Typing of Panton-Valentine leukocidin-encoding phages carried by methicillin-susceptible and methicillin-resistant Staphylococcus aureus from Italy

Bacterial isolates

All the PVL-positive S. aureus isolates collected from April 2005 to May 2011 were examined in this study. Overall 48 PVL-positive S. aureus (25 MSSA, 52%, and 23 MRSA, 48%) were referred on a voluntary basis by 18 hospital laboratories located in seven different regions of north and central Italy. All the isolates had been obtained from severe infections or persistent or recurrent infections acquired in the community (Table 1).

The isolates were assayed for the presence of PVL and of mecA by PCR according to previously published methods 23.

The control isolates for phage typing were: S. aureus 81/108 (Φ108PVL), JCSC2958 (ΦSa2958), A980470 (ΦSLT), MW2 (ΦSa2mw) and USA300 FPR3757 (ΦSa2usa). As no control was available for ΦPVL, strain SauL94 (this study) was used as a control.

Molecular typing

Staphylococcus aureus genomic DNA was extracted with the QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany). Molecular typing was performed by protein A (spa) typing and multilocus sequence typing (MLST); the staphylococcal chromosome cassette (SCC) mec was typed in MRSA isolates 23.

PVL phage detection

Phage typing was performed following the sequential scheme of Ma et al. 15 that allows classification of elongated-head group and icosahedral-head group I phages. Briefly, the three steps of the scheme detected the morphological phage group, the linkage with PVL genes and the specific phage type, respectively. The original scheme, allowing identification of five phage types, was extended to include two more phage types, ΦSa2usa 15, 17 and ΦTCH60 26 (Table 2).

If the third set of PCR assays did not identify any specific phage type, PVL phages were identified only on the basis of the morphological group. If the PCR assays of the scheme of Ma yielded negative results, the presence of an unknown PVL phage was confirmed using the primers designed by Boakes et al. 17, targeting the conserved left and right junctions of the PVL prophage with the bacterial chromosome.

Prophage induction in strain Sau119 and electron microscopy analysis

To detect the presence of a functional phage in strain Sau119, mitomycin induction was performed. Briefly, Sau119 was grown in 10 mL of BHI broth at 37°C to a turbidity corresponding to OD₆₂₀ 0.3. Mitomycin C (Sigma-Aldrich, St Louis, MO, USA) was added to final concentrations of 0.6 μg/mL and the culture was incubated at 37°C until lysis occurred, as shown by a decrease in turbidity. Cellular debris was removed by centrifugation at 16 000 g for 15 min at 4°C; the filtered supernatant was ultracentrifuged at 100 000 g for 2 h at 4°C. The pellet obtained was washed twice in PBS and resuspended in 200 μL of PBS; this represented the phage preparation and was stored at −80°C until used. For transmission electron microscopy the phage preparation was deposited on carbon-coated copper grids, negatively stained with 2% potassium phosphotungstate at pH 7.0 and examined in a Philips EM 208 electron microscope.

DNA sequencing of the Sau119 phage and design of a new typing scheme

Phage DNA was extracted from 100 μL of the phage preparation using the QIAamp DNAMini Kit (QIAGEN). The nucleotide sequence was determined by applying the 454-Genome Sequencer FLX procedure (http://454.com/applications/whole-genome-sequencing/) to libraries constructed on phage DNA, producing >600 bp fragment reads. The draft genome was assembled by the GS De Novo Assembler v.2.6 software (Roche Diagnostic, Monza, Milan, Italy).

Automated gene annotation was performed by the web-based Rapid Annotation using Subsystems Technology (RAST) service 27. Annotation of relevant genes was manually curated based on annotated staphylococcal phage genomes available in the GenBank database. The nucleotide sequence of the PVL phage carried by Sau119 (ΦSa119) has been deposited in GenBank under the Accession no. KJ596420.

Blast similarity search against the nucleotide collection database and whole-genome shotgun contigs database was performed at the NCBI website.

On the basis of the sequence of ΦSa119, an additional typing scheme consistent with the sequential scheme of Ma et al. 15, allowing identification of icosahedral-head group II PVL phages including ΦSa119, was designed (Table 3).

Molecular typing of the isolates

Molecular typing revealed the presence of 27 different spa types, 18 among MSSA, 11 among MRSA, and two shared by both MSSA and MRSA. Eighteen different STs were found, five of which were shared by both MSSA and MRSA. The most prevalent MSSA clonal groups were CC30 and CC121, each comprising six out of 25 isolates (24.0%). The most prevalent MRSA clonal group was CC8 (10 out of 23 isolates, 43.5%), followed by CC80 (six out of 23 isolates, 26.0%) (Table 1).

PVL-phage typing

Applying the expanded PCR scheme of Ma, it was possible to detect a PVL phage and determine at least the morphological phage group (elongated-head group or icosahedral-head group I) in 45 out of 48 isolates (93.7%). The large majority of the PVL phages (34 out of 48, 70.8%) were elongated-head types. A specific PVL-phage type was identified in 33 isolates (68.7%); phage typeability was 48.0% in MSSA (12 out of 25) and 91.3% in MRSA (21 out of 23) (Table 1).

The most common phage type was ΦSa2usa, recovered in 15 isolates (31.2%), both MRSA and MSSA belonging to CC8 and CC5 (Table 1). ΦTCH60 was recovered in four isolates (8.3%), three MRSA belonging to CC30 and CC5 and one MSSA belonging to CC88.

Among the icosahedral-head group I, two MSSA isolates belonging to CC30 (Sau002 and Sau143) yielded amplicons with primers designed to detect Φ108PVL (intF-2/108-aR, Table 2); however, the fragments obtained were larger than expected (c. 5.6 kb instead of 4.3 kb). Sequences of the 3′ end of the amplicons were different and had identity with regions of different PVL phages (Φ7247PVL (Genbank Accession no. AP01195) for Sau002 phage and tp310-1 (Genbank Accession no. NC_009761.2) for Sau143 phage). Therefore the two phages were considered different variants of Φ108PVL and designated Φ108PVL_V1 and Φ108PVL_V2, respectively (Table 1).

In 12 out of 48 isolates (25.0%), it was only possible to determine the morphological phage group and not the specific PVL-phage type.

With three isolates, including one MRSA belonging to ST772 (Sau119), all the PCR assays of the typing scheme yielded negative results, and accordingly the phage type was defined as unknown. In these isolates, the presence of a PVL phage that was integrated into the same chromosomal site of known PVL phages was confirmed by PCR.

Characterization of PVL phage ΦSa119

Electron microscopy of the supernatant of a mitomycin-induced culture of Sau119 revealed the presence of viral particles consisting of a small icosahedral head and a long flexible tail that are characteristic of bacteriophages belonging to the Siphoviridae family 28 (Fig. 1).

Following 454 sequencing of the purified PVL phage of Sau119, a unique contig accounting for the phage sequence with a 300-fold coverage, was obtained by GS-FLX gsAssembler software.

The phage, designated ΦSa119, was 42 600 bp in size with a GC content of 33.4%. A 29-bp core sequence of the attP site (5′- ACCATCACATTATGATGATATAATTAGTC -3′) was identified corresponding to the 29-bp sequence found at the L junction of the integrated phage (data not shown). The integration site of ΦSa119 was inside a region corresponding to the hypothetical gene with locus tag SACOL1532 in the S. aureus COL chromosome (Genbank accession no. CP000046).

Blast analysis of ΦSa119 sequence towards Whole Genome Shotgun database revealed 99% identity with a region inside genomes of ST772 isolates from India, Malaysia and Australia, corresponding to a PVL phage named ΦIND772PVL 22. As observed in ΦIND772PVL and other ST772 PVL phages 22, 29, ΦSa119 contains sea, the enterotoxin A gene, located in a region close to the PVL genes. Sequence analysis also revealed 94% nucleotide identity between ΦSa119 and PVL phages found in ST59 isolates, including Φ7247PVL (Genbank accession no. AP011956) 21, 30, 31.

PVL phages present in both ST772 and ST59 strains belong to the icosahedral-head group II 21, 22 and are not detected by the PCR scheme of Ma. Therefore a new scheme for PVL phages present in both ST772 and ST59 strains of the icosahedral-head group II was designed exploiting the identity between the structural genes of ST772 and those of ST59 PVL phages. For the first set of PCR assays the morphological group was detected by a duplex PCR targeting the structural genes por, encoding for the portal protein, and mtp, encoding a tail protein (Table 3). For the second set of PCR, the linkage between the tail gene and the PVL genes was detected with a primer pair targeting mtp and lukS. The confirmatory PCR for the ST772 phage type (third set of PCR) was developed using primers targeting int and ant, the putative antirepressor that appears to be specific for ΦSa119 and other ST772 phages (Table 3). ΦSa119 was identified as an ST772 phage by this new typing scheme, while the two MSSA isolates that carried unknown PVL phages according to the scheme of Ma, did not yield any positive result.

When one PVL-positive ST59 S. aureus control isolate (not included in this study) was examined by icosahedral-head group II typing, amplicons were obtained with primer sets 1 and 2, of the same size as those obtained with ΦSa119, indicating that the new scheme is able to detect the PVL phage present in ST59 at the morphological level, but no amplicon was obtained with the PCR specific for the ST722 phage type. A new PCR specific for the ST59 PVL-phage type was designed using published primers targeting int and rep (Table 3). This assay gave a positive result, allowing the identification of the ST59 PVL-phage type (not shown).