The pathogenic fungus Trichosporon asahii causes fatal deep-seated mycosis in immunocompromised patients. Calcineurin, which is widely conserved in eukaryotes, regulates cell growth and various stress responses in fungi. Tacrolimus (FK506), a calcineurin inhibitor, induces sensitivity to compounds that cause stress on the cell membrane and cell wall integrity. In this study, we demonstrated that FK506 affects stress responses and hyphal formation in T. asahii. In silico structural analysis revealed that amino acid residues in the binding site of the calcineurin–FKBP12 complex that interact with FK506 are conserved in T. asahii. The growth of T. asahii was delayed by FK506 in the presence of SDS or Congo red but not in the presence of calcium chloride. FK506 also inhibited hyphal formation in T. asahii. A mutant deficient of the cnb gene, which encodes the regulatory subunit B of calcineurin, exhibited stress sensitivities on exposure to SDS and Congo red and reduced the hyphal forming ability of T. asahii. In the cnb-deficient mutant, FK506 did not increase the stress sensitivity or reduce hyphal forming ability. These results suggest that FK506 affects stress responses and hyphal formation in T. asahii via the calcineurin signaling pathway.

Abbreviations

CnA: calcineurin catalytic subunit A
CnB: calcineurin regulatory subunit B
FK506: tacrolimus
PCR: polymerase chain reaction
PDB: Protein Data Bank
TIMM: Teikyo University Institute Medical Mycology
UTR: untranslated region
WT: wild type
YPD: yeast–peptone–dextrose

INTRODUCTION

Trichosporon asahii is the major causative agent of deep-seated trichosporonosis, which is common in patients with neutropenia and has a case fatality rate of over 70%.^{1, 2} T. asahii can change its morphology from yeast to hyphae and arthroconidia.³ Hyphae and arthroconidia are observed in lesion tissue on histopathological examination⁴ and play an important role in biofilm formation in T. asahii.^{5, 6} T. asahii needs to adapt to the host environment during infection. Therefore, inhibiting a crucial factor that regulates stress responses and hyphal formation in T. asahii could prevent infections.

The calcineurin signaling pathway is widely conserved in eukaryotes from yeast to humans and regulates various stress responses.^7-9 Calcineurin is a calcium-dependent activated serine/threonine protein phosphatase that is composed of catalytic subunit A (CnA) and regulatory subunit B (CnB).¹⁰ The calcium–calmodulin complex, which is formed in response to increasing intracellular calcium concentrations, activates calcineurin.^{8, 11} The calcineurin signaling pathway controls hyphal formation, cell wall synthesis, drug resistance, and serum proliferation in Candida spp.—representative dimorphic fungi—and cell membrane and cell wall syntheses, cation homeostasis, and thermotolerance in Cryptococcus spp.—pathogenic basidiomycetes.^{12, 13} T. asahii, which is a dimorphic fungus and basidiomycete, also possibly exhibits similar stress responses.¹⁴

FK506 (tacrolimus), a calcineurin inhibitor, is an immunosuppressant agent intended to prevent allograft rejection in patients who undergo organ transplantation.¹⁵ It binds to its immunophilin FKBP12 to form the FK506–FKBP12 complex that inhibits calcineurin.^{16, 17} FK506 inhibits morphological changes in Candida spp.^18-20 and leads to thermosensitivity in Cryptococcus neoformans.^{12, 21, 22}

In this study, we demonstrated that FK506 and cnb deficiency caused sensitivity to stress inducers such as SDS and Congo red and reduced hyphal formation in T. asahii. Moreover, FK506 did not aggravate stress sensitivity or hyphal formation in the cnb-deficient mutant of T. asahii. Therefore, FK506 might affect T. asahii cells via the calcineurin signaling pathway.

MATERIALS AND METHODS

Comparing amino acid sequences

The structure of C. neoformans calcineurin–FKBP12 complex with FK506 (PDB ID: 6TZ8) was obtained from the Protein Data Bank (https://www.rcsb.org). The structural information was analyzed using PyMoL version 2.5.2, and the FK506 binding site was estimated. The amino acid sequences of CnA, CnB, and FKBP12 in C. neoformans and T. asahii were obtained from the National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov). The GenBank IDs of CnA, CnB, and FKBP12 in C. neoformans are AFR97420.1, AFR95242.1, and AFR93187.1, respectively. The GenBank IDs of CnA, CnB, and FKBP12 in T. asahii are XP_014176335.1, XP_014180618.1, and XP_014177827.1, respectively. Amino acid sequence alignment was performed using CLUSTALW (https://www.genome.jp/tools-bin/clustalw).

Strains

The strains used in the present study are listed in Table 1. The T. asahii TIMM1318 (where TIMM stands for Teikyo University Institute Medical Mycology) strain obtained from the culture collection of TIMM was used as the parent strain. The cnb-deficient mutant was constructed via homologous recombination in T. asahii TIMM1318 according to a previously described method on C. neoformans.²³ To generate the cnb-deficient strain, a DNA fragment (5′-UTR-NAT1–3′-UTR) containing the upstream 5′-untranslated region (UTR) and downstream 3′-UTR of cnb and the marker gene NAT1 was prepared using a polymerase chain reaction (PCR)-based method. To generate revertants, a DNA fragment (5′-UTR-cnb-hph-3′-UTR) containing the 5′-UTR, cnb, 3′-UTR, and the marker gene hph was prepared using the same PCR-based method. The sequences of primers used for the PCR amplification of each DNA fragment are listed in Table 2. DNA delivery into T. asahii cells was performed via biolistic transformation.²⁴ In brief, T. asahii TIMM1318 or cnb-deficient mutant cell suspensions were each spread on yeast–peptone–dextrose (YPD; 1% yeast extract, 2% peptone, 2% glucose, 2% agar) plates supplemented with 0.7 M NaCl. DNA samples were prepared by combining 600 µg of gold microcarrier beads (0.6 µm; No. 165–2262; Bio-Rad, CA, USA) with 1–4 µg of DNA, 10 µL of 2.5 M CaCl₂, and 2 µL of 1 M spermidine. The plates were then bombarded with the DNA-bound gold microcarrier beads in a Bio-Rad biolistic transformation apparatus at a helium gas pressure of approximately 1350 psi under a vacuum level of 29 in. of Hg. The plates were incubated at 27°C for 24 h, and liquified YPD medium with 0.7% agar containing nourseothricin (200 µg/mL) or hygromycin (200 µg/mL) was overlaid, and the plates were further incubated at 27°C for 3–5 days until antibiotic-resistant transformants appeared on the surface of the overlaid medium. Nourseothricin and hygromycin were purchased from Jena Bioscience GmbH (Thuringia, Germany) and FUJIFILM Wako Pure Chemical Corporation (Osaka, Japan), respectively. The strains were grown on Sabouraud dextrose agar (1% peptone, 4% glucose, 1.5% agar) at 27°C.

Table 1. Trichosporon asahii strains used in this study

Strains	Relevant genotype	Background	Source
Wild-type		TIMM1318	TIMM culture collection
∆cnb	cnb::NAT1	TIMM1318	This study
Rev10	cnb::NAT1, cnb, hph	TIMM1318 ∆cnb	This study
Rev12	cnb::NAT1, cnb, hph	TIMM1318 ∆cnb	This study

Table 2. Sequences of primers used in this study

Primer	Sequence (5′-3′)
For cnb-deficient mutant
F cnb (5′-UTR)	TGAACTAGTCCGTGATCTGCTGCACGTTCGGGTCC
R cnb (5′-UTR)	AAAGGGCCCAAGATCTAGTGATAGATGTGTGGAGA
F cnb (3′-UTR)	CTGGGATCCGCGCGCACACACGGATGTGAGCGTAA
R cnb (3′-UTR)	CGCGGTACCACTGTTCACCTCTGGCATTGTTACGA
For revertants
TaCNA-F1/SpeI	TGAACTAGTCCGTGATCTGCTGCACGTTCGGGTCC
TaCNB-R2(-KpnI)	GTGCGTGCGCGGTACTCACGATCGGTGTAATAGC
TaCNB-F2(-KpnI)	GCTATTACACCGATCGTGAGTACCGCGCACGCAC
TaCNB-R6/ApaI	TACGCTCACATCCGTGTTTGGGCCCTTAGAACAGG
CnPactin(F)ApaI	TTTGGGCCCCCTGCGAGGATGTGAGCTGGAGAGCG
CnPact-hph(R)	GAGTTCAGGCTTTTTCATACGCGTAGACATGTTGG
CnPact-hph(F)	CCAACATGTCTACGCGTATGAAAAAGCCTGAACTC
hph-Ttrp1(R)	ACCGCCTTCACGAATTCCTATTCCTTTGCCCTCGG
hph-Ttrp1(F)	CCGAGGGCAAAGGAATAGGAATTCGTGAAGGCGGT
Ttrp1(R)BamHI	AAAGGATCCGAAGAGATGTAGAAACTAGC

Hyphal formation assay

Sabouraud dextrose agar containing FK506 (0.1 µg/mL) or DMSO (control) was prepared. T. asahii cell suspensions (A₆₃₀ = 0.1) were prepared using a spectrophotometer (AS ONE, Osaka, Japan), spotted onto the above media, and incubated at 27°C or 37°C for 4 days. The edges of the colonies were then observed using an optical microscope (Olympus corporation, Tokyo, Japan). FK506 was purchased from Cayman Chemical Company (MI, USA) and FUJIFILM Wako Pure Chemical Corporation (Osaka, Japan).

Temperature tolerance test

Cell suspensions (A₆₃₀ = 0.2) were serially diluted 10-fold. Cell suspensions of each concentration were spotted onto YPD agar plates and incubated at 27°C, 37°C, or 39°C for 24 or 48 h.

Drug sensitivity test

YPD agar containing SDS (0.005%), Congo red (0.1 and 1 mg/mL), CaCl₂ (400 mM), or FK506 (0.1 µg/mL) were prepared. Cell suspensions (A₆₃₀ = 0.2) were serially diluted 10-fold. Ten microliters of each concentration of the cell suspension were spotted onto the above media and incubated at 27°C or 37°C for 24 h.

RESULTS

Conservation of amino acids of the calcineurin–FKBP12 complex for FK506 binding

In C. neoformans, the binding site of the calcineurin–FKBP12 complex to FK506 was determined using crystal structure analysis (Figure 1a).²⁵ We examined whether the amino acids of the calcineurin–FKBP12 complex are conserved in T. asahii. The homology of the amino acid sequences of the calcineurin–FKBP12 complex between C. neoformans and T. asahii was more than 60% for each protein (Table 3). The amino acids associated with FK506 binding in the calcineurin–FKBP12 complex of C. neoformans are depicted in Figure 1b. Trp382 (W382) of CnA, and Tyr53 (Y53), Asp64 (D64), Gln81 (Q81), Ile83 (I83), and Tyr109 (Y109) of FKBP12 in C. neoformans were close to FK506 (Figure 1b). The results of the amino acid alignment analysis indicate that these amino acids are conserved in the calcineurin–FKBP12 complex of T. asahii (Figure 1c). These findings also suggest that the calcineurin–FKBP12 complex of T. asahii interacts with FK506.

Details are in the caption following the image — **Figure 1**
Open in figure viewer PowerPoint

Conservation of amino acids related to FK506 binding in *Trichosporon asahii*. (a) Structure of the *Cryptococcus neoformans* calcineurin–FKBP12 complex with FK506. (b) Amino acids related to FK506 binding in the calcineurin–FKBP12 complex of *C. neoformans*. (c) Alignment of amino acids related to FK506 binding in the calcineurin–FKBP12 complex of *T. asahii*. Red letters indicate the amino acids related to FK506 binding. Yellow shading indicates the amino acids that are identical.

Table 3. Comparison of the conserved amino acid sequences of CnA, CnB, and FKBP12 between Trichosporon asahii and Cryptococcus neoformans

Protein	Description	Query cover (%)a	Identity (%)a
CnA	Serine/threonine-protein phosphatase 2B catalytic subunit A1	99	77.23
CnB	Calcium-dependent protein serine/threonine phosphatase	100	94.86
FKBP12	Macrolide-binding protein FKBP12	100	63.87

^a Query cover and percentage identity were determined and compared with the amino acid sequence of C. neoformans.

Effects of FK506 on T. asahii

The calcineurin pathway regulates tolerance to high temperatures, membrane and cell wall stress, and cation homeostasis in Cryptococcus spp.^{13, 26, 27} We investigated whether FK506 induced stress sensitivity in T. asahii. The wild-type T. asahii strain TIMM1318 demonstrated retarded growth after FK506 treatment, especially at 39°C (Figure 2). In the presence of SDS, a cell membrane stress inducer, FK506 delayed the growth of T. asahii at both of 27°C and 37°C (Figure 3). In the presence of Congo red, a cell wall stress inducer, FK506 inhibited the growth compared with that seen in the absence of FK506 (control) at both temperatures (Figure 3). Although Congo red (1 mg/mL) affected the growth of T. asahii at 37°C in the absence of FK506, the growth inhibition was more severe in the presence of FK506 (Figure 3). By contrast, CaCl₂, a calcium stress inducer, did not affect the growth in the presence or absence of FK506 (Figure 3). Moreover, we investigated whether FK506 affected the morphological change in T. asahii as the calcineurin signaling is required for hyphal growth of the representative dimorphic fungi, Candida spp.^{18, 20, 28} Hyphal formation of T. asahii was inhibited by FK506 at both 27°C and 37°C (Figure 4). These results suggest that FK506 has the potential to decrease stress tolerance and inhibit hyphal formation in T. asahii.

Phenotypic analyses of the cnb-deficient mutant under stress conditions

CnB is an essential component of the calcineurin pathway in C. neoformans.²⁹ In Cryptococcus spp., the cnb gene-deficient mutant is sensitive to several stresses such as high temperature and cell wall damage.^{29, 30} To confirm the effect of FK506 was caused by inhibition of the calcineurin pathway, the same evaluations as those analyzed using the wild-type strain with FK506 treatment were performed using the cnb-deficient T. asahii mutant. The growth of the cnb-deficient mutant was delayed at 39°C (Figure 5a). Treatment with SDS, Congo red, and CaCl₂ delayed the growth of the cnb-deficient mutant at both 27°C and 37°C (Figure 5b). The mutant also showed reduced hyphal formation at both temperatures (Figure 5c). These phenotypes in the cnb-deficient mutant were restored in the revertant strains (Rev10 and Rev12), in which the cnb gene was reintroduced into the genome of the cnb-deficient mutant (Figure 5). In the cnb-deficient mutant, the growth in the presence of the aforementioned stressors and hyphal formation ability were not further decreased by the addition of FK506 (Figure 6). These results suggest that FK506 affects T. asahii via the calcineurin signaling pathway.

DISCUSSION

In this study, we demonstrated that FK506 induced sensitivity to high temperature, SDS, and Congo red in T. asahii. Moreover, FK506 inhibited hyphal growth in T. asahii. The cnb-deficient mutant, with a defective calcineurin signaling pathway, sensitized to high temperature, SDS, and Congo red and reduced hyphal formation, compared with the wild-type strain. FK506 was ineffective against sensitivity to high temperature, SDS, and Congo red in the cnb-deficient mutant. Our findings suggest that FK506 inhibits stress responses and hyphal formation via the calcineurin signaling pathway in T. asahii.

Structural analyses of mammalian and fungal calcineurin molecules revealed amino acid residues in the binding site of the calcineurin–FKBP12 complex that interact with FK506.^{25, 31} Trp382 of CnA and Tyr53, Asp64, Gln81, Ile83, and Tyr109 of FKBP12 in C. neoformans were conserved in the calcineurin–FKBP12 complex of T. asahii (Figure 1c). Therefore, we assumed that FK506 might also interact with the calcineurin–FKBP12 complex of T. asahii and affect the cellular activities of this fungus.

Growth ability at over 37°C, which is human body temperature, is a key factor for virulence of pathogens. In basidiomycete Cryptococcus spp., calcineurin regulates thermotolerance.^{26, 27} C. neoformans and Cryptococcus gattii cannot grow above 37°C in the presence of calcineurin inhibitors or when the cells are calcineurin deficient.^{26, 27} However, FK506 did not affect the growth of Ascomycota fungus, Candida spp., except for some strains of Candida glabrata.⁹ In T. asahii, cell growth at 39°C was slightly delayed by FK506 treatment (Figure 2) and cnb deletion (Figure 5a). The results indicate that T. asahii, a Basidiomycota fungus, regulates thermotolerance through the calcineurin pathway, which is a common property of C. neoformans, although the regulation is weaker in T. asahii. While the cnb deletion strain delayed growth at 39°C, the growth of revertant strains did not recover as much as that of the wild-type strain (Figure 5a). To understand this phenomenon, the transcriptional expression level of the cnb gene was measured. The cnb gene expression was upregulated (3.8-fold) in Rev10 and downregulated (0.2-fold) in Rev12 compared with the wild type (Supporting Information Figure S1). Calcineurin forms a complex with Cna and Cnb subunits, and then dephosphorylates target molecules. The expression level of each subunit within a protein complex is ultimately determined in balance for appropriate cellular performance. Overexpression of only one subunit within a complex may trigger disruption of stoichiometric balance, which causes cellular defects.³² Rev10 may not express appropriate calcineurin function because of stoichiometric imbalance. By contrast, the calcineurin function of Rev12 did not reach the level of the wild type because of the lower expression level of the cnb gene.

In fungi, the calcineurin signaling pathway regulates several physiological maintenance activities and responses such as cell membrane and cell wall synthesis.¹² FK506 treatment and cnb deletion caused increased sensitivity to SDS and Congo red in T. asahii (Figures 3 and 5b). A transient increase of Ca²⁺ concentration in cytoplasm is stress for cells, which is sensed by calmodulin. This subsequently activates calcineurin. The calcineurin signaling pathway also regulates calcium transport to reduce intracellular Ca²⁺ concentrations in Cryptococcus spp.^{13, 30, 33} By contrast, calcineurin functions as a negative regulator against Ca²⁺ tolerance in Saccharomyces cerevisiae and C. glabrata.^{34, 35} In this study, we investigated whether the calcineurin pathway of T. asahii responds to calcium stress. The effect of calcium stress on T. asahii differed between FK506 treatment (Figure 3) and cnb deletion (Figure 5b). Therefore, the lack of cnb might also affect the calcium homeostasis system, independent of the effects of FK506. Further studies are required to determine the exact mechanism.

T. asahii is a dimorphic fungus, which forms yeast, hyphae, and arthroconidia. In Candida spp., the representative dimorphic fungi, calcineurin signaling is required for hyphal growth,^{18, 20, 28} although the effect in Candida albicans depends on the experimental conditions and strain backgrounds.^{36, 37} In C. albicans, hyphal development is related to severe infections.³⁸ Hyphae of T. asahii are observed in blood vessels and may cause necrotic thrombi.³⁹ The present study results showed that FK506 treatment and cnb deletion inhibited hyphal formation in T. asahii (Figures 4 and 5c). By contrast, FK506 did not further decrease the growth and hyphal formation of the cnb lacking mutant (Figure 6). Unexpectedly, FK506 slightly improved the growth of the cnb-deficient mutant in the presence of Congo red. FK506 might also inhibit/promote calcineurin-independent pathways, which have an antagonistic function against cell wall stress. However, effects of FK506 on calcineurin-independent pathways were considered to be weak because FK506 inhibited the growth of the wild type in the presence of Congo red (Figure 3). These results suggest that FK506 inactivates the calcineurin molecule in T. asahii, resulting in the inhibition of stress tolerance and hyphal formation. Therefore, we hypothesize that calcineurin inhibitors are potential drugs against T. asahii infections. FK506 suppresses the immune system by blocking T-cell activation in humans, and this effect should be eliminated when used as a drug against fungal infections. Odom et al.²² have reported a nonimmunosuppressive FK506 analog (L-685,818) that exhibited the same antifungal action as FK506 against C. neoformans. Juvvadi et al.²⁵ have developed the FK506 analog APX879 that inhibits the Aspergillus fumigatus calcineurin but has reduced immunosuppressive activity against murine CD4⁺ T cells. Future studies on the antimicrobial activity of nonimmunosuppressive FK506 analogs against T. asahii holds high significance.

In conclusion, FK506 inhibits calcineurin, which controls morphological changes and various stress responses in T. asahii. The inhibition of calcineurin in T. asahii leads to reduced hyphal formation that could be associated with T. asahii virulence. The findings suggest that FK506 derivatives, which do not affect mammalian calcineurin, are potential drugs to treat T. asahii infections.

ACKNOWLEDGMENTS

This study was supported in part by the Japan Society for the Promotion of Science (JSPS; grant number JP20K16000 to S. K.) and in part by the Research Program on Emerging and Re-emerging Infectious Diseases of the Japan Agency for Medical Research and Development (AMED; grant number JP20fk0108135h0201 to T.S.).

CONFLICTS OF INTEREST

The authors declare no conflict of interest.

Open Research

DATA AVAILABILITY STATEMENT

The data supporting the findings of this study are available from the corresponding author upon reasonable request.

Supporting Information

REFERENCES

1Girmenia C, Pagano L, Martino B, et al. Invasive infections caused by Trichosporon species and Geotrichum capitatum in patients with hematological malignancies: a retrospective multicenter study from Italy and review of the literature. J Clin Microbiol. 2005; 43: 1818–28.
10.1128/JCM.43.4.1818-1828.2005
PubMed Web of Science® Google Scholar
2Suzuki K, Nakase K, Kyo T, et al. Fatal Trichosporon fungemia in patients with hematologic malignancies. Eur J Haematol. 2010; 84: 441–7.
10.1111/j.1600-0609.2010.01410.x
CAS PubMed Web of Science® Google Scholar
3Colombo AL, Padovan ACB, Chaves GM. Current knowledge of Trichosporon spp. and trichosporonosis. Clin Microbiol Rev. 2011; 24: 682–700.
10.1128/CMR.00003-11
CAS PubMed Web of Science® Google Scholar
4Sadamoto S, Shinozaki M, Nagi M, et al. Histopathological study on the prevalence of trichosporonosis in formalin-fixed and paraffin-embedded tissue autopsy sections by in situ hybridization with peptide nucleic acid probe. Med Mycol. 2020; 58: 460–8.
10.1093/mmy/myz096
CAS PubMed Web of Science® Google Scholar
5Kurakado S, Chiba R, Sato C, Matsumoto Y, Sugita T. N,N,N′,N′-tetrakis(2-pyridylmethyl)ethylenediamine, a zinc chelator, inhibits biofilm and hyphal formation in Trichosporon asahii. BMC Res Notes. 2020; 13: 142.
10.1186/s13104-020-04990-x
CAS PubMed Web of Science® Google Scholar
6Kurakado S, Miyashita T, Chiba R, Sato C, Matsumoto Y, Sugita T. Role of arthroconidia in biofilm formation by Trichosporon asahii. Mycoses. 2021; 64: 42–7.
10.1111/myc.13181
CAS PubMed Web of Science® Google Scholar
7Stewart AA, Ingebritsen TS, Manalan A, Klee CB, Cohen P. Discovery of A Ca²⁺-and calmodulin-dependent protein phosphatase. FEBS Lett. 1982; 137: 80–4.
10.1016/0014-5793(82)80319-0
CAS PubMed Web of Science® Google Scholar
8Rusnak F, Mertz P. Calcineurin: form and function. Physiol Rev. 2000; 80: 1483–521.
10.1152/physrev.2000.80.4.1483
CAS PubMed Web of Science® Google Scholar
9Yu SJ, Chang YL, Chen YL. Calcineurin signaling: lessons from Candida species. FEMS Yeast Res. 2015; 15: 1–7.
10.1093/femsyr/fov016
Web of Science® Google Scholar
10Creamer TP. Calcineurin. Cell Commun Signaling. 2020; 18: 137.
10.1186/s12964-020-00636-4
CAS PubMed Web of Science® Google Scholar
11Klee CB, Ren H, Wang X. Regulation of the calmodulin-stimulated protein phosphatase, calcineurin. J Biol Chem. 1998; 273: 13367–70.
10.1074/jbc.273.22.13367
CAS PubMed Web of Science® Google Scholar
12Juvvadi PR, Lee SC, Heitman J, Steinbach WJ. Calcineurin in fungal virulence and drug resistance: prospects for harnessing targeted inhibition of calcineurin for an antifungal therapeutic approach. Virulence. 2017; 8: 186–97.
10.1080/21505594.2016.1201250
CAS PubMed Web of Science® Google Scholar
13Chow EWL, Clancey SA, Billmyre RB, et al. Elucidation of the calcineurin-Crz1 stress response transcriptional network in the human fungal pathogen Cryptococcus neoformans. PLoS Genet. 2017; 13:e1006667.
10.1371/journal.pgen.1006667
PubMed Web of Science® Google Scholar
14Duarte-oliveira C, Rodrigues F, Gonçalves SM, Goldman GH, Carvalho A, Cunha C. The cell biology of the Trichosporon -host interaction. Front Cell Infect Microbiol. 2017; 7: 118.
10.3389/fcimb.2017.00118
PubMed Web of Science® Google Scholar
15Azzi JR, Sayegh MH, Mallat SG. Calcineurin inhibitors: 40 years later, can't live without …. J Immunol. 2013; 191: 5785–91.
10.4049/jimmunol.1390055
CAS PubMed Web of Science® Google Scholar
16Liu J, Farmer JD, Lane WS, Friedman J, Weissman I, Schreiber SL. Calcineurin is a common target of cyclophilin-cyclosporin A and FKBP-FK506 complexes. Cell. 1991; 66: 807–15.
10.1016/0092-8674(91)90124-H
CAS PubMed Web of Science® Google Scholar
17Ke H, Huai Q. Structures of calcineurin and its complexes with immunophilins- immunosuppressants. Biochem Biophys Res Commun. 2003; 311: 1095–102.
10.1016/S0006-291X(03)01537-7
CAS PubMed Web of Science® Google Scholar
18Chen YL, Brand A, Morrison EL, et al. Calcineurin controls drug tolerance, hyphal growth, and virulence in Candida dubliniensis. Eukaryot Cell. 2011; 10: 803–19.
10.1128/EC.00310-10
CAS PubMed Web of Science® Google Scholar
19Zhang J, Silao FGS, Bigol UG, et al. Calcineurin is required for pseudohyphal growth, virulence, and drug resistance in Candida lusitaniae. PLoS One. 2012; 7:e44192.
10.1371/journal.pone.0044192
CAS PubMed Web of Science® Google Scholar
20Chen YL, Yu SJ, Huang HY, et al. Calcineurin controls hyphal growth, virulence, and drug tolerance of Candida tropicalis. Eukaryot Cell. 2014; 13: 844–54.
10.1128/EC.00302-13
PubMed Google Scholar
21Cardenas ME, Muir RS, Breuder T, Heitman J. Targets of immunophilin-immunosuppressant complexes are distinct highly conserved regions of calcineurin A. EMBO J. 1995; 14: 2772–83.
10.1002/j.1460-2075.1995.tb07277.x
CAS PubMed Web of Science® Google Scholar
22Odom A, Del Poeta M, Perfect J, Heitman J. The immunosuppressant FK506 and its nonimmunosuppressive analog L- 685,818 are toxic to Cryptococcus neoformans by inhibition of a common target protein. Antimicrob Agents Chemother. 1997; 41: 156–61.
10.1128/AAC.41.1.156
CAS PubMed Web of Science® Google Scholar
23Toh-e A, Ohkusu M, Shimizu K, Ishiwada N, Watanabe A, Kamei K. Novel biosynthetic pathway for sulfur amino acids in Cryptococcus neoformans. Curr Genet. 2018; 64: 681–96.
10.1007/s00294-017-0783-7
CAS PubMed Web of Science® Google Scholar
24Toffaletti DL, Rude TH, Johnston SA, Durack DT, Perfect JR. Gene transfer in Cryptococcus neoformans by use of biolistic delivery of DNA. J Bacteriol. 1993; 175: 1405–11.
10.1128/jb.175.5.1405-1411.1993
CAS PubMed Web of Science® Google Scholar
25Juvvadi PR, Fox D, Bobay BG, et al. Harnessing calcineurin-FK506-FKBP12 crystal structures from invasive fungal pathogens to develop antifungal agents. Nat Commun. 2019; 10: 4275.
10.1038/s41467-019-12199-1
PubMed Web of Science® Google Scholar
26Chen YL, Lehman VN, Lewit Y, Averette AF, Heitman J. Calcineurin governs thermotolerance and virulence of Cryptococcus gattii. G3. 2013; 3: 527–39.
10.1534/g3.112.004242
Web of Science® Google Scholar
27Odom A. Calcineurin is required for virulence of Cryptococcus neoformans. EMBO J. 1997; 16: 2576–89.
10.1093/emboj/16.10.2576
CAS PubMed Web of Science® Google Scholar
28Sanglard D, Ischer F, Marchetti O, Entenza J, Bille J. Calcineurin A of Candida albicans: involvement in antifungal tolerance, cell morphogenesis and virulence. Mol Microbiol. 2003; 48: 959–76.
10.1046/j.1365-2958.2003.03495.x
CAS PubMed Web of Science® Google Scholar
29Fox DS, Cruz MC, Sia RAL, et al. Calcineurin regulatory subunit is essential for virulence and mediates interactions with FKBP12-FK506 in Cryptococcus neoformans. Mol Microbiol. 2001; 39: 835–49.
10.1046/j.1365-2958.2001.02295.x
CAS PubMed Web of Science® Google Scholar
30Fu C, Donadio N, Cardenas ME, Heitman J. Dissecting the roles of the calcineurin pathway in unisexual reproduction, stress responses, and virulence in Cryptococcus deneoformans. Genetics. 2018; 208: 639–53.
10.1534/genetics.117.300422
CAS PubMed Web of Science® Google Scholar
31Griffith JP, Kim JL, Kim EE, et al. X-ray structure of calcineurin inhibited by the immunophilin-immunosuppressant FKBP12-FK506 complex. Cell. 1995; 82: 507–22.
10.1016/0092-8674(95)90439-5
CAS PubMed Web of Science® Google Scholar
32Moriya H. Quantitative nature of overexpression experiments. Mol Biol Cell. 2015; 26: 3932–9.
10.1091/mbc.E15-07-0512
CAS PubMed Web of Science® Google Scholar
33Kmetzsch L, Staats CC, Cupertino JB, et al. The calcium transporter Pmc1 provides Ca²⁺ tolerance and influences the progression of murine cryptococcal infection. FEBS J. 2013; 280: 4853–64.
10.1111/febs.12458
CAS PubMed Web of Science® Google Scholar
34Withee JL, Sen R, Cyert MS. Ion tolerance of Saccharomyces cerevisiae lacking the Ca²⁺/CaM- dependent phosphatase (calcineurin) is improved by mutations in URE2 or PMA1. Genetics. 1998; 149: 865–78.
10.1093/genetics/149.2.865
CAS PubMed Web of Science® Google Scholar
35Chen YL, Konieczka JH, Springer DJ, et al. Convergent evolution of calcineurin pathway roles in thermotolerance and virulence in Candida glabrata. G3. 2012; 2: 675–91.
10.1534/g3.112.002279
CAS PubMed Web of Science® Google Scholar
36Blankenship JR, Wormley FL, Boyce MK, et al. Calcineurin is essential for Candida albicans survival in serum and virulence. Eukaryotic Cell. 2003; 2: 422–30.
10.1128/EC.2.3.422-430.2003
CAS PubMed Web of Science® Google Scholar
37Bader T, Schröppel K, Bentink S, Agabian N, Köhler G, Morschhäuser J. Role of calcineurin in stress resistance, morphogenesis, and virulence of a Candida albicans wild-type strain. Infect Immun. 2006; 74: 4366–9.
10.1128/IAI.00142-06
CAS PubMed Web of Science® Google Scholar
38Naglik JR, König A, Hube B, Gaffen SL. Candida albicans–epithelial interactions and induction of mucosal innate immunity. Curr Opin Microbiol. 2017; 40: 104–12.
10.1016/j.mib.2017.10.030
CAS PubMed Web of Science® Google Scholar
39Mada PK, Ayoade F, Li A, Todd J. Trichosporon asahii septic thrombophlebitis following lower extremity amputation in an immunocompetent host. BMJ Case Rep. 2018; 2018:bcr2017221441.
10.1136/bcr-2017-221441
PubMed Google Scholar

Citing Literature

Volume67, Issue2

February 2023

Pages 49-57

Tacrolimus inhibits stress responses and hyphal formation via the calcineurin signaling pathway in Trichosporon asahii