Web of Science® Google Scholar
137 Relman DA, Schmidt TM, MacDermott RP, Falkow S. Identification of the uncultured bacillus of Whipple's disease. N Engl J Med 1992; 327: 293–301.
10.1056/NEJM199207303270501
CAS PubMed Web of Science® Google Scholar
138 La Scola B, Fenollar F, Fournier P, Altwegg M, Mallet M, Raoult D. Description of Tropheryma whipplei gen. nov., sp. nov., the Whipple's disease bacillus. Int J Syst Evol Microbiol 2001; 51: 1471–9.
10.1099/00207713-51-4-1471
CAS PubMed Web of Science® Google Scholar
139 Raoult D, Ogata H, Audic S, Robert C, Suhre K, Drancourt M, et al. Tropheryma whipplei Twist: a human pathogenic Actinobacteria with a reduced genome. Genome Res 2003; 13: 1800–9.
10.1101/gr.1474603
CAS PubMed Web of Science® Google Scholar
140 Bentley S, Maiwald M, Murphy L, Pallen M, Yeats C, Dover L, et al. Sequencing and analysis of the genome of the Whipple's disease bacterium Tropheryma whipplei. Lancet 2003; 361: 637–44.
10.1016/S0140-6736(03)12597-4
CAS PubMed Web of Science® Google Scholar
141 Renesto P, Crapoulet N, Ogata H, La Scola B, Vestris G, Claverie J, et al. Genome-based design of a cell-free culture medium for Tropheryma whipplei. Lancet 2003; 362: 447–9.
10.1016/S0140-6736(03)14071-8
PubMed Web of Science® Google Scholar
142 Marth T, Raoult D. Whipple's disease. Lancet 2003; 361: 239–46.
10.1016/S0140-6736(03)12274-X
PubMed Web of Science® Google Scholar
143 Fenollar F, Fournier P, Gerolami R, Lepidi H, Poyart C, Raoult D. Quantitative detection of Tropheryma whipplei DNA by real-time PCR. J Clin Microbiol 2002; 40: 1119–20.
10.1128/JCM.40.3.1119-1120.2002
CAS PubMed Web of Science® Google Scholar
144 Dutly F, Altwegg M. Whipple's disease and “Tropheryma whippelii“. Clin Microbiol Rev 2001; 14: 561–83.
10.1128/CMR.14.3.561-583.2001
CAS PubMed Web of Science® Google Scholar
145 Street S, Donoghue H, Neild G. Tropheryma whippelii DNA in saliva of healthy people. Lancet 1999; 354: 1178–9.
10.1016/S0140-6736(99)03065-2
CAS PubMed Web of Science® Google Scholar
146 Hinrikson H, Dutly F, Nair S, Altwegg M. Detection of three different types of “Tropheryma whippelii“ directly from clinical specimens by sequencing, single-strand conformation polymorphism (SSCP) analysis and type-specific type PCR of their 16S-23S ribosomal intergenic spacer region. Int J Syst Bacteriol 1999; 49: 1701–6.
10.1099/00207713-49-4-1701
CAS PubMed Web of Science® Google Scholar
147 Maiwald M, Ditton H, Von Herbay A, Rainey F, Stackebrandt E. Reassessment of the phylogenetic position of the bacterium associated with Whipple's disease and determination of the 16S-23S ribosomal intergenic spacer sequence. Int J Syst Bacteriol 1996; 46: 1078–82.
10.1099/00207713-46-4-1078
CAS PubMed Web of Science® Google Scholar
148 Hinrikson H, Dutly F, Altwegg M. Analysis of the actinobacterial insertion in domain III of the 23S rRNA gene of uncultured variants of the bacterium associated with Whipple's disease using broad-range and “Tropheryma whippelii“-specific PCR. Int J Syst Evol Microbiol 2000; 50: 1007–11.
10.1099/00207713-50-3-1007
CAS PubMed Web of Science® Google Scholar
149 Parkhill J, Wren BW, Thomson NR, Titball RW, Holden MT, Prentice MB, et al. Genome sequence of Yersinia pestis, the causative agent of plague. Nature 2001; 413: 523–7.
10.1038/35097083
CAS PubMed Web of Science® Google Scholar
150 Achtman M. Yersinia pestis, the cause of plague, is a recently emerged clone of Yersinia pseudotuberculosis. Proc Natl Acad Sci U S A 1999; 96: 14043–8.
10.1073/pnas.96.24.14043
CAS PubMed Web of Science® Google Scholar
151 Deng W, Burland V, Plunkett G III, Boutin A, Mayhew GF, Liss P, et al. Genome sequence of Yersinia pestis KIM. J Bacteriol 2002; 184: 4601–11.
10.1128/JB.184.16.4601-4611.2002
CAS PubMed Web of Science® Google Scholar
152 Doll JM. Cat-transmitted fatal pneumonic plague in a person who traveled from Colorado to Arizona. Am J Trop Med Hyg 1994; 51: 109–14.
10.4269/ajtmh.1994.51.109
CAS PubMed Web of Science® Google Scholar
153 Zhou D, Han YDE, Pei D, Song Y, Zhai J, Du Z, et al. Identification of signature genes for rapid and specific characterization of Yersinia pestis. Microbiol Immunol 2004; 48: 263–9.
10.1111/j.1348-0421.2004.tb03522.x
CAS PubMed Web of Science® Google Scholar
154 Brubaker RR. The recent emergence of plague: a process of felonious evolution. Microb Ecol 2004; 47: 293–9.
10.1007/s00248-003-1022-y
CAS PubMed Web of Science® Google Scholar
155 Rollins SE, Rollins SM, Ryan ET. Yersinia pestis and the plague. Am J Clin Pathol 2003; 119(Suppl): S78–85.
PubMed Google Scholar
156 Imported plague – New York City, 2002. MMWR Morb Mortal Wkly Rep 2003; 52: 725–8.
PubMed Google Scholar
157 Lazarus AA, Decker CF. Plague. Respir Care Clin N Am 2004; 10: 83–98.
10.1016/S1078-5337(03)00051-0
PubMed Google Scholar
158 Loiez C, Herwegh S, Wallet F, Armand S, Guinet F, Courcol RJ. Detection of Yersinia pestis in sputum by real-time PCR. J Clin Microbiol 2003; 41: 4873–5.
10.1128/JCM.41.10.4873-4875.2003
CAS PubMed Web of Science® Google Scholar
159 Rahalison L, Vololonirina E, Ratsitorahina M, Chanteau S. Diagnosis of bubonic plague by PCR in Madagascar under field conditions. J Clin Microbiol 2000; 38: 260–3.
CAS PubMed Web of Science® Google Scholar
160 Hinnebusch J, Schwan TG. New method for plague surveillance using polymerase chain reaction to detect Yersinia pestis in fleas. J Clin Microbiol 1993; 31: 1511–4.
PubMed Web of Science® Google Scholar
161 Raoult D, Aboudharam G, Crubezy E, Larrouy G, Ludes B, Drancourt M. Molecular identification by “suicide PCR” of Yersinia pestis as the agent of Medieval Black Death. Proc Natl Acad Sci USA 2000; 97: 12800–3.
10.1073/pnas.220225197
CAS PubMed Web of Science® Google Scholar
162 Tomaso H, Reisinger EC, Al Dahouk S, Frangoulidis D, Rakin A, Neubauer H. Rapid detection of Yersinia pestis in with multiplex real-time PCR assays using fluorescent hybridisation probes. FEMS Immunol Med Microbiol 2003; 38: 117–26.
10.1016/S0928-8244(03)00184-6
CAS PubMed Web of Science® Google Scholar
163 Bogdanovitch T, Carniel E, Fukushima H, Skurnik M. Use of O-antigen gene cluster-specific PCRs for the identification and O-genotyping of Yersinia pseudotuberculosis and Yersinia pestis. J Clin Microbiol 2003; 5103–12.
10.1128/JCM.41.11.5103-5112.2003
CAS PubMed Web of Science® Google Scholar
164 Norkina OV, Kulichenko AN, Gintsburg AL, Tuchkov IV, Popov YU, Aksnov MU, et al. Development of a diagnostic test of Yersinia pestis by the polymerase chian reaction. J Appl Bacteriol 1994; 76: 240–5.
10.1111/j.1365-2672.1994.tb01622.x
CAS PubMed Web of Science® Google Scholar
165 Campbell N, Lowe J, Ezzell J. Rapid and specific identification of Yersinia pestis by using a nested polymerase chain reaction procedure. J Clin Microbiol 1993; 31: 758–9.
CAS PubMed Web of Science® Google Scholar
166 Klevytska AM, Price LB, Schupp JM, Worsham PL, Wong J, Keim P. Identification and characterization of variable-number tandem repeats in the Yersinia pestis genome. J Clin Microbiol 2001; 39: 3179–85.
10.1128/JCM.39.9.3179-3185.2001
CAS PubMed Web of Science® Google Scholar
167 Pourcel C, Andre-Mazeaud F, Neubauer H, Ramisse F, Vergnaud G. Tandem repeats analysis for the high resolution phylogenetic analysis of Yersinia pestis. BMC Microbiol 2004; 4: 22.
10.1186/1471-2180-4-22
CAS PubMed Web of Science® Google Scholar
168 Pitt TL, Saunders NA. Molecular bacteriology: a diagnostic tool for the millennium. J Clin Pathol 2000; 53: 71–5.
10.1136/jcp.53.1.71
CAS PubMed Web of Science® Google Scholar
169 Druel B, Vandenesch F, Greenland D, Verneau V, Grando J, Salord F, et al. Aseptic meningitis after neurosurgery: a demonstration of bacterial involvement. Clin Microbiol Infect 1996; 1: 230–4.
10.1111/j.1469-0691.1996.tb00567.x
PubMed Google Scholar
170 Kajander EO, Kuronen I, Pelttari A, Ciftçioglu N. Nanobacteria from blood, the smallest culturable autonomously replicating agent on Earth. In: Instruments, methods, and missions for the investigation of extraterrestrial microorganisms. SPIE Proceedings Series, Vol. 3111. Society of Photo-Optical Instrumentation Engineers: Washington, DC, 2004: 420–8.
Google Scholar
171 Drancourt M, Jacomo V, Lepidi H, Lechevallier E, Grisoni V, Coulange C, et al. Attempted isolation of Nanobacterium sp. microorganisms from upper urinary tract stones. J Clin Microbiol 2003; 41: 368–72.
10.1128/JCM.41.1.368-372.2003
PubMed Web of Science® Google Scholar
172 Chang DY, Jarrett TW, Kavoussi LR, Nelson K. Abstract from the 95th Annual Meeting of the American Urological Association. J Urol 2000; 161: 249.
Google Scholar
173 Cisar JO, Xu DQ, Thompson J, Swaim W, Hu L, Kopecko DJ. An alternative interpretation of nanobacteria-induced biomineralization. Proc Natl Acad Sci U S A 2000; 97: 11511–5.
10.1073/pnas.97.21.11511
CAS PubMed Web of Science® Google Scholar
174 Tanner MA, Goebel BM, Dojka MA, Pace NR. Specific ribosomal DNA sequences from diverse environmental settings correlate with experimental contaminants. Appl Environ Microbiol 1998; 64: 3110–3.
10.1128/AEM.64.8.3110-3113.1998
CAS PubMed Web of Science® Google Scholar
175 Willems H, Thiele D, Krauss H. Plasmid based differentiation and detection of Coxiella burnetii in clinical samples. Eur J Epidemiol 1993; 9: 411–8.
10.1007/BF00157399
CAS PubMed Web of Science® Google Scholar
176 Ibrahim A, Norlander L, Macellaro A. The potential of the 23S rRNA gene for rapid detection of Coxiella burnetii in clinical samples. In: J Kazar, R Toman, editors. Rickettsiae and Rickettsial diseases. Bratislava: Slovak Academy of Sciences, 2004: 441–5.
Google Scholar
177 Thiele D, Willems H, Krauss H. The 16S/23S ribosomal spacer region of Coxiella burnetti. Eur J Epidemiol 1994; 10: 421–6.
10.1007/BF01719666
CAS PubMed Web of Science® Google Scholar
178 Hinrikson H, Dutly F, Altwegg M. Homogeneity of 16S-23S ribosomal intergenic spacer regions of Tropheryma whippelii in Swiss patients with Whipple's disease. J Clin Microbiol 1999; 37: 152–6.
CAS PubMed Web of Science® Google Scholar
179 Hinrikson H, Dutly F, Altwegg M. Evaluation of a specific nested PCR targeting domain III of the 23S rRNA gene of “Tropheryma whippelii” and proposal of a classification system for its molecular variants. J Clin Microbiol 2000; 38: 595–9.
10.1128/JCM.38.2.595-599.2000
CAS PubMed Web of Science® Google Scholar
180 Morgenegg S, Dutly F, Altwegg M. Cloning and sequencing of a part of the heat shock protein 65 (hsp65) gene of Tropheryma whippelii and its use for the detection of Tropheryma whippelii in clinical specimens by PCR. J Clin Microbiol 2000; 38: 2248–53.
CAS PubMed Web of Science® Google Scholar
181 Drancourt M, Carlioz A, Raoult D. rpoB sequence analysis of cultured Tropheryma whippelii. J Clin Microbiol 2001; 39: 2425–30.
10.1128/JCM.39.7.2425-2430.2001
CAS PubMed Web of Science® Google Scholar

Citing Literature

Volume112, Issue11-12

December 2004

Pages 785-807

Molecular genetic methods for the diagnosis of fastidious microorganisms†

Abstract

GENERAL PRINCIPLES OF PCR-BASED DIAGNOSIS

Choice of primers

Choice of primer for identification

At the genus and species level

For specific identification

Choice of primers for epidemiology

16–23S rDNA spacer (ITS)

Multilocus locus sequence typing (MLST)

Multi spacer typing (MST)

Variable number tandem repeat (VNTR)

Genome level-informed PCR (GLIP)

Specificity

Negative controls

Sources of contamination and solutions

Vertical contamination

Horizontal contamination

Bacterial DNA in reagents

Neighboring contamination

Interpretation of positive results

SensitivityDNA extraction

Positive control

Detection of the efficiency

Inhibitors

MOLECULAR DIAGNOSIS OF HIGHLY FASTIDIOUS BACTERIA

Rickettsia sp.

Bacteria (including molecular characterization)

Clinical aspects

Molecular diagnosis

Ehrlichia spp.

Bacteria

Clinical aspects

Molecular diagnosis

Coxiella burnetii

Bacteria (including molecular characterization)

Clinical aspects

Molecular diagnosis

Bartonella species

Bacteria

Clinical aspects

Molecular diagnosis

Tropheryma whipplei

Bacteria (including molecular characterization)

Clinical aspects

Molecular diagnosis

Yersinia pestis

Bacteria (including molecular characterization)

Clinical aspects

Molecular diagnosis

REMAINING PROBLEMS

CONCLUDING REMARKS

REFERENCES

Citing Literature

Figures

References

Related

Information

Molecular genetic methods for the diagnosis of fastidious microorganisms^†