Modeling PCDH19 clustering epilepsy by Neurogenin 2 induction of patient-derived induced pluripotent stem cells

2.1 Study subject and sample collection

A 19-year-old female patient was diagnosed with PCDH19-CE at the Medical Genetics Unit of the Azienda Ospedaliero-Universitaria Senese (Siena, Italy) after Sanger sequencing of PCDH19 gene. Previously, she was tested for mutations in the SCN1A gene—the most common gene causing epilepsy² and resulted negative. Genomic DNA of the patient was isolated from EDTA peripheral blood samples using a QIAamp DNA Blood Kit according to the manufacturer's protocol (Qiagen, Hilden, Germany). The frameshift mutation c.2133delG (p.Thr712Pro) was revealed in the blood cells' DNA. The mutation is not yet reported in the literature. The patient has focal epilepsy, mild ID, mental retardation, and motor deficits.

A skin specimen containing epidermis, dermis, and superficial fat was obtained from a punch biopsy of the forearm under local anesthesia. The sample was stored in phosphate buffered saline at room temperature and processed shortly after collection. The study protocol was approved by the Institutional Ethics Committee of the University of Siena/Azienda Ospedaliero-Universitaria Senese, Siena, Italy. The patient (and/or her parents) provided and signed a written informed consent at the Medical Genetics Unit for clinical data usage, and the use of DNA samples for both research and diagnosis purposes.

2.2 Cell cultures

All types of cells were cultured in the CO₂ incubator (Heracell, 37°C, 95% humidity, and 5% CO₂). Skin biopsy material from the patient was cut with a sterile blade into pieces of 1–2 mm and put into complete CHANG Medium C (Irvine Scientific, FUJIFILM) for the expansion of fibroblasts. The medium was changed every day until cells started to proliferate and reached 80% confluence. Primary dermal fibroblasts were cultured in the same complete medium. hiPSCs were grown in complete StemFlex medium (Thermo Fisher Scientific, USA) on Geltrex (Thermo Fisher Scientific, USA) coated plates. Cells were routinely passed with appropriate enzymes as soon as they reached 80%–90% confluence. All primary cells and cell cultures were grown in a medium with 1% penicillin–streptomycin (10 000 U/mL, Thermo Fisher Scientific, USA).

2.3 Generation of human-induced pluripotent stem cell and human-induced pluripotent stem cell–derived neurons

PCDH19-mutated hiPSC clones used in the study were generated and characterized by Marina Cardano from the Cell Technology Facility (CIBIO—University of Trento). HiPSC clones were obtained from patient's skin fibroblasts using Sendai virus particles delivering Yamanaka factors (CytoTune-iPS 2.0 Sendai Reprogramming Kit, Thermo Fisher Scientific, USA). Mature neurons were obtained from hiPSC through the overexpression of transcription factor Neurogenin-2 (Ngn2) by infection with lentiviral vectors to stably integrate transgenes into the genome of hiPSCs (Figure 1A). The protocol of generation of induced neurons from hiPSCs was modified from.^12-14 Briefly, we produced ultra-concentrated Lentivirus encoding Ngn2 and rtTA plasmids (a present from Prof. Anna Margherita Corradi, Department of Experimental Medicine, University of Genoa) using calcium phosphate method of transfection with third generation lentiviral packaging vectors in HEK293T cells.¹⁵ RtTA virus encodes a Tet-On Advanced transactivator and the second virus encodes Ngn2 under the control of Tet-controlled promoter, eGFP cassette and blasticidin resistance gene as a fusion protein linked by P2A and T2A sequences (Figure 1B). Doxycycline-induced lentiviral Ngn2 gene expression based on the Tet-On system allowed us to generate electrophysiologically active, mature neurons in 3 weeks.

2.4 Molecular biology methods

Genomic DNA and total RNA were isolated from pelleted cells. DNA from cells was extracted using QIAmp DNA Mini Kit (Qiagen, Germany). Total cellular RNA was extracted using TRIzol Reagent and RNeasy mini Kit (Life Technologies, USA). RNA concentration was quantified using Nanodrop-1000 spectrophotometer (Thermo Fisher Scientific, USA). In analyses, only samples of DNA with a 260/280 ratio of 1.8–2.0 and RNA with 260/230 ratio of 2.0–2.2 were used. cDNA was synthesized starting from 500 ng of total RNA with QuantiTect Reverse Transcription Kit (Qiagen, Germany) according to manufacturer's protocol.

The presence of PCDH19 mutation in the DNA of the patient's fibroblasts was confirmed by Sanger sequencing. Genomic DNA isolated from human primary dermal fibroblasts was amplified by PCR with primers flanking mutation sites (GGGCTCTGTGAACTTGTCCT; CAGAGGAGAAAGTGAGCCTA). Primers were designed using the online tool Primer3web version 4.1.0.¹⁶ PCR products were purified with Agencourt AMPure XP magnetic beads (Beckman Coulter, USA) and loaded for sequencing reaction with BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, USA) according to manufacturer's protocol. Samples were loaded on ABI PRISM 3130 Genetic Analyzer (Applied Biosystems, USA) and data were analyzed with Sequencher software V.4.9 (Gene Codes, USA). Sanger sequencing was also performed on coding DNA of hiPSC clones using the same protocol.

X-inactivation analysis was performed on genomic DNA template by standard human androgen receptor (HUMARA) X-chromosome inactivation assay as described in Ref. [17]. using a forward primer labeled with a fluorescent dye (5′-FAM) GCTGTGAAGGTTGCTGTTCCTCAT and reverse primer TCCAGAATCTGTTCCAGAGCGTGC. Samples were loaded with 0.25 μL of GeneScan 500 LIZ dye Size Standard (Thermo Fisher Scientific, USA) on ABI PRISM 3130 Genetic Analyzer (Applied Biosystems, Thermo Fisher Scientific; USA). To analyze PCDH19 expression in patients' cells, cDNA was amplified with the same primers used for genomic amplification as they were designed on two different exons and flanking mutation sites and sequenced on ABI PRISM 3130 Genetic Analyzer (Applied Biosystems, Thermo Fisher Scientific; USA) as described before.

2.5 Characterization of human induced pluripotent stem cells and neurons

Antibodies for immunostaining were used at the following dilutions: PCDH19 (1:300, HPA001461, Sigma, Germany), NeuN (1:300, ab177487, Abcam, UK), SOX2 (1:200, GTX101507, Genetex, USA), Nanog (1:200, sc-376915, Santa Cruz, USA), b3-Tubulin (1:300, sc-80005, Santa Cruz, USA), FOXA2 (1:100, sc-374376, Santa Cruz, USA), T-Brachyury (1:100, sc-166962, Santa Cruz, USA) goat anti-mouse or anti-rabbit IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 (1:2500, A-11004 and A-11011, Invitrogen, USA). Samples were analyzed by a confocal laser microscope Leica TCS SP8 (Leica, Germany) with 405 lex and 440–480 lem, 488 lex and 490–540 lem and 561 lex and 578–625 lem for DAPI, GFP and Alexa Fluor 568, respectively. All images were processed using ImageJ software (National Institutes of Health, USA).

2.6 Electrophysiology

Whole-cell patch-clamp electrophysiological recordings were performed by Prof. Maria Passafaro and Luca Murru in the NeuroMI Milan Center for Neuroscience, at the University of Milano-Bicocca with a Multiclamp 700B amplifier (Axon CNS Molecular Devices, USA) and using an infrared-differential interference contrast microscope Nikon Eclipse FN1 (Nikon, Japan). Patch electrodes (borosilicate capillaries with a filament and an outer diameter of 1.5 μm; Sutter Instruments, USA) were prepared with a four-step horizontal puller (Sutter Instruments, USA) and had a resistance of 3–5 MΩ. Voltage- and Current-clamp experiments were performed using an intracellular solution containing (in mM): 126 K-gluconate, 4 NaCl, 1 EGTA, 1 MgSO₄, 0.5 CaCl₂, 3 ATP (magnesium salt), 0.1 GTP (sodium salt), 10 glucose, and 10 HEPES–KOH (pH 7.28), and an external solution containing (in mM) 138 NaCl, 4 KCl, 2 CaCl₂, 1.2 MgCl₂, 10 HEPES, and 10 d-glucose, adjusted to physiological pH 7.4 with NaOH. To evaluate hiPSC-derived neurons active and passive membrane properties, a series of depolarizing current steps (0–230 pA) were injected (10 pA per step, 0.5 s duration) to evoke action potential (AP) firing. The AP frequency was correlated to the current injected in an input/output (I/O) curve. AP feature analysis was performed for the first AP evoked at rheobase. Voltage-clamp recordings of inward and outward currents were elicited by 5 mV steps (10 ms) from −75 to +85 mV and neurons were held at −65 mV. Currents were amplified, filtered at 5 kHz and digitized at 20 kHz. All the analyses were performed offline with Clampfit 10.1 software (PClamp, Molecular Devices, USA).

3.1 Case description and diagnosis

The patient is 19 years old, female, born at 40 weeks of an uneventful pregnancy by Caesarean section. Cytogenetic analysis on amniotic fluid sampling revealed a normal female karyotype. Birth weight was 3.2 kg, length was 51 cm. The proband showed a normal psychomotor development up to the age of 18 months, when she manifested focal febrile seizures and they continued to occur annually usually lasting several days. Brain MRI at 5 years of age was normal. EEG reported “right temporo-occipital irritative abnormalities”. The patient has been on therapy with phenobarbital and later on with topiramate till the age of 7. At 16 years of age, the patient had a recurrence of epileptic symptomatology, for which polypharmacological therapy was reintroduced (topiramate, carbamazepine and levetiracetam). When she was 11, she obtained a full scale IQ of 70 at WISC scale. A quite good performance at school was reported and at the last examination (19 years old) she was attending university. Frequent episodes of headache and some short-term memory difficulties were also reported. At the time of our first evaluation, the patient was 11 years old and already tested negative for mutations in SCN1A and SCN1B, and negative for chromosomal rearrangements. Exome sequencing was performed when the patient was 19 years old and revealed a single heterozygous frameshift mutation at chrX:99661461 (c.2133delG; p.Thr712Profs*8) within the exon 1 of PCDH19 (NM_001184880). The mutation was then confirmed by Sanger sequencing and is not present in parents.

3.2 PCDH19-CE hiPSCs

Patient's skin fibroblasts were analyzed for X-inactivation and a skewed X-inactivation pattern was confirmed by a HUMARA assay and showed a ratio of 75:25 (data not shown). Sanger sequencing of cDNA from fibroblasts confirmed the presence of WT and mutated alleles. Two hiPSC clones obtained from the patient's skin fibroblasts expressed mutant or WT allele (Figure 2). The cells carrying the wild-type allele of PCDH19 gene were used as control.

Human induced pluripotent stem cells were fully characterized by immunostaining and tested for self-renewal and pluripotency properties by trilineage differentiation. All clones had a typical hESC-like morphology (Figure 3A) and were able to form embryoid bodies (Figure 3B). HiPSC expressed self-renewal markers NANOG and SOX2 (Figure 3C). In vitro trilineage differentiation confirmed the ability of the clones to spontaneously differentiate into three germ layers (Figure 3D). The staining with anti-PCDH19 antibody showed the localization of the protein in the centrosomes of dividing cells (Figure 3E).

3.3 hiPSC-derived PCDH19-CE neurons

To investigate the role of PCDH19 during neurogenesis, mature neurons were obtained from hiPSC through the forced expression of Ngn2. We aimed to establish a mosaic cell line by mixing WT and mut hiPSC clones in a ratio 1:1, thus creating a cell model of PCDH19-CE where both cell populations co-exist. Neuronal differentiation of the generated hiPSC lines was assessed by immunostaining. Doxycycline-induced GFP expression of differentiated neurons was present from the first day of induction (Figure 4A) and all along the experiment. As expected, we observed neuron-like cells starting from DPI 5 (Figure 4B). All clones were already b3-tubulin positive starting from DPI 8 (Figure 4C) until the DPI 35 (Figure 4E). We stained mature neurons for b3-tubulin to assess the differences in neurite length and ramification between clones (Figure 4E). Mutated clone #24 expressed the mature neuronal marker NeuN at DPI 18 while WT clone #5 and mosaic – at DPI 24. (Figure 4D). HiPSC-derived neurons immunostained with neuronal markers were also GFP positive and easily distinguishable from the DAPI positive rat astrocytes (Figure 4D,E).

3.4 Neuronal excitability

To recreate the mosaic conditions, PCDH19 mut and PCDH19 WT hiPSCs were expanded and mixed in a 1:1 ratio (mosaic neurons). The current-clamp experiments showed a decrease in AP firing frequency upon depolarizing current injection (Figure 5B). We analyzed the features of the AP evoked by the injection of depolarizing current (Figure 5C) and it showed increased threshold and lowest AP amplitude in mut neurons (Figure 5D). We also observed an increased AP width in mosaic and mut clones that suggested alterations in AP kinetic (Figure 5D).

Voltage-clamp analysis helps to measure ion movements as electric currents (Figure 6). The clamp records reveal an inward current followed by an outward current during step depolarizations.¹⁸ The currents were recorded with depolarization steps ranging from −75 mV a + 85 mV in 5 mV steps. Current densities (Figure 6B) are expressed in current divided by capacitance and allow to calculate current densities and compare ionic currents in neurons. We observed the increase in inward and outward currents in mosaic neurons, compared to WT and mut neurons (Figure 6B,C).