Volume 48, Issue s1 pp. 50s-55s

Full Access

Inter-Strain Variability of Insertion/Deletion Events in the Encephalitozoon cuniculi Genome: A Comparative KARD-PFGE Analysis

JEAN-FRANCOIS BRUGERE,

JEAN-FRANCOIS BRUGERE

Parasitologie Moléculaire et Cellulaire, LBP, UMR CNRS 6023, Université Blaise Pascal, 63177 Aubière cedex, France

Search for more papers by this author

EMMANUEL CORNILLOT,

Corresponding Author

EMMANUEL CORNILLOT

Parasitologie Moléculaire et Cellulaire, LBP, UMR CNRS 6023, Université Blaise Pascal, 63177 Aubière cedex, France

Corresponding Author: E. CORNILLOT - Telephone: (33)(0)473407471; FAX: (33)(0)473407455; E-mail: [email protected].Search for more papers by this author

THIERRY BOURBON,

THIERRY BOURBON

Parasitologie Moléculaire et Cellulaire, LBP, UMR CNRS 6023, Université Blaise Pascal, 63177 Aubière cedex, France

Search for more papers by this author

GUY METENIER,

GUY METENIER

Parasitologie Moléculaire et Cellulaire, LBP, UMR CNRS 6023, Université Blaise Pascal, 63177 Aubière cedex, France

Search for more papers by this author

CHRISTIAN P. VIVARÈS,

CHRISTIAN P. VIVARÈS

Parasitologie Moléculaire et Cellulaire, LBP, UMR CNRS 6023, Université Blaise Pascal, 63177 Aubière cedex, France

Search for more papers by this author

JEAN-FRANCOIS BRUGERE,

JEAN-FRANCOIS BRUGERE

Parasitologie Moléculaire et Cellulaire, LBP, UMR CNRS 6023, Université Blaise Pascal, 63177 Aubière cedex, France

Search for more papers by this author

EMMANUEL CORNILLOT,

Corresponding Author

EMMANUEL CORNILLOT

Parasitologie Moléculaire et Cellulaire, LBP, UMR CNRS 6023, Université Blaise Pascal, 63177 Aubière cedex, France

Corresponding Author: E. CORNILLOT - Telephone: (33)(0)473407471; FAX: (33)(0)473407455; E-mail: [email protected].Search for more papers by this author

THIERRY BOURBON,

THIERRY BOURBON

Parasitologie Moléculaire et Cellulaire, LBP, UMR CNRS 6023, Université Blaise Pascal, 63177 Aubière cedex, France

Search for more papers by this author

GUY METENIER,

GUY METENIER

Parasitologie Moléculaire et Cellulaire, LBP, UMR CNRS 6023, Université Blaise Pascal, 63177 Aubière cedex, France

Search for more papers by this author

CHRISTIAN P. VIVARÈS,

CHRISTIAN P. VIVARÈS

Parasitologie Moléculaire et Cellulaire, LBP, UMR CNRS 6023, Université Blaise Pascal, 63177 Aubière cedex, France

Search for more papers by this author

First published: 11 July 2005

https://doi.org/10.1111/j.1550-7408.2001.tb00451.x

Citations: 5

Share a link

Email
Wechat
Bluesky

Abstract

ABSTRACT. We applied a two-dimensional pulsed-field gel electrophoresis procedure to the genomes of two karyotype variants assigned to two different strains of the microsporidian Encephalitozoon cuniculi, termed D (strain III) and F (strain II). Data obtained for BssHII and Mlul restriction fragment length polymorphisms in each chromosome are compiled and compared to the reference strain I variant A. Six Insertion/Deletion (InDels) are found in subterminal position, some of these being characteristic of either D or F. Like in strain I, the terminal fragments extending between each telomere and rDNA locus are conserved in length for each chromosome. They are however smaller than in reference variant. This size reduction is estimated to be 2.5 kbp for the strain III isolate and 3.5 kbp for the strain II isolate. We hypothesize that for the three E. cuniculi strains, all chromosome extremities are prone to a constant process of sequence homogenization through mitolic recombination between conserved regions.

Although most microsporidian species can be considered as parasites with a highly restricted host specificity, those belonging to the genus Encephalitozoon, especially E. cuniculi, are capable of infecting a wide range of mammalian host species [16]. Three different E. cuniculi strains (I, II and III) have been clearly differentiated on the basis of molecular criteria such as sequence variations of the unique rDNA internal transcribed spacer TTS1 [13] and of the polar tube protein PTP1 [22]. Each strain seems to be preferentially, but not exclusively, associated with an animal host (strain I: rabbit, strain II: fox, strain III: dog), and both immunological and molecular analyses of various E. cuniculi isolates lent credit to the hypothesis that human infections with E. cuniculi are a zoonosis [5,12,14,19,21].

It should be recalled that E. cuniculi has a highly reduced genome (∼2.9 Mb) divided into eleven chromosomes [6]. Chromosome size polymorphism has been demonstrated among isolates assigned to different strains, leading to the discrimination of six karyotype variants (A to F) [5]. The development of a new protocol of genome fingerprinting based on two-dimensional pulsed-field gel electrophoresis (2-D PFGE), we termed “Karyotype And Restriction Display 2-D PFGE (KARD-PFGE)” [8,9], enabled us to show that this polymorphism can result of subtelomeric insertion-deletion events (InDels) in two karyotype variants (A and C) of strain I [10]. Isolates belonging to strains II and III were previously found to have significantly reduced chromosome size ranges, compared to strain I isolates [5]. This prompted us to extend the application of KARDPFGE to two other E. cuniculi isolates of different origins and respectively assigned to strains II and III. To facilitate a comparison with the reference isolate (karyotype A, strain I), the same restriction enzymes (Mlul and BssHH) were used.

MATERIALS AND METHODS

Cell culture

The E. cuniculi isolate USA-D1 (strain n) was from a domestic dog in USA and kindly provided by Dr E. Didier. The isolate N-F220 (strain in) was from a fanned blue fox in Norway and kindly provided by Drs P. Deplazes and R. Weber. The isolate GB-M1 from a mouse (strain I), routinely used for various studies in our laboratory, served as a reference. Parasites were grown at 37°C on MDCK (Madin Darby Canine Kidney) cells [3].

KARD-PFGE

Purification of E. cuniculi spores and preparation of agarose blocks for PFGE analyses were done as described in [9]. Contour-clamped homogeneous electric field PFGE in a Gene Navigator(tm) (Pharmacia) system was performed at 12°C, using 1.3% chromosomal grade agarose (SeaKEM(tm) GTG, FMC Bioproducts) in 0.5 × TBE (45 mM Tris base, 45 mM boric acid, 1 mM EDTA) and 16.5-s pulses for 38 h at 200 V. KARD-PFGE separations and DNA labeling were performed as previously described [9]. For visualising radioactive DNA, gels were vacuum-dried for 1.5 h with a gel slab dryer (Model 224, BioRad), and placed against a Biomax(tm) MS film (Kodak) between two intensifying screens at - 80°C. Data for restriction fragment lengths have been generated semi-automatically with the Melanie n software (ISB, Geneva). Autoradiographs were scanned on a GS700 imaging densitometer (BioRad).

Hybridization

The 23S rDNA probe was designed downstream of the Mlul restriction site associated with 23S rDNA gene, as previously described [8] and was synthesised using a PCR procedure with Universal and Reverse primers (GTTTTCCCAGTCACGAC and AACAGCTATGACCATG, respectively) and a pUC 18-based vector. The corresponding insert was amplified then labeled with 10 Ci [α³²P]dCTP, 25 M d[A,G,T]TP and 2 mM MgCl₂ after 30 cycles of amplification comprising 30 s at 94°C, 30 s at 53°C and 2 min at 72°C. The synthesis of the 16S rDNA probe was done with primers described in [11]. Radiolabeled probes were hybridised to PFGE-separated restriction fragments directly in dried gels. All hybridizations were done at 65°C for 18 h, in 5X SSPE, 1% SDS and 5X Denhardt solution. Membranes or gels were washed three times in 0.1X SSPE, 0.1% SDS, at 65°C for 30 min each, before exposition to Biomax™ MS film (Kodak).

PCR amplification

To amplify DNA from subtelomeric regions, an oligonucleotide was designed on the basis of the consensus sequence of E. cuniculi chromosome I [23]. The corresponding sequence was: 5′CCGCGAAAGCTTCTGTCGACGAAAG 3′. The other primer was derived from the 23S rDNA gene, downstream of the Mlul restriction site: 5′AGTACGAGAGGAACTCTTGATTGCG 3′. Long-range PCR experiments were performed using a Long Expand PCR kit (Roche Molecular Biochemicals). The expected size for the PCR product of reference isolate was 5 kbp.

RESULTS

Restriction profiles of chromosomal DNAs from two E. cuniculi isolates representative of strains II and III were obtained by KARDPFGE, a procedure which involved successively: (i) PFGE-separation of chromosomal bands (molecular karyotype), (ii) cutting of an agarose band which includes the full karyotype then in-gel digestion of DNA with a restriction enzyme, (iii) in-gel ³²P labeling of digested DNA using Klenow fragment, (iv) deposition of the agarose band at the top of a second PFGE gel, electrophoresis of radiolabeled restriction fragments in a direction orthogonal to that of molecular karyotype, and (v) visualization of separated fragments by autoradiography. Each autoradiograph therefore reveals specific restriction patterns of all the chromosomes in the order imposed by the first electrophoretic step. The designations for the karyotype forms of the strain III isolate (dog) and strain II isolate (blue fox) were D and F, respectively [5]. Tables 1 and 2 show the results of spot analysis after either Mlul or BssHII digestion, for these two variants and the reference strain I variant A. Figure 1 summarizes schematically our inferences about the positions of polymorphic elements in the eleven chromosomes of the E. cuniculi genome The three different “genomic fingerprints” are illustrated by the upper photographs of Fig. 2.

Table 1. A MluI restriction fragment size (kbp) KARD analysis of the three different isolates of E. cuniculi. Fragments representing polymorphism are in bold and underlined. When the modification is specific of only the D or F variant, numbers are italicized. Fragments with an InDel differentiating two homologues are separated by /.

Karyotype	A	D	F	A	D	F	A	D	F	A	D	F	A	D	F
	E. cuniculi chromosomes MluI restriction pattern
	1			2			3			4			5
	12	9,5	8,5	3	3	3	5	5	5	12	9,5	8,5	8	8	8
	12	9,5	8,5	3	9,5	8,5	12	9,5	8,5	12	9,5	8,5	12	9,5	8,5
	53	53	53	12	9,5	8,5	12	9,5	8,5	26	26	26	12	9,5	8,5
	133	133	133	12	21	21	18	18	18	38	38	38	17	17	17
				21	27	27	23	30	30	157	65	58	17	17	17
				27	27	27	30	44	44		93	93	42	42	42
				27	41	41	40	49	49				44	44	44
				41	87	87	44	69	64				96	89	89
				82			46/49
TOTAL	210	205	203	230	225	223	230/233	234	227	245	241	232	248	236	234

Karyotype	A	D	F	A	D	F	A	D	F	A	D	F	A	D	F	A	D	F
	E. cuniculi chromosomes MluI restriction pattern
	6			7			8			9			10			11
	12	9,5	8,5	12	9,5	8,5	8	8	8	12	9,5	8,5	7	7	7	4	4	4
	12	9,5	8,5	12	9,5	8,5	12	9,5	8,5	12	9,5	8,5	9	9	8,5	12	9,5	8,5
	47	47	47	21	21	21	12	9,5	8,5	15	15	15	12	9,5	8,5	12	9,5	8,5
	52	52	52	28	28	28	20	20	20	21	21	21	12	9,5	9	19	19	19
	59	52	58	53	53	53	21	21	21	28	28	28	21	21	21	20	20	20
	72	68	63	134	134	134	53	53	53	83	83	83	23	26	26	21	21	21
							53	53	53	109	109	107/109	23	48	48	27	27	27
							87	87	89				80	80	80	32	32	32
													105	84	84	54	54	54
																103	100	100
TOTAL	254	238	237	260	255	253	266	261	261	280	275	271/273	292	294	292	304	296	294

Table 2. A BssHII restriction fragment size (kb) KARD analysis of the three different isolated of E. cuniculi. The conventions as is in Table 1 are used.

Karyotype	A	D	F	A	D	F	A	D	F	A	D	F	A	D	F
	E. cuniculi chromosomes BssHII restriction pattern
	1			2			3			4			5
	9,5	7	6	9,5	7	6	9,5	7	6	9,5	7	6	4	4	4
	9,5	7	6	9,5	7	6	9,5	7	6	9,5	7	6	9,5	7	6
	19	19	19	25	25	25	104/107	107	107	18	19	18	9,5	7	6
	20	30	30	38	38	38	107	113	109	50	50	44	20	20	20
	30	30	30	45	45	45				50	50	50	27	29	29
	30	30	30	50	50	50				54	54	54	27	29	29
	30	30	30	53	53	53				54	54	54	29	47	47
	30	52	52										29	93	93
	32												93
TOTAL	210	205	203	230	225	223	230/233	234	228	245	241	232	248	236	234

Karyotype	A	D	F	A	D	F	A	D	F	A	D	F	A	D	F	A	D	F
	E. cuniculi chromosomes BssHII restriction pattern
	6			7			8			9			10			11
	8	8	8	9,5	7	6	4	4	4	9,5	7	6	9,5	7	6	8	5	6
	9,5	7	6	9,5	7	6	7	7	6	9,5	7	6	9,5	7	6	9,5	7	6
	9,5	7	6	11	11	11	9,5	7	6	126	89	80	52	52	52	9,5	7	6
	25	25	25	11	11	11	9,5	7	7	135	37	44/46	221	228	228	18	18	18
	79	79	79	28	28	28	13	13	13		135	135				22	22	22
	123	112	112	44	44	44	29	29	29							22	22	22
				55	55	55	29	29	29							25	25	25
				92	92	92	38	38	38							35	35	35
							58	58	60							37	37	37
							69	69	69							39	39	39
																39	39	39
																40	40	40
TOTAL	254	238	236	260	255	253	266	261	261	280	275	271/273	292	294	291	304	296	295

Details are in the caption following the image — **Figure 1**
Open in figure viewer PowerPoint

Representation of the different elements of polymorphism deduced from the comparison of KARD patterns of different *E. cuniculi* isolates, positioned on the reference Mlul and firaHII restriction maps. Mlul and *Bss*HII restriction sites are represented by large and small vertical lines within chromosome schemes. +/− indicate additional site/lacking site, relative to variant A. Inlrachromosomal rearrangements are marked by horizontal dashed lines. Subterminal InDels are shown by vertical arrows with letters (A, C, D or F). Previous results for A and C [10] have been added. The region between rDNA and telomere is represented by a horizontal gray arrow on each extremity.

KARD-PFGE pattern of variant D (strain III)

One significant difference between variant D and variant A patterns concerns a Mlul fragment which should be specifically associated with each chromosome extremity. In variant A, a 12-kbp Mlul fragment was indeed previously shown to derive from the two ends of all the 11 chromosomes, as a result of a strong sequence conservation of telomeric and rDNA-containing subtelomeric regions [8]. In variant D, the terminal 12-kbp fragment seems to be replaced by a smaller one (9.5 kbp), as suggested by its double intensity. Moreover, as shown by vertical arrows in Fig. 1, a length polymorphism of the fragment extending immediately upstream of the terminal fragment was detected in three chromosomes (length increase of 6 kbp for chromosome III; length decrease of 7 and 4 kbp for chromosomes V and VI, respectively). Three more internal InDels were also found (horizontal dashed lines in Fig. 1), one on chromosome VI (7 kbp) and the two others on the two largest chromosomes (X: 7kbp and XI: 3 kbp).

KARD-PFGE pattern of variant F (strain II)

The strong resemblance between D and F patterns (Fig. 2, upper part) reflects similarities in the presence/absence of some Mlul (see Table 1, e.g. chromosomes n and X) or BssHII (see Table 2, e.g. chromosomes I and V) restriction sites, compared to variant A. Likewise, the terminal fragment shared by all chromosome ends is smaller than in variant A. The length of this fragment is however more reduced (8.5 kbp) than in variant D. Of the three previously mentioned subterminal InDels, that in chromosome V is in fact common to D and F and that in chromosome VI is more extensive in variant F. In contrast, the subterminal InDel in chromosome III remains specific of variant D. Two other subterminal InDels are associated with chromosomes IV (7 kbp) and VTff (2 kbp) in variant F. An additional characteristic of this variant is represented by two chromosome IX homologues whose the size difference can be explained by a unique InDel (2 kbp) located in the chromosome core (dashed horizontal line in Fig. 1).

Hybridization with rDNA probes

In a previous mapping of chromosomes from strain I reference isolate, the common terminal Mlul fragment, 12 kbp in length, was demonstrated to hybridize with 23S rDNA probe, supporting a centrifuge arrangement of each rDNA unit located at the neighboring of each telomeric region [8]. To test the hypothesis that the somewhat reduced terminal fragments in strain II and III isolates still retain rDNA sequences, KARD-PFGE gels were also used for hybridizations experiments with 16S and 23S rDNA probes (Fig. 2, lower part). The data obtained with 23S rDNA probe show clearly that the 9.5-kbp (variant D) and 8.5-kbp (variant F) Mlul fragments (and corresponding smaller BssHII fragments; data not shown) are specific of conserved chromosome termini. All the subterminal fragments found to differ in size, in comparison with variant A, hybridized with 16S rDNA probe. The divergent orientation of the two subtelomeric rDNA units in each chromosome is therefore also conserved.

Analysis of a PCR-amplified subtelomeric region

We succeeded in PCR amplification of a subtelomeric DNA sequence extending downstream of the 23S rRNA gene and providing a DNA fragment with the expected size of 5 kbp in the reference variant. The same protocol was applied to chromosomal DNAs from variants D and F. The PCR product derived from variant D was about 500 bp smaller than the previous one. The size difference was confirmed through RFLP analysis with NsiI and XhoI restriction enzymes (data not shown). No amplificatian product was however obtained with DNA from variant F. Thus, the possibility remains that the size reduction of terminal regions in the two variants is not dependent on a unique InDel in a same place.

DISCUSSION

This comparative KARD-PFGE study provides more information about the multiplicity of sites of rearrangements in the small genome of the mammal-infecting microsporidian species E. cuniculi prone to a significant karyotype variability [5]. In the yeast Saccharomyces cerevisiae [4,15] or the apicomplexan parasite Plasmodiumfalciparum [20], the number of chromosomes is preserved among isolates but different karyotype forms also exist. Chromosome rearrangements in these organisms may be sometimes related to InDel events which can occur in subtelomeric regions [2,17,18]. This can be also the case in E. cuniculi, as first suggested by a KARD-PFGE comparison of two variants (A and C) from the same strain I [10]. Following the examination of the restriction patterns derived from variants D and F, it can be deduced that the total number of MluI and BssHII restriction sites is rather well conserved in spite of variations in restriction fragment size. Only, the disappearance of one BssHII site in chromosome V may be explained by an InDel event. It should be stressed that DNA rearrangements may lead sometimes to changes in the size order of the E. cuniculi chromosomes. In the variant D, not in variant F, the chromosome IV was larger than chromosomes V and VI. In fact, a careful look at the polymorphic fragments reveals that this is a consequence of deletions within the chromosomes V and VI, justifying a drastic size reduction of these chromosomes. That the size of chromosome IV is smaller than in variant A is only due to the reduction of its terminal fragment. The usual chromosome size order is restored in variant F because of the presence of a new InDel in its chromosome IV. This somewhat complex interpretation is well indicative of the power of analysis offered by the KARD-PFGE method.

Evidence for six new subterminal InDels have been brought in this study. Taking into account those previously described in two strain I isolates, the total number of different InDels attains 11 for a sample of only four E. cuniculi isolates. The mean frequency of nearly 3 new Indels per isolate strongly supports that the species E. cuniculi has been regularly subjected to chromosomal rearrangements. In P. falciparum, subtelomeric InDels have been shown to involve minisatellites or genes encoding surface antigens [1,7,17]. The relationship of InDels with specific DNA sequences and the possible incidence of InDels on phenotypic features of E. cuniculi await further investigations.

Of peculiar interest is our finding of a new type of InDel which affected all the 22 chromosome extremities of the E. cuniculi genome. This represents a major justification of the trend to a general decrease of chromosome sizes observed among strain II and III isolates [5]. Compared to that in variant A, each terminal region would have been subjected to a deletion of 2.5 kp in variant D and of 3.5 kbp in variant F. For the entire genome, this corresponds to a loss of either 55 or 77 kbp. Like in some other eukaryotic parasites, the terminal regions may include hot spots of recombination. How and why rDNA units remain associated with these regions, whatever the strain considered, are still unresolved questions. Possibly, the specific positioning of rDNA units may result from frequent mitotic interchromosomal exchanges and may contribute to the maintenance of the integrity of gene-rich chromosome cores. The InDels which have been assigned to the core regions are indeed rare and they clearly differentiate variants D and F from those of strain I (A and C). It is tempting to consider that the size of the terminal restriction fragment may represent an additional strain marker, given that three different sizes correlate with the number of strains. Further genome fingerprinting studies of other isolates from strains II and III are however needed to determine whether such variations are truly characteristic of each E. cuniculi strain. If it was the case, an insight into the evolutionary history of the small genomes of Encephalitozoon species might emerge.

ACKNOWLEDGMENTS

We thank Dr M. H6braud (URINRA 370, Theix, France) for assistance in attempts at computational data acquisition with their proteomic plateform.

LITERATURE CITED

1 Anderson, T. J., Su, X. Z., Roddam, A. & Day, KP. 2000. Complex mutations in a high proportion of microsatellite loci from the protozoan parasite Plasmodiumfalciparum. MolEcol. 9: 1599–1608.
10.1046/j.1365-294x.2000.01057.x
CAS PubMed Web of Science® Google Scholar
2 Atbel, T., Shemesh, R. & Simchen, G. 1999. Frequent meiotic recombination between the ends of truncated chromosome fragments of Saccharomyces cerevisiae. Genetics. 153: 1583–1590.
PubMed Web of Science® Google Scholar
3 Beauvais, B., Sarfati, C., Challier, S. & Derouin, F. 1994. In vitro model to assess effect of antimicrobial agents on Encephalitozoon cuniculi. Antimicrob Agents Chemother. 38: 2440–2448.
10.1128/AAC.38.10.2440
CAS PubMed Web of Science® Google Scholar
4 Bidenne, C, Blondin, B., Dequin, S. & Vezinhet, F. 1992. Analysis of the chromosomal DNA polymorphism of wine strains of Saccharomyces cerevisiae. Curr Genet. 22: 1–7.
10.1007/BF00351734
CAS PubMed Web of Science® Google Scholar
5 Biderre, C., Mathis, A., Deplazes, P., Weber, R., Méténier, G. & Vivarés, C. P. 1999. Molecular karyotype diversity in the microsporidian Encephalitozoon cuniculi. Parasitology. 118: 439–445.
10.1017/S0031182099004023
CAS PubMed Web of Science® Google Scholar
6 Biderre, C., Pages, M., Mélénier, G, Canning E. U. & Vivarés, C. P. 1995. Evidence for the smallest nuclear genome (2.9 Mb) in the microsporidium Encephatitozoon cuniculi. Mol Biochem Parasitol. 74: 229–231.
10.1016/0166-6851(95)02495-6
CAS PubMed Web of Science® Google Scholar
7 Biggs, B. A., Kemp, D. J. & Brown, G. V. 1989. Subtelomeric chromosome deletions in field isolates of Plasmodiumfalciparum and their relationship to loss of cytoadherence in vitro. ProcNatlAcadSet USA. 86: 2428–2432.
10.1073/pnas.86.7.2428
CAS PubMed Web of Science® Google Scholar
8 Brogere, J.-F., Comillot, E., Méténier, G., Bensimon, A. & Vivarés, C. P. 2000. Encephalitozoon cuniculi (Microspora) genome: physical map and evidence for telomere-associated rDNA units on all chromosomes. Nucleic Acids Res. 28: 2026–2033.
10.1093/nar/28.10.2026
PubMed Web of Science® Google Scholar
9 Brugere, J.-F., Cornillot, E., Méténier, G. & Vivarés, C. P. 2000a. In-gel DNA radiolabelling and two-dimensional pulsed field gel electrophoresis procedures suitable for fingerprinting and mapping small eukaryotic genomes. Nucleic Acids Res. 28: E48.
10.1093/nar/28.10.e48
CAS PubMed Google Scholar
10 Brugere, J.-F., Comillot, E., Méténier, G. & Vivarés, C. P. 2000b. Occurence of subtelomeric rearrangements in the genome of the microsporidian parasite Encephalitozoon cuniculi, as revealed by a new fingerprinting procedure based on two-dimensional pulsed field gel electrophoresis. Electrophoresis. 21: 2576–2581.
10.1002/1522-2683(20000701)21:12<2576::AID-ELPS2576>3.0.CO;2-D
CAS PubMed Web of Science® Google Scholar
11 Delbac, F. & Vivares, C. P. 1997. A PCR technique for detecting and differentiating known microsporidia in AIDS patients. J Eukaryot Microbiol. 44: 758.
10.1111/j.1550-7408.1997.tb05789.x
Web of Science® Google Scholar
12 Deplazes, P., Mathis, A., Baumgartner, R., Tanner, I. & Weber, R. 1996. Immunologic and molecular characteristics of Encephalitozoon-like microsporidia isolated from humans and rabbits indicate that Encephalitozoon cuniculi is a zoonotic parasite. Clin Infect Dis. 22: 557–559.
10.1093/clinids/22.3.557
CAS PubMed Web of Science® Google Scholar
13 Didier, E. S., Vossbrinck, C. R., Baker, M. D., Rogers, L. B., Bertucci, D. C. & Shadduck, J. A. 1995. Identification and characterization of three Encephalitozoon cuniculi strains. Parasitology. 111 : 411–421.
10.1017/S0031182000065914
CAS PubMed Web of Science® Google Scholar
14 Didier, E. S., Visvesvara, G. S., Baker, M. D., Rogers, L. B., Bertucci, D.C., De Groote, M. A. & Vossbrinck, C. R. 1996. A microsporidian isolated from an AIDS patient corresponds to Encephalitozoon cuniculi III, originally isolated from domestic dogs. J Clin Microbiol. 34: 2835–2837.
10.1128/JCM.34.11.2835-2837.1996
CAS PubMed Web of Science® Google Scholar
15 Fischer, G., James, S. A., Roberts, I. N., Oliver, S. G. & Louis, E. J. 2000. Chromosomal evolution in Saccharomyces. Nature. 405: 451–454.
10.1038/35013058
CAS PubMed Web of Science® Google Scholar
16 Franzen, C. & Mailer, A. 1999. Molecular techniques for detection, species differentiation, and phylogenetic analysis of microsporidia. Clin Microbiol Rev. 12: 243–285.
10.1128/CMR.12.2.243
CAS PubMed Web of Science® Google Scholar
17 Freitas-Junior, L. H., Bottius, E., Pirrit, L. A., Dehsch, K. W., Scheidig, C, Guinet, F., Nehrbass, U., Wellems, T. E. & Scherf, A. 2000. Frequent ectopic recombination of virulence factor genes in telomeric chromosome clusters of P. falciparum. Nature. 407: 1018–1022.
10.1038/35039531
Google Scholar
18 Hinterberg, K., Muanza, K., Hernandezr-Rivas, R., Gay, F., Gysin, J., Mattei, D. & Scherf, A. 1995. Karyotype analysis of virulent Plasmodium falciparum strains propagated in Saimiri sciureus: strain adaptation leads to deletion of the RESA gene. Infect Immun. 63: 693–695.
CAS PubMed Web of Science® Google Scholar
19 Hollister, W. S., Canning, E. U. & Anderson, C. L. 1996. Identification of Microsporidia causing human disease. J Eukaryol Microbiol. 43: 104S–105S.
10.1111/j.1550-7408.1996.tb05026.x
CAS PubMed Web of Science® Google Scholar
20 Kemp, D. J., Thompson, J., Barnes, D. A., Triglia, T., Karamalis, R. Petersen, C., Brown, G. V. & Day, K. P. 1992. A chromosome 9 deletion in Plasmodium falciparum results in loss of cytoadherence. Mem Inst Oswaldo Cruz. 87-. 85S–89S.
10.1590/S0074-02761992000700011
Google Scholar
21 Mathis, A, Michel, M, Kuster, H, Muller, C. Weber, R, Deplazes, P. 1997. Two Encephalilozoon cuniculi strains of human origin are infectious to rabbits. Parasitology. 114: 29–35.
10.1017/S0031182096008177
PubMed Web of Science® Google Scholar
22 Peuvel, I.. Delbac, R, Metenier, G., Peyret, P., Vivares, C. P.. 2000. Polymorphism of the gene encoding a major polar tube protein PTPl in two microsporidia of the genus Encephalilozoon. Parasitology. 121: 581–587.
10.1017/S0031182000006910
CAS PubMed Web of Science® Google Scholar
23 Peyret, P., Katinka, M. D., Duprat, S., Duffieux, R, Barbe, V., Barbazanges, M., Weissenbach, J., Saurin, W., Vivarès, C. P. 2001. Sequence and analysis of chromosome I of the amitochondriate intracellular parasite Encephalilozoon cuniculi (Microspora). Genome Res. 11: 198–207.
10.1101/gr.164301
CAS PubMed Web of Science® Google Scholar

Citing Literature

Volume48, Issues1

June 2001

Pages 50s-55s

Inter-Strain Variability of Insertion/Deletion Events in the Encephalitozoon cuniculi Genome: A Comparative KARD-PFGE Analysis

Abstract