Phenotypic and genomic analysis of serotype 3 sabin poliovirus vaccine produced in MRC-5 Cell substrate
Abstract
The cell substrate has a pivotal role in live virus vaccines production. It is necessary to evaluate the effects of the cell substrate on the properties of the propagated viruses, especially in the case of viruses which are unstable genetically such as polioviruses, by monitoring the molecular and phenotypical characteristics of harvested viruses. To investigate the presence/absence of mutation(s), the near full-length genomic sequence of different harvests of the type 3 Sabin strain of poliovirus propagated in MRC-5 cells were determined. The sequences were compared with genomic sequences of different virus seeds, vaccines, and OPV-like isolates. Nearly complete genomic sequencing results, however, revealed no detectable mutations throughout the genome RNA-plaque purified (RSO)-derived monopool of type 3 OPVs manufactured in MRC-5. Thirty-six years of experience in OPV production, trend analysis, and vaccine surveillance also suggest that: (i) different monopools of serotype 3 OPV produced in MRC-5 retained their phenotypic characteristics (temperature sensitivity and neuroattenuation), (ii) MRC-5 cells support the production of acceptable virus yields, (iii) OPV replicated in the MRC-5 cell substrate is a highly efficient and safe vaccine. These results confirm previous reports that MRC-5 is a desirable cell substrate for the production of OPV. J. Med. Virol. 83:897–903, 2011. © 2011 Wiley-Liss, Inc.
Abbreviations used:
BSA, bovine serum albumin; CCID50, cell culture infectious dose50; CV, coefficient of variation; DMEM, Dulbecco's modified Eagle's medium; EPI, Expanded Program on Immunization; MAPREC, mutant analysis by PCR and restriction enzyme cleavage; MNVT, monkey neurovirulence test; MOI, multiplicity of infection; MRC-5 cells, Medical Research Council 5 cells; OPV, oral polio vaccine; pi, post-infection; PMKC, primary monkey kidney cell; PV, poliovirus; QC, quality control; rct, reproductive capacity of growth at different temperatures; RT-PCR, reverse transcription polymerase chain reaction; SD, standard deviation; SV40, Simian virus 40; WHO, World Health Organization; WI38 cells, Wistar Institute 38 cells.
INTRODUCTION
Polioviruses (PVs) belong to the genus Enterovirus of the family Picornaviridae, a name that signifies its small size, and the RNA nature of the genome of picornaviruses. PVs have been classified into three distinct serotypes, namely, types 1–3 according to their reaction with neutralizing antibodies [Bodian et al., 1949]. The PVs are non-enveloped with a linear, non-segmented positive-strand RNA of approximately 7.5 kb [Racaniello, 2007]. Like most RNA viruses, genomes of PVs are adaptable and variable in their nucleotide composition and sequences [Gavrilin et al., 2000; Agol, 2006a,b]. PV genome variations are caused possibly by non-replicative alterations, that is, recombination and point mutations, as well as errors which occur during viral replication, such as point mutations, slippage, and rearrangements, which have been reviewed [Agol, 2006a]. This high rate of genetic variability [especially in serotype 3 which reverts to neurovirulent phenotype more often than the other two serotypes, Sabin, 1965; Fogel and Plotkin, 1968; Dunn et al., 1990; Contreras et al., 1992; Strebel et al., 1992] occurs during propagation and passage in tissue cultures [Minor, 1992; Chumakov et al., 1994; Chezzi et al., 1998; Guillot et al., 2000; Kew et al., 2005] and/or organisms (e.g., human/animal intestinal tract) [Melnick et al., 1959; MacLeod, 1966; Jarzabek et al., 1976, 1977; Kew et al., 1981, 2002, 2005; Evans et al., 1985; Hamada et al., 1988; Macadam et al., 1989; Dunn et al., 1990; Tatem et al., 1991; Contreras et al., 1992; Minor, 1992, 1999, 2009; Gavrilin et al., 2000; Martín et al., 2004; Minor et al., 2005; Agol, 2006b; Nathanson, 2008; Wringe et al., 2008; Thorley et al., 2009] and are generally referred to as quasispecies. The virus that has been inoculated recently to a new cell culture may require the accumulation of variations, which enable it to adapt and replicate preferentially in the new cells (selective advantage in new environments), as well as variations which occur randomly. Thus, it has been found that the critical parameter for oral polio vaccine (OPV) production is less than 96 hr at temperatures between 33 and 35°C of incubation of the cultures [Wood and Macadam, 1997; WHO, 2002]. However, it is necessary to examine the effects of new cell culture substrate on the properties of the viruses by monitoring the phenotypic and molecular characteristics [Tatem et al., 1991; Minor, 1992; Chumakov et al., 1994; Mallet et al., 1997; WHO, 2002].
OPV is produced mainly in Vero cells or in primary monkey kidney cells (PMKCs) derived from rhesus, patas, and green monkeys. These primates are natural hosts to a wide variety of viruses [Lerche, 2005]. The use of PMKCs increases the risk of contamination of the vaccine with adventitious agents, for example, Simian virus 40 (SV40); whereas well characterized human diploid cells, such as MRC-5 and WI38, are safer [Cutrone et al., 2005] and reduce significantly the risks of adding an adventitious agent during production. MRC-5 and WI38 cells have also been favored as cell substrates because they are easily propagated in large scale and the viruses grow in them with an acceptable yield.
Although the previous studies based on monkey neurovirulence test (MNVT), MAPREC (analysis by PCR and restriction enzyme cleavage), and clinical trials [Mirchamsy et al., 1981; Mirchamsy and Shafyi, 1984; Prikazsky et al., 2005] have shown that OPV vaccines produced in MRC-5 are safe and effective, the complete genome sequence of this vaccine remains to be identified. The complete genome sequence of vaccine seeds, OPV3 propagated in some other cells, several OPV-like and Sabin vaccine-derived polioviruses (VDPVs) have been determined [Stanway et al., 1983, 1984; Almond et al., 1984, 1987; Cann et al., 1984; Toyoda et al., 1984; Rezapkin et al., 1995; Chezzi et al., 1998; Blomqvist et al., 2004; Dedepsidis et al., 2008; Shahmahmoodi et al., 2008]. There are, however, no data for the complete genomic sequence of OPV3 produced in MRC-5 diploid cells. In this study, almost full-length genomic sequence from different harvests of the type 3 Sabin strain of PV produced in MRC-5 cells were isolated and determined. These sequences were compared with other available sequences of original seeds, vaccines, and Sabin VDPV field strains isolated from different parts of the world, including Iran. The main aim of this study was to explore the possible mutation(s) of serotype 3 Sabin OPV following passage in MRC-5 cells by sequencing and alignment and to assess the safety of OPV manufactured in MRC-5 cell substrate. The safety, potency, and efficacy of the vaccine required evaluation by comparative and trend analysis of vaccine production for over a 30-year period.
MATERIALS AND METHODS
Virus
MRC-5 cells were grown as monolayer cultures in Dulbecco's modified Eagle (DME) media (Sigma–Aldrich, Steinheim, Germany). For the production of monovalent bulk of type 3 PV, the working seed virus prepared by the Mérieux Institute, from a Pfizer type 3 RNA-derived master seed 457-III, was used. The virus was propagated, according to the current WHO guidelines for production of OPV [Wood and Macadam, 1997; WHO, 2002], in confluent monolayer MRC-5 cells between 33 and 34°C. In brief, the cells inoculated at a multiplicity of infection (MOI) of 0.2 log10 CCID50/cell in serum-free growth medium. Subsequently, the cells were harvested <96 hr (usually 72 hr) post-inoculation (p.i.) and burst by one freeze-thawing cycle. Virus harvests were filtered through 0.45 and 0.2 µm filters (Sartorius, Goettingen, Germany), respectively, to remove cell debris and viral aggregates (clarification), and were subjected to quality control (QC) tests. When the QC tests were completed satisfactorily, several single harvests were pooled, mixed, and filtered to form the monovalent bulk virus suspension (monopool). Subsequently, bulk suspension was subjected to QC tests, such as MNVT and rtc/40 [WHO, 2002]. The viral titers of the harvests and pools were measured by endpoint dilution method [Husson-van Vliet, 1986] on HeLa cells as reported by Kärber formula [1931]. Twenty 5 ml samples were withdrawn from each harvest or monopool. The vials were stored at below −60°C until used for further studies.
RT-PCR and Complete Genomic Sequencing
Viral RNA extraction
The clarified virus suspensions (single harvests) were used as the material for RNA extraction. Viral RNA was extracted from 200 µl of each single harvest using viral RNA extraction kits (high pure viral nucleic acid kit, Roche Applied Science, Mannheim, Germany) according to the manufacturer's instructions.
RT-PCR and direct sequencing
The first-strand cDNA synthesis reaction mixture contained 100 ng random primers, 500 ng RNA, and 500 µM each of dNTP mix in a total volume of 20 µl. After incubation at 95°C for 10 min and cooling the denatured RNA solution in ice for 1 min, 4 µl of 5× reaction buffer (250 mM Tris–HCl, 375 mM KCl, 15 mM MgCl2, pH 8.3), 200 U SuperScript™ III reverse transcriptase (Invitrogen Life Technologies, Carlsbad, CA), 5 mM DTT, and 50 U protector RNase Inhibitor (Roche Applied Science) were added, and the reaction mixture was incubated at 25°C for 5 min. Following this, the reaction mixture was incubated at 50°C for 60 min and the enzyme heat-inactivated for 15 min at 70°C.
Approximate full-length genome of PV3 propagated in MRC-5 cells was amplified in six overlapping fragments, using six primer pairs (Table I). Primers for PCR amplification and sequencing of cDNA strands were designed based on the serotype 3 Sabin strain PV sequence (accession number AY184221), and synthesized by Isogen Life Science (Maarssen, the Netherlands) and Eurofins MWG Operon (Ebersberg, Germany).
| Namea,b | Sequence | Tm (°C)c | Applicationd | Amplicon size (bp) |
|---|---|---|---|---|
| PV3-1+ | TTAAAACAGCTCTGGGGTT | 54.9 | PCR, sequencing | 1,826 |
| PV3-6+ | ACAGCTCTGGGGTTGTTC | 56.0 | Sequencing | |
| PV3-591− | CATAAGCAGCCATTCAAGA | 54.9 | Sequencing | |
| PV3-891+ | AGATCCGTCCAAGTTCAC | 53.1 | Sequencing | |
| PV3-1826− | GTGATTGGTGGTTGTCTG | 52.6 | PCR, sequencing | |
| PV3-1807+ | GTCAGACAACCACCAATC | 51.4 | PCR, sequencing | 1,838 |
| PV3-2607+ | TGCATTGACAGCCGTGGA | 63.6 | Sequencing | |
| PV3-2848− | CCAGTTTGCGTCTCAGTT | 54.7 | Sequencing | |
| PV3-3644− | GGTAGTAGTCATTAGCCTC | 46.1 | PCR, sequencing | |
| PV3-3505+ | ATCAAAAGCTCAAGGTACCGA | 58.8 | PCR, sequencing | 592 |
| PV3-4096− | AATCTCCAAAGTGTCACATGC | 57.7 | PCR, sequencing | |
| PV3-3709+ | TATCCTTAGGTGTCAACATG | 50.9 | PCR, sequencing | 1,995 |
| PV3-4670+ | ACGGAGCAGACATGAAAC | 54.4 | Sequencing | |
| PV3-4861− | CCACGTCAAATGCGAATCT | 59.7 | Sequencing | |
| PV3-5703− | GTGGGTATGTGTTGTCTGA | 52.2 | PCR, sequencing | |
| PV3-5685+ | TCGAAGATCAGGCAGGCA | 61.7 | PCR, sequencing | 1,703 |
| PV3-6429+ | TGGAATTAACTTACCGCTTG | 55.6 | Sequencing | |
| PV3-6625− | GATCACAACCAACTGCACT | 54.3 | Sequencing | |
| PV3-7387− | TCCAATTCGACTGAGGTAG | 53.6 | PCR, sequencing | |
| PV3-6643+ | AGTGTTGATGGAAGAAAAGC | 54.5 | PCR, sequencing | 757 |
| PV3-7387− | TCCAATTCGACTGAGGTAG | 53.6 | Sequencing | |
| PV3-7399− | AGTATGACCCAATCCAATTC | 53.9 | PCR, sequencing |
- Each group of primers applied for generation and sequencing of different and separate amplicons (as mentioned in “d”).
- a (+) and (−) indicate forward and reverse polarity of the primer, respectively.
- b The numbers correspond to the nucleotide position of the 5′ ends of the synthetic primers relative to the 5′ terminus of the genome.
- c The Tm of primers were calculated using nearest-neighbor thermodynamic values method [Breslauer et al., 1986].
- d Primers are divided according to their application for generation and sequencing of separate overlapping fragments.
All PCRs had the same thermal profile parameters and conditions: initial denaturation at 95°C for 5 min, then 25 cycles of 95°C for 1 min, 48°C for 1 min, and 72°C for 1.5 min, followed by a final elongation at 72°C for 10 min. The PCR reaction mixture (50 µl) contained 10 µl first-strand cDNA product, 5 µl 10× Pfu DNA polymerase buffer (200 mM Tris–HCl, pH 8.8, 100 mM KCl, 100 mM (NH4)2SO4, 1% Triton X-100, 1 mg/ml BSA, 20 mM MgSO4), 0.2 µM from each primer, 200 µM dNTPs, and 2.5 U Pfu DNA polymerase (Fermentas Life Science, Vilnius, Lithuania). The PCR reactions were performed in a Veriti™ thermal cycler (Applied Biosystems, Foster City, CA).
The PCR products were isolated from the agarose gel by high pure PCR purification kit (Roche Applied Science). All sequencing reactions were performed in Eurofins MWG Operon.
Data Analysis
Sequence assembly and multiple nucleotide alignments were performed using DNAMAN version 4.13. Statistical analyses were performed using SPSS software, version 11.0.0.
RESULTS
Type 3 Sabin Strain of Poliovirus Cultivation in MRC-5 Cells
Figure 1 shows the virus titers from different harvested viruses (potency trend) during a 36-year period of production. The maximum, minimum, and mean (average infectivity) titers were 8.45 log10 CCID50/ml, 6.9 log10 CCID50/ml, and 7.74 log10 CCID50/ml, respectively, with a standard deviation (SD) of 0.46. The upper and lower limits of the harvests in this study were 8.66 log10 CCID50/ml and 6.82 log10 CCID50/ml, respectively. The coefficient of variation (CV) of the harvest titers was calculated as 5.9%. Statistically, the titers were homogeneous between different harvests. These results also suggest that MRC-5 cells provide an acceptable virus yield in serum-free condition.
Comparison of different harvest titers of serotype 3 OPV that grow in MRC-5 cells. Infectivity titers were determined by CCID50 in HeLa cells as mentioned in the Materials and Methods Section.
Values for MNVT mean lesion score and rct/40 reduction titer contents of different monopool batches of serotype 3 PV prepared in MRC-5 are shown in Table II. These results showed that different monopools of serotype 3 OPV produced in MRC-5 cell substrate retained their phenotypic characteristics (temperature sensitivity and neuroattenuation). All these batches passed the tests and are/were used for the production of trivalent OPV.
| Batch | rct/40 | MNVT | ||||||
|---|---|---|---|---|---|---|---|---|
| Bulk titers reductiona | Reference titers reductiona,b | Wild titers reductiona,b | Resultsc | Bulk mean lesion score | Reference mean lesion scored | Different between bulk and reference | Resultse | |
| #1 | 6.3 | 5.5 | 2.5 | Satisfactory | 0.15 | 0.9 | −0.75 | Satisfactory |
| #2 | 6.4 | 5.5 | 1.2 | Satisfactory | 0.30 | 0.69 | −0.39 | Satisfactory |
| #3 | 6.97 | 6.8 | 2.1 | Satisfactory | 1.42 | 1.91 | −0.49 | Satisfactory |
| #4 | 6.2 | 5.5 | 1.0 | Satisfactory | 0.40 | 0.60 | −0.20 | Satisfactory |
- rct/40, reproductive capacity at temperatures of 36 and 40°C; MNVT, monkey neurovirulence test.
- a Titer (log10 CCID50) at 36°C − titer (log10 CCID50) at 40°C.
- b Attenuated and wild-type virus references for the rct/40 test were TC3 (NIH, Bethesda, MD) and Saukett strains, respectively.
- c Specification limits: Both the bulk and reference must have at least a 5.0 log10 lesser titer at 40°C than at 36°C to pass the test for sensitivity to grow at supra-optimal temperature (titer at 36°C − titer at 40°C > 5); whereas for virulent strain reduction titer should be less than 5.0 log10 (titer at 36°C − titer at 40°C < 5) [Wood and Macadam, 1997; WHO, 2002].
- d Attenuated virus reference for MNVT test was SO+3 71/303.
- e Specification limits: Difference between mean lesion score for the bulk and reference should not be greater than a constant value (c-value) calculated from pooled within-test variance for laboratory [Wood and Macadam, 1997; WHO, 2002].
Genomic Sequence Analysis
In this study, RT-PCR was used successfully to amplify the cDNA of the almost complete genome fragment of type 3 PV. To obtain the sequence of PV3 genome designed primers were utilized to amplify overlapping fragments (Table I). The length of the amplicons was fully compatible with their predicted chain lengths. The sequences of six cDNA fragments obtained from RT-PCR were determined by sequencing directly with specific primers in both directions (Table I). In total, 7,360 nucleotides of the genome (7,432 nucleotides) from nucleotide 20 to nucleotide 7379 were sequenced. No differences in nucleotide sequence were detected between the original seed [accession number AY184221, Rezapkin et al., 1995] and the different harvests of latest RSO-derived monopools of type 3 OPV, produced in MRC-5 cells by direct sequencing.
DISCUSSION
The results from the present study suggest that the potency trend of the different batches during this 36-year period of production were virtually consistent from harvest to harvest, and batch to batch. And the study reconfirmed that the MRC-5 cell line is a suitable cell substrate for large-scale production of PV vaccine in serum-free condition. However, the limitation of MRC-5 for OPV vaccine production is that the titer of the harvested virus is usually lower than that obtained from Vero or PMKC cells. Though this limitation has been partially overcome by the modification/optimization of growth parameters, such as pH of media, MOI, cell density, passage number of cell, and cell culture method. For example, a study showed that the replacement of conventional flasks by roller bottles can increase the yield of PV production in MRC-5 cells up to 1 log10 CCID50/ml and was not far from the titers obtained in PMKC [Mirchamsy et al., 1978].
Some nucleotide substitutions have been observed previously in type 3 VDPV isolated from an Iranian immunodeficient vaccine recipient [Shahmahmoodi et al., 2008]. There were no observed mutations in the harvests studied, in agreement with the previous study, suggesting that these mutations occur during viral replication in the gut of this X-linked agammaglobulinemia vaccinee [Shahmahmoodi et al., 2008]. Others reported previously an increase in the rate of mutations and recombination of P3/VDPVs excreted by patient with vaccine-associated paralytic poliomyelitis (VAPP) [Cann et al., 1984; Macadam et al., 1989; Minor, 1992, 1999; Driesel et al., 1995; Martín, 2006].
In 1973, OPV was introduced as routine vaccination as part of the Iranian Expanded Program on Immunization (EPI). In Iran, the MRC-5 diploid cells are used to propagate and grow the Sabin strains and production of trivalent OPV vaccine [Mirchamsy et al., 1978; Mirchamsy and Shafyi, 1984]. For more than 36 years (from 1973 to date) Iran has used OPV produced in MRC-5 cells for routine and mass immunization. During these years, the quality and safety of the vaccine batches were tested in the laboratory, for example, by phenotypic characterization tests (MNVT and rct/40 tests, Table II) as well as by clinical trials and surveillance. During these 36 years of production, more than 10 million doses of OPV were used annually in Iran. And the major part of the OPV used for vaccination in Iran has been provided by the local manufacturer which used MRC-5 cells for vaccine production. Exhaustive national surveillance of all acute flaccid paralysis (AFP) cases in Iran, especially in recent years, revealed that only a few cases (six cases during 10-years of surveillance) had VAPP, mostly in association with immunodeficiency (iVAPP), have been reported as yet [Parvaneh et al., 2007; Rahimi et al., 2007a,b; Davarpanah et al., 2008; Mamishi et al., 2008; Shahmahmoodi et al., 2008, 2009], and no increased level of complications was observed in vaccinees. The risk of VAPP among recipients and/or contacts was 1 case per 745,000 to 7,142,000 used doses of OPV in different parts of the world [WHO, 1982; Nkowane et al., 1987; Joce et al., 1992; Strebel et al., 1992; Prevots et al., 1994; Andrus et al., 1995; Kohler et al., 1999; Zimmerman and Spann, 1999; Samoĭlovich et al., 2007]. The rate of VAPP is higher with the first dose [Clements, 2000] and also among immunodeficient individuals (3,000-fold higher risk than that in immunocompetent individual) [Khetsuriani et al., 2003; Martín, 2006]. Thus, so far the risk of VAPP in Iran has reported in an acceptable risk range. However, continuous surveillance of all AFP cases in Iran need to be documented fully to assess the rate of VAPP as a consequence of OPV vaccine produced in MRC-5 cells.
Although Iran has been free of indigenous cases of wild PV infection since 1997 [Rahimi et al., 2007a], and exogenous cases since 2001 [Shahmahmoodi et al., 2009], in recent years several outbreaks of poliomyelitis disease caused by wild PV strains, especially type 3 and/or 1, occurred in the neighboring countries, Afghanistan and Pakistan (as a potential source of renewed infection of wild PV in Iran) [Rai and Nazir, 2008; WHO, 2008; MMWR, 2009a,b]. To maintain a polio-free Iran, routine and mass vaccination need to be continued. Past [Jacobs, 1970; Mirchamsy et al., 1981; Mirchamsy and Shafyi, 1984; Dunn et al., 1990; Prikazsky et al., 2005] and present studies of OPV produced in MRC-5 cells have confirmed the safety and efficacy of this vaccine.
Acknowledgements
We wish to thank Dr. M.H. Habloolvarid and the personnel of the Pathology Department of Razi Institute for performing the MNVT tests. We also thank Dr. A. Mohammadi and A. Foroghi for preparing cell cultures, Dr. M. Ashtiani, Dr. M. Jelokhani, Z. Hamzeloo, and Z. Bozorgkhoo, for their technical assistance in production. This study is dedicated to the memory of our teacher Prof. H. Mirchamsy.
