Volume 7, Issue 3 e00482

RESEARCH ARTICLE

Open Access

Stevioside Ameliorates Palmitic Acid–Induced Abnormal Glucose Uptake via the PDK4/AMPK/TBC1D1 Pathway in C2C12 Myotubes

Changfa Zhang,

Changfa Zhang

Center for Clinical Epidemiology and Methodology (CCEM), Guangdong Second Provincial General Hospital, Guangzhou, China

Contribution: Data curation (equal), Methodology (equal), Validation (equal), Writing - original draft (equal)

Search for more papers by this author

Shuai Li,

Shuai Li

Center for Clinical Epidemiology and Methodology (CCEM), Guangdong Second Provincial General Hospital, Guangzhou, China

Contribution: Formal analysis (equal), Methodology (equal), Writing - original draft (equal)

Search for more papers by this author

Likang Li,

Likang Li

Center for Clinical Epidemiology and Methodology (CCEM), Guangdong Second Provincial General Hospital, Guangzhou, China

Contribution: Formal analysis (equal), Methodology (equal), Resources (equal), Writing - original draft (equal)

Search for more papers by this author

Ruoting Wang,

Ruoting Wang

Center for Clinical Epidemiology and Methodology (CCEM), Guangdong Second Provincial General Hospital, Guangzhou, China

Contribution: Formal analysis (equal), Investigation (equal), Methodology (equal), Writing - original draft (equal)

Search for more papers by this author

Shiming Luo,

Shiming Luo

Fertility Preservation Lab, Guangdong-Hong Kong Metabolism and Reproduction Joint Laboratory, Reproductive Medicine Center, Guangdong Second Provincial General Hospital, Guangzhou, China

Contribution: Investigation (equal), Methodology (equal), Supervision (equal), Writing - original draft (equal)

Search for more papers by this author

Guowei Li,

Corresponding Author

Guowei Li

[email protected]

orcid.org/0000-0002-1184-1791

Center for Clinical Epidemiology and Methodology (CCEM), Guangdong Second Provincial General Hospital, Guangzhou, China

Department of Health Research Methods, Evidence, and Impact (HEI), McMaster University, Hamilton, Ontario, Canada

Correspondence:

Guowei Li ([email protected])

Contribution: Formal analysis (equal), Methodology (equal), Project administration (equal), Writing - review & editing (equal)

Search for more papers by this author

Changfa Zhang,

Changfa Zhang

Center for Clinical Epidemiology and Methodology (CCEM), Guangdong Second Provincial General Hospital, Guangzhou, China

Contribution: Data curation (equal), Methodology (equal), Validation (equal), Writing - original draft (equal)

Search for more papers by this author

Shuai Li,

Shuai Li

Center for Clinical Epidemiology and Methodology (CCEM), Guangdong Second Provincial General Hospital, Guangzhou, China

Contribution: Formal analysis (equal), Methodology (equal), Writing - original draft (equal)

Search for more papers by this author

Likang Li,

Likang Li

Center for Clinical Epidemiology and Methodology (CCEM), Guangdong Second Provincial General Hospital, Guangzhou, China

Contribution: Formal analysis (equal), Methodology (equal), Resources (equal), Writing - original draft (equal)

Search for more papers by this author

Ruoting Wang,

Ruoting Wang

Center for Clinical Epidemiology and Methodology (CCEM), Guangdong Second Provincial General Hospital, Guangzhou, China

Contribution: Formal analysis (equal), Investigation (equal), Methodology (equal), Writing - original draft (equal)

Search for more papers by this author

Shiming Luo,

Shiming Luo

Fertility Preservation Lab, Guangdong-Hong Kong Metabolism and Reproduction Joint Laboratory, Reproductive Medicine Center, Guangdong Second Provincial General Hospital, Guangzhou, China

Contribution: Investigation (equal), Methodology (equal), Supervision (equal), Writing - original draft (equal)

Search for more papers by this author

Guowei Li,

Corresponding Author

Guowei Li

[email protected]

orcid.org/0000-0002-1184-1791

Center for Clinical Epidemiology and Methodology (CCEM), Guangdong Second Provincial General Hospital, Guangzhou, China

Department of Health Research Methods, Evidence, and Impact (HEI), McMaster University, Hamilton, Ontario, Canada

Correspondence:

Guowei Li ([email protected])

Contribution: Formal analysis (equal), Methodology (equal), Project administration (equal), Writing - review & editing (equal)

Search for more papers by this author

First published: 31 March 2024

https://doi.org/10.1002/edm2.482

Citations: 2

Funding: This study was funded by grants from the Science Foundation of Guangdong Second Provincial General Hospital (YY2018-002).

Share a link

Email
Wechat
Bluesky

ABSTRACT

Background

Stevioside (SV) with minimal calories is widely used as a natural sweetener in beverages due to its high sweetness and safety. However, the effects of SV on glucose uptake and the pyruvate dehydrogenase kinase isoenzyme (PDK4) as an important protein in the regulation of glucose metabolism, remain largely unexplored. In this study, we used C2C12 skeletal muscle cells that was induced by palmitic acid (PA) to assess the effects and mechanisms of SV on glucose uptake and PDK4.

Methods

The glucose uptake of C2C12 cells was determined by 2-NBDG; expression of the Pdk4 gene was measured by quantitative real-time PCR; and expression of the proteins PDK4, p-AMPK, TBC1D1 and GLUT4 was assessed by Western blotting.

Results

In PA-induced C2C12 myotubes, SV could significantly promote cellular glucose uptake by decreasing PDK4 levels and increasing p-AMPK and TBC1D1 levels. SV could promote the translocation of GLUT4 from the cytoplasm to the cell membrane in cells. Moreover, in Pdk4-overexpressing C2C12 myotubes, SV decreased the level of PDK4 and increased the levels of p-AMPK and TBC1D1.

Conclusion

SV was found to ameliorate PA-induced abnormal glucose uptake via the PDK4/AMPK/TBC1D1 pathway in C2C12 myotubes. Although these results warranted further investigation for validation, they may provide some evidence of SV as a safe natural sweetener for its use in sugar-free beverages to prevent and control T2DM.

1 Introduction

Type 2 diabetes mellitus (T2DM) remains a severe public health issue globally, with an expected amount of approximately 500 million in 2021 [1]. Unhealthy diet is a major risk factor contributing to T2DM [2], especially the long-term consumption of high-calorie foods and drinks [3]. To restrict excessive intake of energy, sugar-free beverages with sweetness have been emergingly used worldwide [4]. Sugar-free beverages are generally made with no- or low-calorie sweeteners instead of sucrose [5, 6], where the sweeteners can be categorised as either artificial or natural [7].

There is a growing body of evidence suggesting that artificial sweeteners may increase the risks of cancers, cardiovascular diseases and glucose intolerance [8-11]. In contrast, stevioside (SV), as a natural sweetener with no safety concerns reported so far [12], is 250–300 times sweeter than sucrose but has minimal calories [13]. Previous preclinical studies have found that SV may improve insulin resistance and glucolipid metabolism [14-16]. Nevertheless, few other studies reported no significant effect of SV on glucose uptake [17]. Therefore, more explorations are needed to further assess the impact and molecular mechanism of SV on glucose uptake.

Pyruvate dehydrogenase kinase isozyme 4 (PDK4) has been recognised as an important protein in the regulation of glucose metabolism [18]. It has been shown that the expression of PDK4 is significantly upregulated in skeletal muscles of patients with insulin resistance [19]. PDK4 can inhibit the activity of the pyruvate dehydrogenase (PDH) complex through phosphorylation, thereby regulating glucose uptake in muscles [20]. As the most important organ for maintaining systemic glucose homeostasis, abnormal functions of skeletal muscles could substantially impair glycaemic control and increase the risk of T2DM [21, 22]. However, the relationship between SV, PDK4 and glucose uptake in skeletal muscles remains unknown.

In this in vitro study, we used C2C12 cells of skeletal muscles from mice to investigate the effects of SV on glucose uptake and PDK4. Results from our study may generate some evidence of SV regarding its use in sugar-free beverages for the prevention and control of T2DM.

2 Materials and Methods

2.1 Cell Culture

C2C12 cells (STCC20027G; Servicebio, China) were cultured in Dulbecco's modified eagle medium (DMEM, C11995500BT; Gibco) supplemented with 10% (v/v) foetal bovine serum (FBS, AUS-01S-02; Cell-Box) and 1% (v/v) penicillin–streptomycin solution (15140-122; Gibco) in an incubator (37°C and 5% CO₂). Upon reaching 80% density, cells were differentiated for 3 d with DMEM culture solution containing 2% horse serum. Subsequently, the cells were manipulated according to various experimental requirements.

2.2 Reagent Preparation and Plasmid Construction

According to the literature, we chose the concentration of 0.4 mM (mmol/L) for palmitic acid (PA) [23-25]. To prepare PA, we first dissolved sodium palmitate (P9767; Sigma-Aldrich) in 1× PBS at 70°C, where 10% of fatty acid–free bovine serum albumin (BSA, A8850; Solarbio) was prepared in 1× PBS. Both solutions were mixed and conjugated at 55°C and then diluted with DMEM to obtain the required final concentration. According to the previous reports, the final molecular ratio of free fatty acid to BSA was 5.2:1 [26]. SV (HY-N0669, MCE) was prepared as a 40 mM concentrated reservoir solution with ultrapure water and set aside. Sodium dichloroacetate (DCA) as an inhibitor of PDK4 was made into a 50 mM concentrated reservoir with ultrapure water and finally diluted to a 0.5 mM working solution with the culture medium for further treatment.

We conducted the Pdk4-overexpressing plasmid as follows. First, the mEmerald-Mito-7 (#54160; Addgene) plasmid was digested using NheI with NotI. The CDS sequence of the Pdk4 gene (NCBI, NM_013743.2) was ligated to the mOrange sequence using T2A (sequence: GGAAGCGGAGAGGGCAGGGGAAGTCTTCTAACATGCGGGGACGTGGAGGAAAATCCCGGCCCC). Sequences were synthesised by Genewiz Biotechnology Ltd. (Suzhou, China), and the target fragments were recombined with linearised vectors using the ClonExpress Ultra One Step Cloning Kit (C115; Vazyme, China).

2.3 Glucose Uptake Assay

C2C12 cells were inoculated in 6-well plates and cultured for differentiation for 3 d. Then, the cultured cells were treated in the following ways: (1) treated with 0.4 mM PA for various times (0, 6, 12 and 24 h); (2) co-treated with different concentrations of SV (0.25, 0.5, 0.75 and 1 mM) with 0.4 mM PA for 24 h; (3) co-treated with 0.5 mM DCA with 0.4 mM PA for 24 h; and (4) transfected with the Pdk4-overexpressing plasmid using the Lipo6000 transfection reagent (C0526FT; Beyotime, China) for 24 h. The normal control group was the C2C12 cells treated with BSA alone.

Subsequently, the cells were starved with low-glucose medium for 2 h and cultured with 1× PBS containing 100 μM 2-NBDG (GC10289; GlpBio) for 30 min [27]. To measure the insulin-stimulated glucose uptake, cells were first treated with 1× PBS diluted with 100 nM insulin (P3376-100IU; Beyotime, China) for 30 min, followed by treatment with 100 μM 2-NBDG for 30 min. Finally, the cells were washed with DMEM twice and replaced with a new medium. The fluorescence detection and analysis was performed by the flow cytometry (CytoFLEX; Beckman Coulter, USA) to quantify the cells' glucose uptake.

2.4 Cell Viability

Cells were differentiated as described above and treated with BSA, 0.4 mM PA and 0.4 mM PA plus 0.75 mM SV for 24 h, respectively. Following this, in each well 100 μL of fresh culture solution was replaced and then incubated for 2 h with 10 μL of CCK-8 solution (A311; Vazyme, China) per well. Absorbance at 450 nm was detected by an enzyme-labelled instrument (Multiskan Sky; Thermo Scientific) to measure the cell viability.

2.5 Quantitative Real-Time PCR (qRT-PCR)

Total RNA was extracted from cell samples using the Total RNA Isolation Kit (RC101; Vazyme, China) according to the manufacturer's instructions. Reverse transcription was performed using 1 μg RNA as described in the cDNA Synthesis Kit (R323; Vazyme, China). The transcript levels of genes between groups were analysed using SYBR qPCR Master Mix (Q711; Vazyme, China) on the ABI7500 Real-Time System. Data were normalised with beta-actin and analysed by ${2}^{-\Delta \Delta {C}_{\mathrm{t}}}$ . Table 1 shows the sequences of all primers used in this study.

TABLE 1. Sequences of all primers for qRT-PCR.

Primers	Sequences	GenBank ID
beta-actin—Forward	5′-GGCTGTATTCCCCTCCATCG-3′	NM_007393.5
beta-actin—Reverse	5′-CCAGTTGGTAACAATGCCATGT-3′	NM_007393.5
Pdk4—Forward	5′-TCCGAAGCTGATGACTGGTG-3′	NM_013743.2
Pdk4—Reverse	5′-ACAGACCCACTTTGATCCCG-3′	NM_013743.2
Prkaa1—Forward	5′-GTCAAAGCCGACCCAATGATA-3′	NM_001013367.3
Prkaa1—Reverse	5′-CGTACACGCAAATAATAGGGGTT-3′	NM_001013367.3
Prkaa2—Forward	5′-CAGGCCATAAAGTGGCAGTTA-3′	NM_001356568.1
Prkaa2—Reverse	5′-AAAAGTCTGTCGGAGTGCTGA-3′	NM_001356568.1

2.6 Western Blotting Analysis

Cell samples were lysed with RIPA lysis buffer (P0013K; Beyotime, China) containing protease and phosphatase inhibitor cocktail (P1045; Beyotime, China) for 30 min on ice, when the cells were vortexed and mixed for every 5 min. Cell membrane proteins and cytoplasmic proteins were extracted using the Mammalian Membrane Protein Extraction Kit (DE301-01; TransGen, China). The protein concentration was determined by BCA Protein Assay Kit (P0012S; Beyotime, China). The separation gel of 10%–12% was prepared with the SDS-PAGE Gel Preparation Kit (P0012AC; Beyotime, China). After adding 20–40 μg of protein sample per well, electrophoresis was performed with Tris–Gly electrophoresis buffer in electrophoresis apparatus (PowerPac Basic; Bio-Rad, USA). Subsequently, the proteins were transferred to the PVDF membrane (IPVH00010; Merck Millipore) by a membrane transfer apparatus (PowerPac Basic; Bio-Rad, USA). Blocking was done with 5% skim milk. After the primary and secondary antibodies were incubated, the protein contents were detected by chemiluminescence with BeyoECL Star (P0018AS; Beyotime, China). In order to avoid errors due to re-sampling and to facilitate the subsequent analysis of the results, we used a special stripping buffer (P0025N; Beyotime, China) to remove the primary and secondary antibodies from the PVDF membrane and to block and re-incubate new antibodies. The integrated density of all protein images was analysed and measured by the ImageJ software.

Antibodies included the following: actin (1:1000, 20536-1-AP; Proteintech Group, China), PDK4 (1:1000, 12949-1-AP; Proteintech Group, China), phospho-AMPK (1:1000, p-AMPK, AF5908; Beyotime, China), AMPK (1:1000, AF6195; Beyotime, China), TBC1D1 (1:1000, 22124-1-AP; Proteintech Group, China), GLUT4 (1:1000, AF6999; Beyotime, China), ATP1A1 (1:1000, 14418-1-AP; Proteintech Group, China) and HRP-conjugated goat anti-rabbit IgG (1:2000, A0208; Beyotime, China).

2.7 Statistical Analyses

Data were described as mean ± standard deviation (SD). We analysed the overall data by one-way ANOVA and performed pairwise comparisons by Dunnett's test, both with a p < 0.05 indicating statistical significance. All statistical analyses were performed using GraphPad Prism 8.

3 Results

3.1 PA Reduced Glucose Uptake in C2C12 Myotubes While SV Could Enhance Glucose Uptake

C2C12 cells that had been differentiated for 3 d were treated with 0.4 mM PA. The ability of the C2C12 myotubes to uptake glucose from the medium gradually diminished with the duration of PA treatment (Figure 1A–C). Because the 24-h-treated group had the smallest glucose uptake when compared with the control group, we used the treatment of PA for 24 h to construct the model of lipid-induced abnormal cellular glucose uptake in C2C12 myotubes (i.e., the PA-alone-treated group for 24 h as the model). Glucose uptake was significantly reduced in insulin-stimulated C2C12 myotubes treated with PA for 24 h compared with the control group (Figure 1D,E), indicating the successful model of insulin resistance of C2C12 myotubes.

Details are in the caption following the image — **FIGURE 1**
Open in figure viewer PowerPoint

PA reduced glucose uptake in C2C12 myotubes while SV could enhance glucose uptake. (A) Flow diagram showing the treatment of C2C12 myoblasts (PA concentration as of 0.4 mM). (B) Glucose uptake capacity of C2C12 myotubes (differentiated for 3 d) at different time points of 0.4 mM PA treatment was measured by 2-NBDG, a fluorescent deoxyglucose derivative. (C) Quantitative analysis of the mean fluorescence intensity of 2-NBDG uptake of C2C12 myotube at different time points of 0.4 mM PA treatment. (D) The glucose uptake capacity of C2C12 myotubes was measured with 2-NBDG in the presence of insulin stimulation after 24-h treatment with 0.4 mM PA. (E) Quantitative analysis of the mean fluorescence intensity of 2-NBDG uptake by insulin-stimulated C2C12 myotubes (0.4 mM PA treatment for 24 h). (F) Glucose uptake capacity of C2C12 myotubes that were co-treated with different concentrations of SV and 0.4 mM PA for 24 h was examined by 2-NBDG. (G) Quantitative analysis of the mean fluorescence intensity of 2-NBDG uptake of C2C12 myotubes that were co-treated with different concentrations of SV and PA for 24 h. Each experiment was performed with three replications. Data are expressed as mean ± SD (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001.

Subsequently, C2C12 myotubes differentiated for 3 d were co-treated with different concentrations of SV (0.25, 0.5, 0.75 and 1 mM) plus 0.4 mM PA. It was found that the 0.75 mM of SV had the greatest effect on promoting glucose uptake when compared with the PA-alone-treated group (4078 ± 177.9 vs. 4742 ± 222.9 A.U., p = 0.016, Figure 1F,G). Therefore, 0.75 mM SV was used to treat the cells in all subsequent experiments.

3.2 SV Reduced PDK4 Expression in PA-Induced C2C12 Myotubes

We observed that 0.75 mM SV significantly reduced Pdk4 mRNA levels when compared with PA-alone-treated C2C12 myotubes (1.8 ± 0.6 vs. 3.0 ± 0.5 A.U., p = 0.019, Figure 2A). This finding was also confirmed by subsequent protein assays that showed a significantly reduced the level of PDK4 in 0.75 mM SV group (Figure 2B,C). Moreover, SV could significantly increase the cell viability of C2C12 myotubes when compared with the PA-alone-treated group (Figure 2D). We speculated that SV may improve cellular glucose uptake by reducing intracellular PDK4 levels. To test this hypothesis, we added 0.5 mM DCA (an inhibitor of PDK4) plus 0.4 mM PA to C2C12 myotubes for 24-h treatment. When compared with the PA-alone-treated group, DCA was found to significantly promote cellular glucose uptake (Figure 2E,F) and reduce the level of PDK4 (Figure 2G,H).

3.3 SV Increased p-AMPK and TBC1D1 Levels in PA-Induced C2C12 Myotubes

Since glucose is an intracellular energy donor and AMPK is a well-known energy-sensing factor, we subsequently explored whether SV could influence the AMPK expression. We observed that in the PA-alone-treated group, the levels of p-AMPK and TBC1D1 were significantly reduced when compared with the control group, while total AMPK levels were not significantly altered (Figure 3A–D). By contrast, SV could significantly increase the levels of p-AMPK and TBC1D1 when compared with the PA-alone-treated group (Figure 3A,B,D). Results from using DCA when compared with the PA-alone-treated group were largely similar to the findings of using SV (Figure 3A–D).

Compared with control group, neither PA, DCA nor SV could significantly alter total GLUT4 levels (Figure 3E). Moreover, in our post hoc experiments, we found that the GLUT4 level in the cell membrane of C2C12 myotubes in the SV group was significantly higher compared with the PA-alone-treated group, while the GLUT4 level in the cytoplasm in the SV group was significantly reduced (Figure 3F–H).

Surprisingly, increased mRNA levels of Prkaa1 but not Prkaa2 were observed in PA-alone-treated group, where Prkaa1 and Prkaa2 were two catalytic subunits of AMP-activated protein kinase. SV had no effect on the mRNA levels of Prkaa2, but reduced the mRNA levels of Prkaa1 when compared with the PA-alone-treated group (Figure 3I,J).

3.4 SV Decreased the Level of PDK4 and Increased the Levels of p-AMPK and TBC1D1 in Pdk4-overexpressing C2C12 Myotubes

To further validate the effect of SV on PDK4 expression in C2C12 myotubes, Pdk4-overexpressing plasmids were transfected into 3 d differentiated C2C12 myotubes and co-treated with 0.75 mM SV for 24 h. Cellular glucose uptake was found to be significantly reduced after transfection with the Pdk4-overexpressing plasmid when compared with the control group (empty vector transfection cells), whereas SV could significantly increase cellular glucose uptake (Figure 4A,B).

Pyruvate dehydrogenase kinase isozyme 4 levels in Pdk4-overexpressing C2C12 myotubes were significantly increased when compared with the control group (Figure 4C,D). SV yielded a significantly reduced level of PDK4 and increased levels of p-AMPK and TBC1D1 when compared with the Pdk4-overexpressing group (Figure 4C–F). However, no significant effect of Pdk4-overexpressing on total GLUT4 expression was found in C2C12 myotubes (Figure 4C,G).

4 Discussion

Currently, sugar-free beverages have been increasingly consumed mainly to reduce calorie intake and prevent obesity and T2DM. While concerns about artificial sweeteners regarding their potential harmful effects on health have been increasingly raised [8, 10], SV as a natural sweetener is recognised as a safe sweetener with high sweetness and minimal calories. In this study, we found that SV significantly improved glucose uptake of PA-treated skeletal muscle cells via the PDK4/AMPK/TBC1D1 pathway, further supporting its use in sugar-free beverages.

It has been shown that acute oral administration of SV increased insulin sensitivity and facilitated insulin glucose transport in skeletal muscle of Zucker rats [28]. Although SV had no effect on the body weight of mice, it may have hypoglycaemic and renoprotective effects on the streptozotocin-induced diabetes model [14]. For instance, SV could effectively inhibit oxidative stress in diabetic gastrocnemius muscle, promote glucose uptake and improve glucose tolerance in diabetic rats [29]. Nevertheless, evidence on the effects of SV on glucose uptake in skeletal muscles remained sparse and limited, making the mechanisms of SV for glucose uptake not fully understood.

Interestingly, we observed a significant effect of SV on glucose uptake by regulating PDK4 in a noninsulin-related manner. Pyruvate dehydrogenase kinase isozyme 4 is an important enzyme in the tricarboxylic acid (TCA) cycle, in which PDK4 can inhibit PDH activity, reduce pyruvate oxidation and promote fatty acid synthesis [30]. Upregulation of PDK4 leads to increased fatty acid utilisation, thereby decreasing the utilisation of glucose [31]. Studies have shown the important regulatory role of PDK4 in the development of insulin resistance in skeletal muscles [19]. In line with previous studies, our research also identified that PDK4 played a key role in controlling glucose metabolism in PA-induced C2C12 myotubes. Moreover, we found that SV significantly reduced the PDK4 levels and activated the AMPK/TBC1D1 signal to enhance glucose uptake. AMPK is an important factor in the regulation of intracellular energy homeostasis and glycolipid metabolism [32]. Intracellular PDK4 deficiency results in a decrease in ATP (adenosine triphosphate) levels, which could subsequently increase p-AMPK levels [33]. This was consistent with our results that increased levels of PDK4 in C2C12 myotubes causing reduced levels of p-AMPK. TBC1D1 is involved in the regulation of fatty acid oxidation and is also a key regulator of insulin- and exercise-stimulated glucose uptake [34]. Exercise increased the level of TBC1D1 phosphorylation and increased AMPKα2 activity in skeletal muscles [35], where the AMPKα2 subunit is the major donor that regulates the AMPK activity of TBC1D1 Ser237 phosphorylation [36]. Moreover, TBC1D4 was found to regulate GLUT4 translocation from the cytoplasm to the plasma membrane as a substrate for AMPK [37].

In this study, we found that SV increased the levels of p-AMPK and TBC1D1 in PA-induced C2C12 myotubes, while the total GLUT4 levels were not altered. Although stevia extracts and derivatives were shown to increase the GLUT4 levels in skeletal muscles [38], no such changes in the total GLUT4 levels were observed in this study. However, in PA-induced C2C12 myotubes, SV was found to promote GLUT4 translocation from the cytoplasm to the cell membrane, revealing that SV could enhance GLUT4 translocation rather than the quantity of GLUT4 level.

Interestingly, we also found that PA increased mRNA levels of Prkaa1 in C2C12 myotubes. PRKAA1 (protein kinase AMP-activated catalytic subunit α1) is a catalytic subunit of AMPK that plays a key role in the regulation of cellular energy metabolism [39]. Prkaa1 also significantly gets involved in lipid metabolism in skeletal muscles, and Prkaa1 deficiency results in delayed skeletal muscle development [40]. Therefore, we hypothesised that PA may have led to a compensatory increase in the mRNA level of Prkaa1 in the C2C12 myotubes, whereas SV could reverse this increase of Prkaa1 to improve glucose metabolism. However, PA reduced the level of p-AMPK in C2C12 myotubes, but did not change the mRNA level of Prkaa2. Thus, the regulation of AMPK activity by PA may not depend on PRKAA1 or PRKAA2. Similarly, given the increased level of p-AMPK and decreased mRNA level of Prkaa1 in SV when compared with PA, the effects of SV on AMPK activity may also be independent of the two major subunits of AMPK (PRKAA1, PRKAA2), requiring more research for further exploration.

Although we found that SV could promote glucose uptake via the PDK4/AMPK/TBC1D1 pathway, we could not fully illustrate the detailed mechanism of regulating TBC1D1 by PDK4/AMPK. In addition, the specific molecular mechanisms involved in the regulation of GLUT4 transport from the cytoplasm to the cell membrane by TBC1D1 required further elucidation. Moreover, whether SV could interact with insulin-related targets to modulate PDK4 and improve glucose uptake, warranted more research. Nevertheless, our study demonstrated that PDK4 may have the potential to serve as a molecular target for glucose uptake improvement, and SV may have beneficial effects on PDK4 and glucose uptake in skeletal muscle that was the most important organ for maintaining systemic glucose homeostasis. Even though these results required further investigation for validation, they may provide some evidence of SV as a safe natural sweetener for its use in sugar-free beverages to prevent and control T2DM.

5 Conclusion

In conclusion, SV could ameliorate PA-induced abnormal glucose uptake via the PDK4/AMPK/TBC1D1 pathway in C2C12 myotubes.

Author Contributions

Changfa Zhang: Data curation (equal); Methodology (equal); Validation (equal); Writing – original draft (equal). Shuai Li: Formal analysis (equal); Methodology (equal); Writing – original draft (equal). Likang Li: Formal analysis (equal); Methodology (equal); Resources (equal); Writing – original draft (equal). Ruoting Wang: Formal analysis (equal); Investigation (equal); Methodology (equal); Writing – original draft (equal). Shiming Luo: Investigation (equal); Methodology (equal); Supervision (equal); Writing – original draft (equal). Guowei Li: Formal analysis (equal); Methodology (equal); Project administration (equal); Writing – review and editing (equal).

Acknowledgements

The authors have nothing to report.

Disclosure

None declared.

Ethics Statement

Ethics approval was not required for this research.

Conflicts of Interest

The authors declare no conflicts of interest.

Open Research

Data Availability Statement

The data supporting the findings of this study are available from the corresponding author upon reasonable request.

References

1 GBDD Collaborators, “Global, Regional, and National Burden of Diabetes From 1990 to 2021, With Projections of Prevalence to 2050: A Systematic Analysis for the Global Burden of Disease Study 2021,” Lancet 402 (2023): 203–234, https://doi.org/10.1016/S0140-6736(23)01301-6.
10.1016/S0140-6736(23)01301-6
PubMed Web of Science® Google Scholar
2Y. Zheng, S. H. Ley, and F. B. Hu, “Global Aetiology and Epidemiology of Type 2 Diabetes Mellitus and Its Complications,” Nature Reviews. Endocrinology 14 (2018): 88–98, https://doi.org/10.1038/nrendo.2017.151.
10.1038/nrendo.2017.151
PubMed Web of Science® Google Scholar
3V. S. Malik and F. B. Hu, “The Role of Sugar-Sweetened Beverages in the Global Epidemics of Obesity and Chronic Diseases,” Nature Reviews. Endocrinology 18 (2022): 205–218, https://doi.org/10.1038/s41574-021-00627-6.
10.1038/s41574-021-00627-6
PubMed Web of Science® Google Scholar
4K. Wilk, W. Korytek, M. Pelczynska, M. Moszak, and P. Bogdanski, “The Effect of Artificial Sweeteners Use on Sweet Taste Perception and Weight Loss Efficacy: A Review,” Nutrients 14 (2022): 1261, https://doi.org/10.3390/nu14061261.
10.3390/nu14061261
PubMed Web of Science® Google Scholar
5Y. Kim, J. B. Keogh, and P. M. Clifton, “Non-Nutritive Sweeteners and Glycaemic Control,” Current Atherosclerosis Reports 21 (2019): 49, https://doi.org/10.1007/s11883-019-0814-6.
10.1007/s11883-019-0814-6
PubMed Web of Science® Google Scholar
6K. A. Higgins and R. D. Mattes, “A Randomized Controlled Trial Contrasting the Effects of 4 Low-Calorie Sweeteners and Sucrose on Body Weight in Adults With Overweight or Obesity,” The American Journal of Clinical Nutrition 109 (2019): 1288–1301, https://doi.org/10.1093/ajcn/nqy381.
10.1093/ajcn/nqy381
PubMed Web of Science® Google Scholar
7K. Kakleas, F. Christodouli, and K. Karavanaki, “Nonalcoholic Fatty Liver Disease, Insulin Resistance, and Sweeteners: A Literature Review,” Expert Review of Endocrinology and Metabolism 15 (2020): 83–93, https://doi.org/10.1080/17446651.2020.1740588.
10.1080/17446651.2020.1740588
CAS PubMed Web of Science® Google Scholar
8C. Debras, E. Chazelas, B. Srour, et al., “Artificial Sweeteners and Cancer Risk: Results From the NutriNet-Sante Population-Based Cohort Study,” PLoS Medicine 19 (2022): e1003950, https://doi.org/10.1371/journal.pmed.1003950.
10.1371/journal.pmed.1003950
CAS PubMed Web of Science® Google Scholar
9P. J. Landrigan and K. Straif, “Aspartame and Cancer – New Evidence for Causation,” Environmental Health 20 (2021): 42, https://doi.org/10.1186/s12940-021-00725-y.
10.1186/s12940-021-00725-y
CAS PubMed Web of Science® Google Scholar
10S. A. A. Shaher, D. F. Mihailescu, and B. Amuzescu, “Aspartame Safety as a Food Sweetener and Related Health Hazards,” Nutrients 15 (2023): 3627, https://doi.org/10.3390/nu15163627.
10.3390/nu15163627
CAS PubMed Web of Science® Google Scholar
11X. Li, Y. Liu, Y. Wang, et al., “Sucralose Promotes Colitis-Associated Colorectal Cancer Risk in a Murine Model Along With Changes in Microbiota,” Frontiers in Oncology 10 (2020): 710, https://doi.org/10.3389/fonc.2020.00710.
10.3389/fonc.2020.00710
CAS PubMed Web of Science® Google Scholar
12A. D. Mooradian, M. Smith, and M. Tokuda, “The Role of Artificial and Natural Sweeteners in Reducing the Consumption of Table Sugar: A Narrative Review,” Clinical Nutrition ESPEN 18 (2017): 1–8, https://doi.org/10.1016/j.clnesp.2017.01.004.
10.1016/j.clnesp.2017.01.004
PubMed Web of Science® Google Scholar
13V. Peteliuk, L. Rybchuk, M. Bayliak, K. B. Storey, and O. Lushchak, “Natural Sweetener Stevia rebaudiana: Functionalities, Health Benefits and Potential Risks,” EXCLI Journal 20 (2021): 1412–1430, https://doi.org/10.17179/excli2021-4211.
10.17179/excli2021‐4211
PubMed Web of Science® Google Scholar
14B. Geeraert, F. Crombe, M. Hulsmans, N. Benhabiles, J. M. Geuns, and P. Holvoet, “Stevioside Inhibits Atherosclerosis by Improving Insulin Signaling and Antioxidant Defense in Obese Insulin-Resistant Mice,” International Journal of Obesity 34 (2010): 569–577, https://doi.org/10.1038/ijo.2009.261.
10.1038/ijo.2009.261
CAS PubMed Web of Science® Google Scholar
15R. S. Kujur, V. Singh, M. Ram, et al., “Antidiabetic Activity and Phytochemical Screening of Crude Extract of Stevia rebaudiana in Alloxan-Induced Diabetic Rats,” Pharmacognosy Research 2 (2010): 258–263, https://doi.org/10.4103/0974-8490.69128.
10.4103/0974-8490.69128
CAS PubMed Google Scholar
16J. Y. Han, M. Park, and H. J. Lee, “Stevia (Stevia rebaudiana) Extract Ameliorates Insulin Resistance by Regulating Mitochondrial Function and Oxidative Stress in the Skeletal Muscle of db/db Mice,” BMC Complementary Medicine and Therapies 23 (2023): 264, https://doi.org/10.1186/s12906-023-04033-5.
10.1186/s12906-023-04033-5
CAS PubMed Google Scholar
17I. Aranda-Gonzalez, Y. Moguel-Ordonez, L. Chel-Guerrero, M. Segura-Campos, and D. Betancur-Ancona, “Evaluation of the Antihyperglycemic Effect of Minor Steviol Glycosides in Normoglycemic and Induced-Diabetic Wistar Rats,” Journal of Medicinal Food 19 (2016): 844–852, https://doi.org/10.1089/jmf.2016.0014.
10.1089/jmf.2016.0014
CAS PubMed Web of Science® Google Scholar
18W. Wei, Z. Y. Zhang, B. Shi, et al., “METTL16 Promotes Glycolytic Metabolism Reprogramming and Colorectal Cancer Progression,” Journal of Experimental & Clinical Cancer Research 42 (2023): 151, https://doi.org/10.1186/s13046-023-02732-y.
10.1186/s13046-023-02732-y
CAS PubMed Web of Science® Google Scholar
19T. Thoudam, C. M. Ha, J. Leem, et al., “PDK4 Augments ER-Mitochondria Contact to Dampen Skeletal Muscle Insulin Signaling During Obesity,” Diabetes 68 (2019): 571–586, https://doi.org/10.2337/db18-0363.
10.2337/db18-0363
CAS PubMed Web of Science® Google Scholar
20D. Dixit, F. Ahmad, R. Ghildiyal, S. D. Joshi, and E. Sen, “CK2 Inhibition Induced PDK4-AMPK Axis Regulates Metabolic Adaptation and Survival Responses in Glioma,” Experimental Cell Research 344 (2016): 132–142, https://doi.org/10.1016/j.yexcr.2016.03.017.
10.1016/j.yexcr.2016.03.017
CAS PubMed Web of Science® Google Scholar
21H. Wu and C. M. Ballantyne, “Skeletal Muscle Inflammation and Insulin Resistance in Obesity,” The Journal of Clinical Investigation 127 (2017): 43–54, https://doi.org/10.1172/JCI88880.
10.1172/JCI88880
PubMed Web of Science® Google Scholar
22K. F. Petersen, S. Dufour, D. B. Savage, et al., “The Role of Skeletal Muscle Insulin Resistance in the Pathogenesis of the Metabolic Syndrome,” Proceedings of the National Academy of Sciences of the United States of America 104 (2007): 12587–12594, https://doi.org/10.1073/pnas.0705408104.
10.1073/pnas.0705408104
CAS PubMed Web of Science® Google Scholar
23J. M. Cacicedo, S. Benjachareowong, E. Chou, N. B. Ruderman, and Y. Ido, “Palmitate-Induced Apoptosis in Cultured Bovine Retinal Pericytes: Roles of NAD(P)H Oxidase, Oxidant Stress, and Ceramide,” Diabetes 54 (2005): 1838–1845, https://doi.org/10.2337/diabetes.54.6.1838.
10.2337/diabetes.54.6.1838
CAS PubMed Web of Science® Google Scholar
24T. Brun, C. Jimenez-Sanchez, J. G. S. Madsen, et al., “AMPK Profiling in Rodent and Human Pancreatic Beta-Cells Under Nutrient-Rich Metabolic Stress,” International Journal of Molecular Sciences 21 (2020): 3982, https://doi.org/10.3390/ijms21113982.
10.3390/ijms21113982
CAS PubMed Web of Science® Google Scholar
25Z. Zhou, J. Qi, C. W. Lim, J. W. Kim, and B. Kim, “Dual TBK1/IKKepsilon Inhibitor Amlexanox Mitigates Palmitic Acid-Induced Hepatotoxicity and Lipoapoptosis In Vitro,” Toxicology 444 (2020): 152579, https://doi.org/10.1016/j.tox.2020.152579.
10.1016/j.tox.2020.152579
CAS PubMed Web of Science® Google Scholar
26Z. Zhou, J. W. Kim, J. Zhao, et al., “Treatment of Cigarette Smoke Extract and Condensate Differentially Potentiates Palmitic Acid-Induced Lipotoxicity and Steatohepatitis In Vitro,” Toxicology In Vitro 52 (2018): 33–40, https://doi.org/10.1016/j.tiv.2018.05.017.
10.1016/j.tiv.2018.05.017
CAS PubMed Web of Science® Google Scholar
27L. Yang, Y. Xue, J. Wei, Q. Dai, and P. Li, “Integrating Metabolomic Data With Machine Learning Approach for Discovery of Q-Markers From Jinqi Jiangtang Preparation Against Type 2 Diabetes,” Chinese Medicine 16 (2021): 30, https://doi.org/10.1186/s13020-021-00438-x.
10.1186/s13020-021-00438-x
CAS PubMed Web of Science® Google Scholar
28N. Lailerd, V. Saengsirisuwan, J. A. Sloniger, C. Toskulkao, and E. J. Henriksen, “Effects of Stevioside on Glucose Transport Activity in Insulin-Sensitive and Insulin-Resistant Rat Skeletal Muscle,” Metabolism 53 (2004): 101–107, https://doi.org/10.1016/j.metabol.2003.07.014.
10.1016/j.metabol.2003.07.014
CAS PubMed Web of Science® Google Scholar
29A. Deenadayalan, V. Subramanian, V. Paramasivan, et al., “Stevioside Attenuates Insulin Resistance in Skeletal Muscle by Facilitating IR/IRS-1/Akt/GLUT 4 Signaling Pathways: An In Vivo and In Silico Approach,” Molecules 26 (2021): 7689, https://doi.org/10.3390/molecules26247689.
10.3390/molecules26247689
CAS PubMed Web of Science® Google Scholar
30X. Song, J. Liu, F. Kuang, et al., “PDK4 Dictates Metabolic Resistance to Ferroptosis by Suppressing Pyruvate Oxidation and Fatty Acid Synthesis,” Cell Reports 34 (2021): 108767, https://doi.org/10.1016/j.celrep.2021.108767.
10.1016/j.celrep.2021.108767
CAS PubMed Web of Science® Google Scholar
31I. K. N. Pettersen, D. Tusubira, H. Ashrafi, et al., “Upregulated PDK4 Expression Is a Sensitive Marker of Increased Fatty Acid Oxidation,” Mitochondrion 49 (2019): 97–110, https://doi.org/10.1016/j.mito.2019.07.009.
10.1016/j.mito.2019.07.009
CAS PubMed Web of Science® Google Scholar
32E. C. Thomas, S. C. Hook, A. Gray, et al., “Isoform-Specific AMPK Association With TBC1D1 Is Reduced by a Mutation Associated With Severe Obesity,” The Biochemical Journal 475 (2018): 2969–2983, https://doi.org/10.1042/BCJ20180475.
10.1042/BCJ20180475
CAS PubMed Web of Science® Google Scholar
33B. Y. Park, J. H. Jeon, Y. Go, et al., “PDK4 Deficiency Suppresses Hepatic Glucagon Signaling by Decreasing cAMP Levels,” Diabetes 67 (2018): 2054–2068, https://doi.org/10.2337/db17-1529.
10.2337/db17-1529
CAS PubMed Web of Science® Google Scholar
34S. C. Hook, A. Chadt, K. J. Heesom, et al., “TBC1D1 Interacting Proteins, VPS13A and VPS13C, Regulate GLUT4 Homeostasis in C2C12 Myotubes,” Scientific Reports 10 (2020): 17953, https://doi.org/10.1038/s41598-020-74661-1.
10.1038/s41598-020-74661-1
CAS PubMed Web of Science® Google Scholar
35N. Jessen, D. An, A. S. Lihn, et al., “Exercise Increases TBC1D1 Phosphorylation in Human Skeletal Muscle,” American Journal of Physiology. Endocrinology and Metabolism 301 (2011): E164–E171, https://doi.org/10.1152/ajpendo.00042.2011.
10.1152/ajpendo.00042.2011
CAS PubMed Web of Science® Google Scholar
36C. Frosig, C. Pehmoller, J. B. Birk, E. A. Richter, and J. F. Wojtaszewski, “Exercise-Induced TBC1D1 Ser237 Phosphorylation and 14-3-3 Protein Binding Capacity in Human Skeletal Muscle,” The Journal of Physiology 588 (2010): 4539–4548, https://doi.org/10.1113/jphysiol.2010.194811.
10.1113/jphysiol.2010.194811
CAS PubMed Web of Science® Google Scholar
37C. de Wendt, L. Espelage, S. Eickelschulte, et al., “Contraction-Mediated Glucose Transport in Skeletal Muscle Is Regulated by a Framework of AMPK, TBC1D1/4, and Rac1,” Diabetes 70 (2021): 2796–2809, https://doi.org/10.2337/db21-0587.
10.2337/db21-0587
PubMed Web of Science® Google Scholar
38A. M. D. El-Mesallamy, S. A. Mahmoud, K. M. Elazab, S. A. M. Hussein, and A. M. Hussein, “Attenuation of Metabolic Dysfunctions in the Skeletal Muscles of Type 1 Diabetic Rats by Stevia rebaudiana Extracts, Via AMPK Upregulation and Antioxidant Activities,” Acta Scientiarum Polonorum. Technologia Alimentaria 17 (2018): 289–297, https://doi.org/10.17306/J.AFS.0567.
10.17306/J.AFS.0567
CAS PubMed Web of Science® Google Scholar
39Y. Zhang, X. Zhou, L. Cheng, et al., “PRKAA1 Promotes Proliferation and Inhibits Apoptosis of Gastric Cancer Cells Through Activating JNK1 and Akt Pathways,” Oncology Research 28 (2020): 213–223, https://doi.org/10.3727/096504019X15668125347026.
10.3727/096504019X15668125347026
PubMed Web of Science® Google Scholar
40W. Wu, Z. Xu, L. Zhang, et al., “Muscle-Specific Deletion of Prkaa1 Enhances Skeletal Muscle Lipid Accumulation in Mice Fed a High-Fat Diet,” Journal of Physiology and Biochemistry 74 (2018): 195–205, https://doi.org/10.1007/s13105-017-0604-y.
10.1007/s13105-017-0604-y
CAS PubMed Web of Science® Google Scholar

Citing Literature

Volume7, Issue3

May 2024

e00482

Stevioside Ameliorates Palmitic Acid–Induced Abnormal Glucose Uptake via the PDK4/AMPK/TBC1D1 Pathway in C2C12 Myotubes