Enpp1^asj and Enpp1^T238A mouse models

Animal care and maintenance were provided through Yale University Animal Resource Center (YARC) at Yale University (New Haven, CT, USA). All procedures were approved by the Animal Care and Use Committee of Yale University and complied with the US National Institutes of Health guide for the care and use of laboratory animals. Knock in of alanine for the catalytic threonine at position 238 in the murine ENPP1 sequence was accomplished by CRISPR/Cas methods essentially as described.⁽¹⁹⁾ Potential Cas9 target guide (protospacer) sequences in proximity of the T238 codon, in exon 7 of the ENPP1 gene on mouse chromosome 10, were screened using the tool CRISPOR (http://crispor.tefor.net/crispor.py). Potential sequences were selected, single-guide RNAs (sgRNAs) were transcribed and tested for activity by microinjection with Cas9 into zygotes followed by culture to blastocysts. Activity was scored by the fraction of blastocysts with indels to the number of blastocysts genotyped, and the protospacer sequence GATTGGGAAACGTCTTGGTA (reverse strand) was chosen due to its performance in the activity assay. A DNA repair template oligonucleotide was designed to introduce the T238 ACG->GCG (Ala) base change, and three additional base changes were introduced to inhibit sgRNA recognition and to introduce a convenient restriction site (BsaI) for genotyping mice. Components were mixed in injection buffer at a concentration of 30 ng/μL Cas9 (NEB), 15 ng/μL sgRNA, and 10 ng/μL repair template, centrifuged, and microinjected into pronuclei of C57BL/6J zygotes. Embryos were transferred to the oviducts of pseudopregnant CD-1 foster females using standard techniques.⁽²⁰⁾ The resulting pups were genotyped by sequencing a PCR amplimer from the following oligonucleotides 5′ CTTACCGGCTGTCCTTTGTACCAC 3′ and 5′ GCGATATGCCTAATAGCAGTGTCTG 3′. To clarify the effects of the above genetic mutations from WT mice, ENPP1^asj mice may be hereafter referred to as “protein knockout” mice, and ENPP1^T238A mice as “catalytic knockout” mice.

Heterozygous Enpp1^asj/+ (genotype C57BL/6J-Enpp1^asj/GrsrJ; The Jackson Laboratory, Bar Harbor, ME, USA; stock number 012810) and heterozygous Enpp1^T238A/+ breeding pairs were maintained on regular chow throughout the entire experiment and food and water were delivered ad libitum. The animal colony was housed in pathogen-free conditions. Litters were genotyped on day 8 and weaned at day 21. Animals were terminally bled on day 70 or day 161 and the skeletal phenotypes were examined. To allow dynamic histomorphometry, all mice were injected intraperitoneally (i.p.) with calcein either 8 or 4 days, and 1 day prior to euthanasia (10 mg/kg; Sigma-Aldrich, St. Louis, MO, USA).

Analysis of plasma analytes

Blood plasma was prepared and assayed for PPi as described.^{(2, 14)} Mouse PTH(1-84) enzyme-linked immunosorbent assay (ELISA) kits were purchased from Quidel Corporation (San Diego, CA, USA; 60-2305). Mouse/Rat FGF-23 (intact) ELISA kit (catalog number 60-6800) was also purchased from Quidel Corporation. Forty-five microliters (45 μL) plasma samples were used for all ELISA experiments. Data analysis was performed via GraphPad Prism 9 (GraphPad Software, Inc., La Jolla, CA, USA).

Isolation of primary calvarial cells

Litters from heterozygous breeding pairs were euthanized at 3 days, and calvariae were isolated immediately, decalcified with 4mM EDTA solution for 10 minutes twice, and then sequentially digested by Collagenase type2 solution (Worthington Biochemical Corporation, Lakewood, NJ, USA) at 200 units per mL for 10 minutes twice followed by 15 minutes thrice. Both decalcification and the digestion were carried at 37°C. Calvariae were disaggregated by repeated pipetting, and the resulting solution was filtered through a 40-μm membrane. The cell suspension was then centrifuged at $33 x g$ for 6 minutes, and the precipitate was resuspend in α-minimum essential medium (α-MEM), supplemented with 10% fetal bovine serum (FBS) and 10,000 g/mL penicillin/streptomycin (P/S). The cells were then plated into wells at 1 × 10⁵ cells/cm².

Micro-computed tomography and histomorphometry

Morphological assessment of bones was performed on tibiae, whereas femurs were used for biomechanical testing. Tibiae of male mice were stripped of soft tissue and fixed in 70% ethanol before scanned using a Scanco μCT-35 (Scanco, Brüttisellen, Switzerland) and analyzed for microstructural parameters at the proximal tibia just below the growth plate (trabecular bone) and at the tibial midshaft (cortical bone). The spatial resolution of the micro-computed tomography (μCT) measurement was 6 mm (isometric voxel size) and was performed to a depth of over 1 mm in each sample.

For histomorphometric analysis, specimens of male mice were further dehydrated and embedded in methyl-methacrylate (MMA) before being sectioned and stained with toluidine blue as well as von Kossa/van Gieson.⁽²¹⁾ Measurements of the trabecular bone were performed on a fixed region between 300 and 800 μm below the growth plate corresponding to secondary spongiosa, and analyzed by OsteoMeasure software (OsteoMetrics, Atlanta, GA, USA). To assess bone formation, osteoid volume per bone volume (OV/BV, %), osteoid surface over bone surface (OS/BS, %), osteoid width (O.Wi, μm), mineralization lag time (Mlt, days), bone formation rate over bone surface (BFR/BS, μm³/μm²/year), and mineralizing surface over bone surface (MS/BS, %) were analyzed. All histomorphometry data were collected according to American Society for Bone and Mineral Research (ASBMR) guidelines.⁽²²⁾

Histomorphometry and μCT parameters were evaluated in a sex-specific manner to remove sex as a confounding variable and are reported in the male animals as there are well known sex differences in C57BL/6 mice. Similar trends were observed in the female animals (data not shown).

Bone biomechanical testing

To determine biomechanical characteristics, all femurs were loaded to failure with four-point bending. Specimens were tested at room temperature and kept moist with phosphate-buffered saline (PBS). All whole-bone tests were conducted by loading the femur in the posterior to anterior direction, such that the anterior quadrant was subjected to tensile loads. The width of the lower and upper supports of the three-point bending apparatus were 7 mm and 3 mm, respectively. Tests were conducted with a deflection rate of 0.05 mm/s using a servo hydraulic testing machine (Instron model 8874; Instron Corp., Norwood, MA, USA). The load and mid-span deflection were acquired directly at a sampling frequency of 200 Hz. Load-deflection curves were analyzed for stiffness, maximum load, and work to fracture. Yield is defined as a 10% reduction in the secant stiffness (load range normalized for deflection range) relative to the initial tangent stiffness. Postyield deflection, which is defined as the deflection at failure minus the deflection at yield was measured also. Femurs were tested at room temperature and kept moist with PBS. Because there are well known sex differences in biomechanical parameters of C57BL/6 mice, the biomechanical measurements at 10 weeks were performed in male animals, with similar trends observed in female animals, and the biomechanical measurements in 23-week-old mice were performed in female animals with similar trends observed in males.

Bone mineral density analysis, forepaw and mandible

Hemimandibles and forepaws were scanned in a μCT 50 scanner (Scanco Medical, Bassersdorf, Switzerland) at 70 kVp, 76 μA, 0.5 Al filter, 900 ms integration time, and 6 μm (mandible) or 10 μm (forepaw) voxel dimension. Reconstructed images were calibrated to five known densities of hydroxyapatite and analyzed using AnalyzePro (version 1.0; AnalyzeDirect, Overland Park, KS, USA). Mineral density heat maps were generated for forepaws and mandibles. A threshold of 650 mg hydroxyapatite (HA)/cm³ was set for mineralized tissue of forepaws. Mandible regions of interest were defined from 480 μm forward from the mesial root and 480 μm backward to the distal root, using the most mesial and distal root points as landmarks. For mandibles, thresholds were set for enamel (1650 mg HA/cm³) and dentin/cementum/bone (650 mg HA/cm³) to determine enamel, dentin, and alveolar bone volumes and densities as described.^(23-25) Measurements were performed in combined male and female animals because sex-specific analysis did not alter the findings.

Cementum analysis

Cementum, the mineralized tissue lining the tooth root surface and required for tooth attachment to surrounding alveolar bone, was analyzed with previously employed methods.^(23-25) In brief, reconstructed images underwent a median filter, 5-kernel size, and a mask of cementum was generated with a density range of 350–1050 mg HA/cm³. This mask was then overlaid onto the original scan. Subsequently, cementum was defined as mineralized tissue above 650 mg HA/cm³ within the masked area. Based on previous histological and μCT analyses of WT mice, the cervical two-thirds of cementum was designated as acellular cementum, and the apical one-third was designated as cellular cementum. Measurements were performed in combined male and female animals because sex-specific analysis did not alter the findings.

Quantitative backscattered electron imaging

As described,⁽²⁾ quantitative backscattered electron imaging (qBEI) was performed to assess bone mineral density distribution (BMDD) of tibias in the lateral cortex. In MMA-embedded samples from male WT (five 10-week-old and four 23-week-old) and Enpp1^T238A (five 10-week-old and six 23-week-old) mice were polished and carbon-coated before scanned in a scanning electron microscope (LEO 435; LEO Microscopy Ltd., Cambridge, UK) equipped with a backscattered electron detector (Type 202; K.E. Developments Ltd., Cambridge, UK). BMDD was evaluated as mean calcium weight percentage (CaMean, wt%), most frequent calcium weight percentage (CaPeak, wt%), heterogeneity of the calcium content (CaWidth, wt%), and proportion of low (CaLow, %) mineralized areas. In addition, the mean osteocyte lacunar area (Ot.Lc.Ar, μm²) and number of osteocyte lacunae in the cross-sectioned mineralized matrix (N.Ot.Lc/B.Ar, 1/mm²) were determined as parameters indicating two-dimensional osteocyte lacunae characteristics.

Cell culture and osteogenic differentiation

Cell media was changed every 2 days and passaged when cell density reached 70%–80% confluence. The osteogenic differentiation started on day 1 after the third passage. For osteogenic differentiation, cells were cultured in α-MEM with 10% fetal bovine serum, 10,000 g/mL P/S, 2 × 10⁻⁴M L-Ascorbic Acid, and 10mM Β-Glycerol phosphate for 21 days, with the media changed every 3 days.

Generation of Sfrp1 knockout cell lines

Calvarial cells isolated from WT, Enpp1^T238A, or Enpp1^asj mice were transfected, after their second passage, with ready-to-use predesigned CRISPR Sfrp1 guide RNAs (gRNAs) lentivirus (Sigma Mission® CRISPR/Cas9; MMPD0000035499) for 8 hours at a concentration of one lentivirus particle per cell, and the transfected cells were selected with 2 μg/mL puromycin for 5 days. The selected cells were maintained for 4–5 days and then were passaged or characterized (via Western blot) when cell density reached 70%–80% confluence.

Real time polymerase chain reaction

Total RNA from the cultured cells was extracted using PureLink® RNA Mini Kit (Thermo Fisher Scientific, Waltham, MA, USA) and reverse transcribed with SuperScript™ IV First-Strand Synthesis System (Thermo Fisher Scientific). Real-time PCR was performed on ViiATM Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) using SYBR Green Reaction mixture (10 μL) containing 4.5 μL of complementary DNA (cDNA) template (2.5 ng/μL), 0.5 μL each of primers (10μM) and SsoAdvanced™ universal SYBR® Green mix (Bio-Rad Laboratories, Hercules, CA, USA). Experiments were performed in triplicate. Messenger RNA (mRNA) levels were normalized to hypoxanthine phosphoribosyltransferase 1 (Hprpt1) mRNA levels. The gene-specific primers used are listed in Table S1.

Western blot analysis

Total protein was harvested from calvarial cells of WT, Enpp1^T238A, or Enpp1^asj mice with Pierce radioimmunoprecipitation assay (RIPA) Buffer (Thermo Fisher Scientific) and nuclear proteins were extracted by Nuclear Extraction Kit (Abcam, Cambridge, MA, USA). The protein concentration was measured using a Bio-Rad Protein Assay Kit (Bio-Rad Laboratories), and 40 μg total protein or nuclear protein was subjected to Western blotting. The protein was separated on 10% Mini-PROTEAN® TGX Stain-Free™ gel (Bio-Rad Laboratories) and subsequently transferred onto polyvinylidene fluoride (PVDF) membranes. Membranes were blocked at 4°C with 5% nonfat milk powder in TBS-Tween20 for 2 hours and then incubated, depending on the experiment, with primary antibodies against Sfrp1 (ab4193; Abcam) or β-catenin (8480s; Cell Signaling Technology, Danvers, MA, USA) followed by anti-rabbit secondary antibodies conjugated with horseradish peroxidase (HRP) (ab205718; Abcam). Bands were visualized using Pierce™ ECL Western Blotting Substrate (Thermo Fisher Scientific).

Mineralization assay

Alizarin Red staining was used to quantify mineralization. After 21 days of differentiation, cells were fixed with 100% ethanol for 30 minutes and then incubated with 40mM Alizarin Red solution (EMD Millipore, Burlington, MA, USA) for 30 minutes. Stained samples were imaged under a microscope to document mineralization. For Alizarin Red quantification, stained calcium was solubilized in 10% cetylpyridinium chloride for 1 hour, absorbance was read at 562 nm, and the results were normalized to total protein in each sample.

Statistics

Statistical significance in plasma analytes displayed in Fig. 1C and in Tables 1 and 2 were assessed by analysis of variance (ANOVA) comparison of means followed by Dunn's multiple comparison test. Pair-wise comparisons of bone microarchitectural, histomorphometric, gene transcripts, and BMDD parameters in Figs. 2-4 and 6-8 were assessed by the Student's unpaired two-tailed t test. To display respective differences in Enpp1^T238A and Enpp1^asj in Figs. 2-4 and 8, the parameters were normalized to WT siblings by dividing the value of each parameter obtained in the Enpp1^T238A and Enpp1^asj mice with the means of their respective WT sibling pairs. The standard error of the normalized mean ($∆f)$ was determined by adding the relative errors of each comparison according to the relationship $\frac{\mathrm{\Delta f}}{\mathrm{f}}$ =$\frac{\mathrm{\Delta }y}{\mathrm{y}}+\frac{\mathrm{\Delta }x}{x}$ (where f, y, and x represent the relative error of the mean of the function F = x/y). The statistical significance between ENPP1-deficient animals and their respective WT sibling pairs (derived from heterozygous breeders) was determined by a Student's two-tailed t test, the results of which are displayed over the box and whisker plots of each genotype in Figs. 2 and 3. Statistical significance in the dental parameters (Fig. 5) was assessed by an ANOVA Kruskal-Wallis test followed by Dunn's post hoc analysis. Values of p are explicitly stated in all figures and tables when 0.05 ≥ p ≥ 0.001. In cases where p ≥ 0.001 the notation ***p < 0.001, ****p < 0.0001 is used.

Design of the Enpp1^T238A mouse model

We engineered an Enpp1 knock-in mouse with unaltered and intact non-catalytic ENPP1 protein signaling domains in a catalytically inactive enzyme by utilizing a point mutation at the catalytic threonine responsible for the nucleophilic attack on the adenosine triphosphate (ATP) substrate (Fig. 1A–C). Unlike other ENPP1-deficient murine models, in which both enzymatic activity and protein expression are dramatically reduced, the substitution of an alanine for a threonine at the ENPP1 catalytic site eliminates a methyl group from a 95-kDa protein, thereby preserving protein expression while dramatically impairing enzymatic activity.

The CRISPR-Cas mouse was made in a C57BL/6 background, and pseudo-pregnant females were implanted with the altered embryos. Pups were generated and genotyped, resulting in mice heterozygous for the T238A mutation (Fig. 1B). The mice were backcrossed with C57BL/6 mice to the F2 generation, and WT and Enpp1^T238A sibling pairs were generated. ENPP1 protein levels were then compared in WT, Enpp1^asj, and Enpp1^T238A mice by Western blot analysis in primary calvarial cells derived from each model, demonstrating comparable levels of ENPP1 protein in T238A and WT mice (Fig. 1D).

Comparison of plasma analytes associated with bone mineralization

We next compared plasma analytes associated with bone mineralization in WT, Enpp1^asj, and Enpp1^T238A mice. Similar to our previous report of Enpp1^asj mice, Enpp1^T238A mice exhibited increased plasma FGF23, decreased plasma Pi, very low plasma levels of PPi, and elevated PTH when compared to WT animals (Fig. 1C and Tables 1 and 2). Importantly, the plasma PPi values in 10-week-old Enpp1^T238A mice (n = 10, 98 ± 44nM) were essentially identical to those observed in 10-week old Enpp1^asj mice (n = 9, 99 ± 37nM). From this data we conclude that the products of ENPP1 catalysis—i.e., PPi or AMP—drives the FGF23 elevation, phosphate wasting, and PTH elevations observed in murine^{(2, 26)} and human^{(2, 14, 27-29)} ENPP1 deficiency.

Microarchitectural and biomechanical comparison of long bones at 10 weeks

We began by examining the bone microarchitecture of 10-week-old animals by μCT (Fig. 2). To facilitate the comparison between Enpp1^asj and Enpp1^T238A mice, the relative values of each genotype are compared side by side after normalization to their respective WT sibling pairs; ie, the WT animals are assigned an arbitrary value of 1.0.

The μCT analysis of tibial bone reveals that trabecular microarchitecture is essentially preserved in (catalytic knockout) Enpp1^T238A mice, in contrast to (protein knockout) Enpp1^asj mice in which μCT parameters reflect low trabecular bone mass. Trabecular BV/TV, spacing, and number of Enpp1^T238A male mice (n = 14) demonstrated no significant changes compared to WT sibling pairs, in marked contrast to Enpp1^asj mice, which exhibited significantly decreased trabecular BV/TV (59% of WT), significantly increased trabecular spacing (118% of WT), and significantly decreased trabecular thickness (84% of WT) (n = 7) (Fig. 2A,B), with similar trends observed in female Enpp1^T238A and Enpp1^asj mice. Overall, the findings support the notion that catalysis-independent ENPP1 signaling contributes to the regulation of trabecular bone microarchitecture.

Comparison of cortical μCT parameters in the tibias of the same animals show a significant reduction in both cortical thickness and BV/TV in both models when compared to WT; however, greater reductions (approximately twofold) were evident in Enpp1^asj as compared to Enpp1^T238A mice (Fig. 2C). Cortical thickness is reduced 10% in Enpp1^T238A male mice at 10 weeks, as compared to 21% in Enpp1^asj; BV/TV is reduced 1.4% in Enpp1^T238A compared to 3.2% in Enpp1^asj mice. The combined findings demonstrate that both ENPP1 catalytic and protein signaling contribute to cortical bone microarchitecture.

Low bone mass clinically manifests as fracture risk, and so we next compared the biomechanics by four-point bending to failure in the femurs of 10-week-old Enpp1^T238A and Enpp1^asj mice (Fig. 2D). In contrast to Enpp1^asj mice, significant reductions in maximal load were not observed in 10-week-old Enpp1^T238A mice, and although stiffness and total work were reduced in both genotypes, the reductions tended to be more severe in the Enpp1^asj mice. For example, the femurs of 10-week-old male Enpp1^asj mice could bear less maximal load (reduced 33% compared to 11%), were less stiff (reduced 35% compared to 24%), and could bear less total work until failure (reduced 49% versus 40%) than those of Enpp1^T238A mice, supporting the notion that both EPP1 catalytic and catalysis-independent protein signaling pathways contribute to mammalian biomechanical strength in postpubertal mammals.

Finally, the femur length at 10 weeks in both genotypes was slightly reduced compared to WT sibling pairs—male Enpp1^T238A was 98% of WT and male Enpp1^asj was 97% of WT (Fig. 2E)—with similar findings observed in females. The findings, although slight, were statistically significant, suggesting that both catalytic and non-catalytic ENPP1 protein signaling play a role in long bone growth. All microarchitectural and biomechanical parameters of Enpp1^asj and Enpp1^T238A mice compared to their WT controls at 10 and 23 weeks are reported in Tables S2 and S3.

Microarchitectural and biomechanical comparison of long bones at 23 weeks

Trabecular microarchitecture measures at 23 weeks were comparable to those at 10 weeks. Microarchitecture measures in (catalytic knockout) Enpp1^T238A mice were not different from WT, but significantly reduced (protein knockout) Enpp1^asj mice—in male Enpp1^asj mice trabecular BV/TV was decreased to 55% of WT, trabecular spacing was increased to 114% of WT, and trabecular thickness was decreased to 85% of WT (Fig. 3A–C)—with similar findings observed in female animals. Similarly, cortical microarchitecture measures at 23 weeks were comparable to the 10-week findings, with reductions in cortical BV/TV and cortical thickness in both Enpp1^asj and Enpp1^T238A—cortical thickness was reduced by 19% and 17% in male Enpp1^asj and Enpp1^T238A mice, respectively, while cortical BV/TV was 3% lower than WT in male animals of both genotypes—with similar findings observed in female mice. The microarchitectural findings at 23 weeks support the conclusions drawn from 10-week animals, namely, that ENPP1 protein signaling regulates trabecular microarchitecture but both ENPP1 catalytic activity and protein signaling appear to regulate cortical microarchitecture.

Differences between the biomechanical findings in the mouse strains were similar at 23 weeks but less pronounced than the findings at 10 weeks, with stiffness trending higher in the Enpp1^T238A mice (reduced 17% versus 35% in Enpp1^asj mice). However, comparable reductions in maximal load and total work until failure present in both genotypes (Fig. 3D). Importantly, increases in postyield deflection at 23 weeks becomes apparent in both Enpp1^asj and Enpp1^T238A, consistent with the accumulated effects of equivalent phosphate wasting in both Enpp1^T238A and Enpp1^asj mice (Tables 1 and 2). These biomechanical findings further support the notion that ENPP1 catalytic activity regulates plasma FGF23 to regulate phosphate homeostasis in mammals. Finally, the femur length of Enpp1^asj mice was noted to be reduced compared to WT siblings, in contrast to the femur length of Enpp1T238A mice (Fig. 3E), further supporting a role for ENPP1 protein signaling on the regulation of bone mass.

Comparison of histomorphology at 10 and 23 weeks

Although μCT quantitates the hard mineral matrix (HA) of bone, both hard and soft mineral matrix can be assessed using histomorphology techniques. To determine the role of ENPP1 signaling on both hard and soft bone mineral matrix we conducted histomorphometric analysis (Fig. 4A) of the proximal tibia, discovering mineralization disturbances in both (catalytic knockout) Enpp1^T238A and (protein knockout) Enpp1^asj models, although with distinct differences. Although 10-week-old Enpp1^asj mice showed increased OV/BV, OS/BS, and O.Wi compared to WT siblings, 23-week-old Enpp1^asj mice presented with similar values as controls. The OV/BV, OS/BS, and O.Wi in 10-week-old Enpp1^T238A mice did not deviate from WT controls, but in 23-week-old mice a trend toward higher OV/BV (WT: 0.85% ± 0.14% versus Enpp1^T238A: 1.80% ± 1.10%; p = 0.131) and OS/BS (5.86% ± 1.48% versus 9.84% ± 3.55%; p = 0.070) was noted without statistical significance, suggesting that the osteomalacia present in Enpp1^asj mice was attenuated in Enpp1^T238A mice (Fig. 4B). Similarly, dynamic histomorphometry enabled through calcein labeling showed reductions in MS/BS in 23-week-old male Enpp1^asj mice, whereas in Enpp1^T238A mice slight trends were noted but were not significant (Fig. 4C). Importantly, BFR/BS in both 10-week-old and 23-week-old Enpp1^T238A mice was not significantly reduced compared to their WT siblings, whereas in comparison 23-week-old Enpp1^asj mice exhibited significantly reduced BFR/BS (66% lower than WT siblings). Mlt in 10-weeks-old Enpp1^asj mice was 196% higher than WT siblings, but was not elevated in Enpp1^T238A at 10 weeks, and only trended higher without significance at 23 weeks. The findings, combined with the reductions in parathyroid hormone (PTH), are consistent with the previously observed development of a low bone turnover state in Enpp1^asj mice at 23 weeks,⁽²⁾ a state that does not appear to be fully present in the 23-week Enpp1^T238A mice. All parameters of Enpp1^asj and Enpp1^T238A mice compared to their WT controls in both age groups are reported in Table S4. In summary, the histomorphometry data indicate a disturbed mineralization process in 10-week-old Enpp1^asj mice, a phenotype which is not observed in 10-week-old Enpp1^T238A mice. In contrast, disturbed mineralization is present in both Enpp1^asj and Enpp1^T238A mice at 23 weeks.

Dentoalveolar phenotype

Next, we examined enamel, dentin, cementum, and surrounding alveolar bone in 10-week-old Enpp1^asj and Enpp1^T238A mice. Pyrophosphate levels are believed to play a dominant role in cementum formation,⁽³⁰⁾ supported by observations that GACI survivors exhibit hypercementosis, with minimal impact on enamel and dentin.⁽²⁵⁾ μCT analysis of the mandible first molar revealed pronounced increases in acellular and cellular cementum volumes compared to WT in (protein knockout) Enpp1^asj mice, whereas (catalytic knockout) Enpp1^T238A mice exhibited a hypercementosis phenotype intermediate between WT and Enpp1^asj mice (Fig. 5A-O and graphs). Enpp1^asj mice also exhibit cementicles extending from cervical cementum (Fig. 5E, arrow), which are absent in Enpp1^T238A mice. Acellular and cellular cementum volumes of Enpp1^T238A mice were in between WT and Enpp1^asj mice, with more significant differences in the acellular cementum volume of Enpp1^asj, whereas cementum densities were comparable between all groups. Histological analysis showed that Enpp1^T238A mice exhibited increased acellular cementum thicknesses compared to WT mice, albeit to a lesser extent compared to Enpp1^asj mice (Fig. 5M–O, arrows). All mice exhibited comparable intact periodontal ligament (PDL) insertions (Fig. 5M–O, asterisks). Dentin volume was significantly higher in Enpp1^asj mice compared to WT mice, whereas enamel volume as well as enamel and dentin mineral densities were comparable between WT, Enpp1^asj, and Enpp1^T238A mice (Fig. 5, graphs).

Alveolar bone volume of Enpp1^T238A mice was significantly lower in comparison to Enpp1^asj mice, but not WT mice (Fig. 5). However, alveolar bone mineral density in Enpp1^T238A mice was not reduced compared to WT siblings, in contrast to Enpp1^asj mice, which exhibited reduced alveolar mineral density when compared to Enpp1^T238A mice. The reduced alveolar bone mineral density in Enpp1^asj versus Enpp1^T238A mice were consistent with the long-bone bone mineral density findings in the two phenotypes (Fig. 3). Moreover, maps visualizing mineral density distributions demonstrate larger numbers of higher density voxels in furcation and basal bone areas of Enpp1^T238A mice compared to WT and Enpp1^asj mice (Fig. 5L). In summation, the trends in alveolar bone mineral density observed in Enpp1^asj and Enpp1^T238A mice paralleled findings in the bone mineral density observed in the long bones (Fig. 3), supporting a role for catalysis-independent signaling in the regulation of bone mass.

Ectopic joint calcification is a hallmark of Enpp1^asj mice,^{(16, 31, 32)} and we previously reported that acellular cementum hypercementosis parallels ectopic calcifications in the forepaws.⁽²⁴⁾ Using μCT analysis, we observed marked ectopic calcifications surrounding joints in forepaws in Enpp1^asj mice (Fig. 5Q versus Fig. 5P). The ectopic calcifications in Enpp1^T238A mice appeared reduced compared to Enpp1^asj mice, but remained more pronounced compared to WT forepaws, which lack calcifications (Fig. 5R, arrows). Overall, our findings show that in the dentoalveolar complex, acellular and cellular cementogenesis is markedly sensitive to ENPP1 catalytic activity, but that catalysis independent protein signaling also plays a significant role. Specifically, the decreased hypercementosis and joint mineralization phenotype in Enpp1^T238A mice compared to Enpp1^asj mice supports a role for catalysis-independent ENPP1 protein signaling in the regulation of cementogenesis and ectopic joint mineralization.

Comparison of osteogenic mineralization pathways in differentiating calvarial osteoblasts

The reduction in bone mass noted in the Enpp1^asj mice may be due functional differences in the cellular activity of osteoclasts or osteoblasts. To investigate whether an osteoblastic defect may account for the decreased bone mass in Enpp1^asj mice observed in the above in vivo studies, we quantitated mineralization in differentiating calvarial cell cultures derived from each genotype. Consistent with observations that Enpp1^asj mice exhibited osteopenia as determined by μCT and biomechanical studies above, mineralization in differentiating (protein knockout) Enpp1^asj calvarial cells was less than one-half that of WT and (catalytic knockout) Enpp1^T238A, whereas cultures of Enpp1^T238A mineralized to a slightly greater extent than WT (Fig. 6A,B). Mineralization in the differentiating Enpp1^asj osteoblasts also lagged behind the mineralization in WT and Enpp1^T238A osteoblasts at days 7 and 14, while mineralization in the differentiating Enpp1^T238A osteoblasts was well advanced with respect to that in WT and Enpp1^T238A osteoblasts at day 7, but less so on day 14 (Fig. S1A). Finally, the temporal mineralization changes closely paralleled the relative transcriptional differences in osteocalcin (OCN; Fig. S1B) and secreted frizzled-related protein 1 (SFRP1) (Fig. 6E) at the various time points. The findings support a role for catalysis independent ENPP1 protein signaling on osteoblast differentiation and/or a functional impact on the mineralization process.

To identify candidate genetic pathways responsible for the decreased mineralization in osteoblasts, we screened a panel of osteogenic pathways, guided by our previous messenger RNA sequencing (mRNAseq) studies in whole bones of Enpp1^asj mice, suggesting that Wnt pathway suppression was primarily responsible for decreased bone mass in the Enpp1^asj mice.⁽³³⁾ We compared gene transcription of differentiating WT, Enpp1^asj, and Enpp1^T238A calvarial cell cultures on day 7 using a panel of genes including Wnt ligands (Wnt4, Wnt5, Wnt9a, Wnt10b, Fzd4, and Lrp5) and inhibitors (Sfrp1, Sost, and Dkk3) (Fig. 6C,D). The most striking differences in gene expression was the differential expression of Sfrp1, which was increased in Enpp1^asj osteoblasts (140% of WT) and suppressed in Enpp1^T238A osteoblasts (71% of WT). To verify elevated Sfrp1 expression patterns in Enpp1^asj osteoblasts we compared Sfrp1 transcription levels in WT and Enpp1^asj osteoblasts at five separate time points during the 21 days of differentiation, observing significant increases in Sfrp1 transcription on every day beginning on the first time point measured—day 3 (Fig. 6E). To compare Sfrp1 expression in Enpp1^asj and Enpp1^T238A osteoblasts during differentiation, we compared (in parallel cultures) the Sfrp1 transcription levels of both genotypes at days 7 and 21 to each other and WT siblings, finding increased Sfrp1 transcription in Enpp1^asj osteoblasts relative to both WT and Enpp1^T238A osteoblasts at day 7 and 21, and decreased Sfrp1 transcription in Enpp1^T238A osteoblasts relative to Enpp1^asj osteoblasts at day 7 and 21 (Fig. 7A). Although Enpp1^T238A osteoblasts exhibited increased Sfrp1 transcription compared to WT at day 21, the transcription rates remained significantly below those of Enpp1^asj osteoblasts at day 21. Importantly, the Sfrp1 transcription levels inversely correlated with transcription of the osteogenic gene Ocn (Fig. 7B) and directly correlated with the mineralization phenotype (Fig. 6A).

To determine whether Sfrp1 transcription in Enpp1^asj may account for the decreased mineralization in differentiating Enpp1^asj osteoblasts, we abrogated SFRP1 protein expression in Enpp1^asj and WT calvarial cells via Crispr-Cas knockdown (Fig. 7D) and correlated this with mineralization phenotype and nuclear β-catenin signaling. Further demonstrating Sfrp1 suppression of Wnt signaling, decreased nuclear β-catenin protein was observed in Enpp1^asj osteoblasts compared to WT osteoblasts, but increased nuclear β-catenin protein was observed in Enpp1^asj and WT calvarial osteoblasts when Sfrp1 was knocked down (Fig. 7E). Finally, knockdown of Sfrp1 protein in Enpp1^asj osteoblasts abrogated the mineralization defect in differentiating calvarial osteoblast cell cultures (Fig. 7C), documenting the effects of Sfrp1 on the skeletal phenotype of ENPP1-deficient mice. The combined results demonstrate that catalysis-independent ENPP1 protein signaling regulates Sfrp1 transcription in order to maintain mammalian bone mass, the effects of which are evident at both cellular and organismal levels.

Comparison of qBEI at 10 and 23 weeks

qBEI was used to analyze the uniformity of bone matrix mineralization by evaluating BMDD, revealing that, in contrast to the effects on bone mass and osteoblast differentiation, ENPP1 deficiency had only minor influences on the variability of mineralization through the sections examined (Fig. 8A). Specifically, in 10-week-old mice CaMean (WT: 26.81% ± 0.49% versus Enpp1^T238A: 27.06% ± 0.29%) and CaWidth (WT: 3.22% ± 0.21% versus Enpp1^T238A: 3.21% ± 0.25%), which are representative parameters for mean matrix mineralization and its heterogeneity, showed no differences between Enpp1^T238A and WT controls (Fig. 8B). Likewise, no differences were found in 23-week-old mice for CaMean (WT: 27.95% ± 0.70% versus Enpp1^T238A: 28.40% ± 0.49%) and CaWidth (WT: 2.83% ± 0.21% versus Enpp1^T238A: 2.74% ± 0.11%). All other BMDD including osteocyte lacunar parameters (Table S5) were comparably affected in Enpp1^T238A and Enpp1^asj at 10 or 23 weeks when compared to WT siblings. Osteocyte lacunar area (Ot.Lc.Ar) was equivalently reduced in both Enpp1^T238A (reduced 13% and 19% from WT siblings at 10 and 23 weeks, respectively) and Enpp1^asj (reduced 12% and 19% from WT siblings at 10 and 23 weeks, respectively), whereas N.Ot.Lc/B.Ar was in range of control levels in all groups (Fig. 8C). The findings demonstrate that loss of ENPP1 catalytic activity in both models equivalently reduces osteocyte lacunar area. Although no direct signs of mineralization were observed, the mechanism may be due to either increased calcification, as suggested,⁽¹⁶⁾ or as a result of an already constricting embedding into the bone matrix.