Volume 11, Issue 5 pp. 2024-2039
ORIGINAL RESEARCH
Open Access

The phylogeny, phylogeography, and diversification history of the westernmost Asian cobra (Serpentes: Elapidae: Naja oxiana) in the Trans-Caspian region

Elmira Kazemi

Elmira Kazemi

Department of Environment, Faculty of Natural Resources and Environment, Science and Research Branch, Islamic Azad University, Tehran, Iran

Contribution: Conceptualization (equal), Data curation (equal), Formal analysis (equal), Writing - original draft (equal)

Search for more papers by this author
Masoud Nazarizadeh

Masoud Nazarizadeh

Department of Parasitology, Faculty of Science, University of South Bohemia, České Budějovice, Czech Republic

Institute of Parasitology, Biology Centre CAS, v.v.i., České Budějovice, Czech Republic

Contribution: Data curation (equal), Formal analysis (equal), Software (equal)

Search for more papers by this author
Faezeh Fatemizadeh

Faezeh Fatemizadeh

Department of Environmental Science, Faculty of Natural Resources, University of Tehran, Karaj, Iran

Contribution: Data curation (equal), Formal analysis (equal), Methodology (equal), Writing - original draft (equal)

Search for more papers by this author
Ali Khani

Ali Khani

Department of Environment, Khorasan Razavi, Mashhad, Iran

Contribution: Methodology (equal), Writing - original draft (equal)

Search for more papers by this author
Mohammad Kaboli

Corresponding Author

Mohammad Kaboli

Department of Environmental Science, Faculty of Natural Resources, University of Tehran, Karaj, Iran

Correspondence

Mohammad Kaboli, Department of Environmental Science, Faculty of Natural Resources, University of Tehran, Karaj, Iran.

Email: [email protected]

Contribution: Conceptualization (equal), Formal analysis (equal), Methodology (equal), Supervision (equal), Validation (equal), Writing - review & editing (equal)

Search for more papers by this author
First published: 22 December 2020
Citations: 13

Abstract

We conducted a comprehensive analysis of the phylogenetic, phylogeographic, and demographic relationships of Caspian cobra (Naja oxiana; Eichwald, 1831) populations based on a concatenated dataset of two mtDNA genes (cyt b and ND4) across the species' range in Iran, Afghanistan, and Turkmenistan, along with other members of Asian cobras (i.e., subgenus Naja Laurenti, 1768). Our results robustly supported that the Asiatic Naja are monophyletic, as previously suggested by other studies. Furthermore, Nkaouthia and N. sagittifera were recovered as sister taxa to each other, and in turn sister clades to N. oxiana. Our results also highlighted the existence of a single major evolutionary lineage for populations of N. oxiana in the Trans-Caspian region, suggesting a rapid expansion of this cobra from eastern to western Asia, coupled with a rapid range expansion from east of Iran toward the northeast. However, across the Iranian range of N. oxiana, subdivision of populations was not supported, and thus, a single evolutionary significant unit is proposed for inclusion in future conservation plans in this region.

1 INTRODUCTION

African and Asian cobras (genus Naja Laurenti, 1768) comprise four subgenera (Wallach et al., 2009), including Naja (Laurenti, 1768), Uraeus (Wagler, 1830), Boulengerina (Dollo, 1886), and Afronaja subgen.nov, within which the typical form Naja (Naja) is restricted to 11 species in Asia, occurring from Trans-Caspia to southern and southeastern Asia, throughout the East Indies, the Philippines, and the Lesser Sunda Islands (Figure 2; Slowinski & Wüster, 2000; Wüster & Broadley, 2003). This subgenus is thought to have an African origin which likely originated from a single invasion of Asia from Africa (Slowinski & Wüster, 2000; Wallach et al., 2009; Wüster et al., 2007). Fang structure is variable within the subgenus Naja in that, except for N. naja and N. oxiana, all other members of the subgenus have fully or partially evolved the spitting behavior (Gold et al., 2002; Lin et al., 2014; O'Shea, 2008; Wüster & Broadley, 2003; Wüster & Thorpe, 1992) (Figure 1).

Details are in the caption following the image
The Caspian cobra (Naja oxiana), aka the Central Asian cobra. This member of the family Elapidae is a nonspitter. Credit: Ali Khani
Details are in the caption following the image
Top: map showing the distribution of the 11 cobra species of Asiatic Naja, ranging from Trans-Caspia to southern and southeastern Asia. Geographic ranges were obtained from the IUCN Red List (IUCN, 2020) and Wüster (1996) and updated for some species based on new occurrence records. Blue circles represent N. oxiana occurrence points that lie outside the species' known range. White dotted line represents N. sumatrana's range boundary. Bottom: map of sampling localities of the 38 specimens from Iran, Turkmenistan, and Afghanistan. Colors correspond to sampling localities of N. oxiana, namely Golestan (purple), Semnan (orange), Northern Khorasan (light blue), Central Khorasan (dark blue), and Southern Khorasan (yellow) provinces of Iran, as well as Turkmenistan (red) and Afghanistan (green). Black triangles once again represent N. oxiana's occurrence points that lie outside the species' known range

The Caspian cobra N. oxiana (Eichwald, 1831) has the westernmost Asian distribution in this subgenus. The species occurs in relatively dry, stony habitats of the Trans-Caspian region including areas with dispersed vegetation in northeastern Iran, Turkmenistan, Uzbekistan, Kyrgyzstan, southwestern Tajikistan, eastern and northern Afghanistan, Pakistan, and northern India (Klemmer, 1968; Rajabizadeh, 2018; Valenta, 2009). Within its distribution range, N. oxiana is subdivided into eastern and western populations, split by the Hindu Kush Mountains and desert zones of southern Afghanistan, southeastern Iran, and southwestern Pakistan (Wüster, 1990). However, a new population in its eastern distribution has been recently recorded in Himachal Pradesh, India, at an altitude of approximately 2,100 m (Santra et al., 2019). Based on morphological characters, Wüster (1990) suggested that the western population is relatively homogeneous but morphologically different from the eastern population. Additionally, western N. oxiana populations appear to lack cuneate scales, whereas eastern populations, similar to most cobras of Asiatic Naja, have a cuneate scale on each side.

The distribution, demography, biology, ecology, and conservation status of the Caspian cobra remain largely undescribed. Even though some molecular studies have investigated Asian and African cobras (Kazandjian et al., 2020; Lin et al., 2008, 2012, 2014; Ratnarathorn et al., 2019; Santra et al., 2019; Wallach et al., 2009; Wüster et al., 2007), the phylogenetic and phylogeographic status, as well as the evolutionary history and population structure of the Caspian cobra in the Trans-Caspian region, are still poorly known. The only study conducted on the genetic structure and phylogeny of the Caspian cobra in Iran, using 589 base pairs (bp) of the mitochondrial D-loop region, revealed low genetic diversity and unstructured populations of the Iranian Caspian cobra (Shoorabi et al., 2017). Yet, it is unclear when or how the species dispersed into northeastern Iran, expanding its range from the dry and semidry mountainous habitats bordering Iran, Afghanistan, and Turkmenistan to the hot and humid plains of Golestan Province, southeast of the Caspian Sea. This species is known as rare and vulnerable in Iran (Darvish & Rastegar-Pouyani, 2012) and is listed in Appendix II of CITES; however, it has been designated as “data deficient” (DD) under the criteria of the International Union for Conservation of Nature (IUCN). For nearly a century, this cobra has been intensively harvested for venom extraction by the largest Iranian venom manufacturing center, the Razi Institute for Serum and Vaccine Research (Darvish & Rastegar-Pouyani, 2012), which is perceived to be the main cause for the dramatic decline in its wild populations.

Here, we aimed to ascertain the first insight into the phylogeny and phylogeography of the Caspian cobra across its distribution range in the Trans-Caspian region, using the Cytochrome b (cyt b) and NADH dehydrogenase subunit 4 (ND4) markers. We sought to (a) demonstrate the phylogenetic relationships of the Caspian cobra and other members of Asian cobras (subgenus Naja), (b) uncover the phylogenetic processes, including the timing and mechanisms of the species' colonization from southwest Asia into Iran and subsequently to the plains of the Caspian Sea, and (c) delineate the evolutionary lineages of the Caspian cobra across its geographical range in the Trans-Caspian region and define the species' ESUs in Iran.

2 MATERIAL AND METHODS

2.1 Sample collection

Sampling permits were issued by the Department of Environment of Iran (license numbers: 94/43027 and 94/17701). Tissue sampling of 38 N. oxiana specimens was done from western populations of the species in Turkmenistan, Afghanistan, and Iran during 2014–2016. Samples of each specimen consisted of three scale clippings taken from the outer layer of the ventral scales, except for 10 muscle tissue samples acquired from museums of Turkmenistan and Afghanistan (Figure 2). After sampling, the cobras were immediately released back at their capture location. All procedures were carried out following the relevant guidelines and approved regulations. Also, we obtained 47 sequences of 11 Asian cobras (two samples of N. oxiana, seven samples of N. atra CANTOR, 1842; three samples of N. naja LINNAEUS, 1758; six samples of N. siamensis LAURENTI, 1768; four samples of N. sumatrana MÜLLER, 1887; five samples of N. philippinensis Taylor, 1922; three samples of N. samarensis Peters, 1861; two samples of N. sagittifera WALL, 1913; three samples of N. sputatrix F. Boie, 1827; nine samples of N. kaouthia LESSON, 1831; and three samples of N. mandalayensis Slowinski & Wüster, 2000) from GenBank (Appendix A).

2.2 DNA isolation, amplification, and fragment analysis

For genomic DNA extraction, we used the standard phenol/chloroform protocol. Two fragments of the mtDNA containing 1,060 bp of the cyt b and 699 bp of the ND4 loci were amplified using four pairs of modified primers (ND4/Leu (Arevalo et al., 1994) and L14910/H16064 (Burbrink et al., 2000; Table 1). For PCR mix preparation, a final volume of 25 µl consisting of 1 µl of primer, 12.5 µl of Taq Mix (2×), 5 ng of template DNA, and 5.5 µl of double-distilled H2O was used. Typical amplification conditions involved a 5-min initial denaturation step at 95°C and 35 cycles at 95°C for 30 s. Next, primer annealing was done at 58°C (cyt b) and 52°C (ND4) for 30 s, and 72°C for 1 min, followed by a 5-min primer extension step at 72°C. PCR products were then analyzed and verified by agarose electrophoresis. Sequencing of the purified products was performed in an ABI PRISM 3730xl automatic sequencer (Korea Genomics, Bioneer).

Table 1. Modified sequences of the primers used for PCR and/or sequencing
Primers Sequences Sources

cyt b-F1

cyt b-R1

GTCCTGCGGCCTGAAAAACCACCGTTGT

CTTTGGTTTACAAGAACAATGCTTTG

Modified from Burbrink et al. (2000)

cyt b-F2

cyt b-R2

AACAGCCTTCTTCGGATACG

AATCGGGTGAGGGTTGGG

ND4-F1

ND4-R1

CACCTTTGACTACCCAAAGCCCACGTCGAAGC

CCTTACTTTTACTGGGATTTGCACCA

Modified from Arevalo et al. (1994)

ND4-F2

ND4-R2

CCTCATCAGCACTATTCTGCCTAGC

TATAAGTAGGTGTTCTCGTGAGTG

2.3 Sequence analysis

The SeqScape version 2.6 software (Applied Biosystems) was used for editing the sequences, and ClustalW via MEGA version 5 (Tamura et al., 2011) was applied for generating a multiple sequence alignment. Sequences of protein coding genes were translated to search for possible stop codons due to pseudogene production. The substitution saturation test (Xia et al., 2003) was conducted using DAMBE version 6.0.4 (Xia, 2013). Genetic diversity (nucleotide and haplotype diversities), polymorphic sites, and haplotype numbers were measured using DnaSP version 5.0 (Librado & Rozas, 2009). Genetic distances and composition of nucleotides were examined based on the uncorrected pairwise genetic distances with 1,000 bootstraps using MEGA version 5 (Tamura et al., 2011). Furthermore, we computed all pairwise distances, between and among groups, nucleotide composition and translation/transversion ratios using MEGA version 5 (Tamura et al., 2011). We also performed a partition homogeneity test to evaluate differences in phylogenetic information content among the two mitochondrial fragments via the Shimodaira–Hasegawa (SH; Shimodaira & Hasegawa, 1999) and the approximate unbiased (AU) tests in PAUP* version 4.0b10 (Swofford, 2002), conducted with heuristic searches of 1,000 replicates.

2.4 Phylogenetic analyses

We constructed a concatenated dataset of two fragments of mtDNA including 1,759 bp in length for 38 samples of N. oxiana from the western population in Iran, Turkmenistan, and Afghanistan, two samples of N. oxiana from the eastern population downloaded from GenBank (1,309 and 1,312 bp in length), 45 samples of the other ten Asiatic Naja species from GenBank, and finally two samples of African cobras (N. nivea and N. haje) downloaded from GenBank, which were used as out-groups. Phylogenetic tree reconstructions were done based on the Bayesian inference (BI) and maximum-likelihood (ML) approaches. To determine the optimal substitution models and partitioning schemes at first, second, and third codon positions, PartitionFinder version 1.1.1 (Lanfear et al., 2012) was adopted for both the BI and ML analyses. Partitioning of three different data subsets was detected: (a) cyt b-pos1/ND4-pos1, (b) cyt b-pos2/ND4-pos2, and (c) cyt b-pos3/ND4-pos3, for which the best fitting models were found to be TRN+I+Γ, GTR+I+Γ, and HKY+I, respectively.

We used IQ-Tree version 1.6.8 (Nguyen et al., 2014) to build an ML tree using 1,000 nonparametric bootstrap replicates and estimate support of the tree topology (Hoang et al., 2018). Furthermore, a Bayesian phylogenetic reconstruction was performed using the selected scheme in MrBayes version 3.2.4 (Ronquist & Huelsenbeck, 2003). For Bayesian inference, four Markov chains Monte Carlo runs (one cold and three heated chains (MC3)) were simultaneously used for 40 million generations with two replicates, sampling the trees every 1000th generation and removing the first 25% burn-in trees. By combining the remaining trees, we obtained a 50% majority rule consensus tree. Tracer version 1.7 was implemented to visualize the results and to measure stationarity and convergence of the chains (Rambaut et al., 2018). Bayesian posterior probabilities were computed to check for support of the Bayesian tree branches.

2.5 Analyses of population genetic structure

To detect genetic clusters in the concatenated mtDNA dataset, we applied the Bayesian inference of genetic structures of populations in BAPS version 6.0 (Corander et al., 2013). A range of 1–20 was considered for values of the number of clusters (K). Moreover, two haplotype networks were constructed to reveal haplotype relationships among the 11 Asian cobras. To reconstruct the phylogenetic relationships among Asian cobras, SplitsTree version 4.6 (Huson & Bryant, 2006) was used and a neighbor-net network was generated using the uncorrected patristic distances with 1,000 bootstrap replicates, and to plot haplotype relationships within N. oxiana populations, TCS algorithm was used in PopArt (Leigh & Bryant, 2015).

2.6 Molecular dating estimates

To determine divergence times, BEAST version 1.8.0 (Drummond & Rambaut, 2007) was implemented using three fossil calibration points recommended by Head et al. (2016) including (a) Viperinae: the divergence between Crotalinae and Viperinae dating back to at least 20 Mya (Szyndlar & Rage, 1990; Wüster et al., 2008). For this node, we used a lognormal prior with 20 Mya as zero offset, a standard deviation of 1 and a mean of 1, providing a 95% confidence interval of 20.52–34.08; and (b) Bungarus: following the divergence time between Bungaurs bungaroides, B. flaviceps, and the B. fasciatus clade around 10.215 Mya (Barry et al., 2002), providing a confidence interval of 10.74–24.3. To constrain this node, we used a standard deviation of 1, a mean of 1 and an offset zero of 17.0 Mya. (c) Naja: We used N. romani fossil (Hoffstetter, 1939) which marks the divergence between Naja and Haemachatus dating back at 17 Mya modeled using lognormal prior with a 95% confidence interval of 17.52–31.08.

In search of the fittest partitioning schemes for our data and models of evolution for molecular dating analyses, PartitionFinder version 1.1.1 (Lanfear et al., 2012) was utilized. Also, a birth–death process was applied as it is more fitting for a multispecies sequence dataset (Drummond & Rambaut, 2007). Fitness of the molecular clocks (strict, exponential relaxed, and lognormal relaxed) was assessed based on the Bayes factor support value (Brandley et al., 2005) estimated by Tracer version 1.5. For the dating analyses, we ran two independent Markov chains for 40 million generations, sampling every 1000th generation and removing the first 25% burn-in trees. To check for convergence of MCMC runs, stationary distribution of the chains, adequate chain mixing, and effective sample sizes of parameters, we used Tracer version 1.5.

We added 29 sequences from GenBank to our concatenated dataset including: two species of African cobras (N. nivea and N. haje), one species of Hemachatus, three species of Bungarus, three species of Macrovipera, eight species of Montivipera, two species of Vipera, four species of Porthidium, four species of Crotalus, and two species of Sistrurus for our molecular dating (see Appendix A).

2.7 Neutrality tests and demographic analyses

The Extended Bayesian Skyline Plot (EBSP; Ho & Shapiro, 2011) was created in Beast version 2.4.7, allowing us to estimate the demographic history of N. oxaina using the concatenated mtDNA dataset. Strict molecular clocks were used with a mutation rate of 0.0065/site/myr (Lin et al., 2014). The MCMC chain was set to a total of 500 million steps, and the Markov chain was sampled every 10,000 steps. To check for convergence of MCMC runs and examine effective sample sizes (>200), Tracer version 1.5 was utilized. Bayesian skyline plots were created using the EBSP R function (Heled & Drummond, 2008).

The demographic signatures of population expansion in N. oxiana were inferred using mismatch distributions. We calculated sums of squared deviations (SSD) and Harpending's raggedness index (RI) in Arlequin version 3.1 (Excoffier & Lischer, 2010) for comparison of observed distributions with expected distributions under the expansion model. Additionally, tests of Fu's Fs statistics (Fu, 1997) and Tajima's D (Tajima, 1989) were estimated to test equilibrium of the population in Arlequin version 3.1 (Excoffier & Lischer, 2010). Negative statistics signify an excess of low frequency alleles, which suggests size expansion and/or purifying selection of a population (Tajima, 1989).

3 RESULTS

3.1 Phylogenetic reconstructions

Based on our phylogenetic reconstruction analyses, our concatenated dataset of 38 sequences of the western population of N. oxiana revealed 1,721 invariable sites, 34 singletons, and 4 parsimony informative sites, out of 1,759 bp aligned positions. No indels (insertions/deletions) or stop codons were detected in the alignment. The sequences had the following base compositions: T = 26.0%, C = 31.7%, A = 31.1%, and G = 11.2%. Additionally, nucleotide (pi) and haplotype (h) diversities were estimated to be 0.0075 and 0.75 for N. oxiana, respectively.

According to the HKA tests, our mtDNA polymorphisms showed no departure from expectations of the neutral model of evolution. Results of the HKA tests revealed nonsignificant differences from neutrality for cyt b (44 sequences, χ2 = 0.116, p = .73) and ND4 (38 sequences, χ2 = 0.015, p = .83). Furthermore, saturation analyses showed that the two mtDNA genes were suitable for phylogenetic analyses, with index values of the observed substitution saturation (ISS) being significantly smaller than the critical (ISSc) values (not shown here), signifying minimal substitution saturation. Also, the AU and SH partition homogeneity tests were nonsignificant (p > .05), verifying that the genes could be combined for phylogenetic analyses.

Both ML and BI phylogenetic trees generated congruent branching patterns. In both reconstructions, Nnaja was strongly supported as the basal lineage for the remaining lineages by high BI posterior probability (1.00) support and ML bootstrap value (99). Furthermore, southeastern Asian (N. siamensis, N. sumatrana, N. philippinensis, N. samarensis, N. sputatrix, and N. mandalayensis) and western, central, southern, and eastern Asian (Noxiana, Nkaouthia, N. sagittifera, and Natra) cobras were separated into well-diverged clades supported by high BI (1.00) and ML (95) values. However, we neither found support for significant divergence between western and eastern populations of N. oxiana, as sequences from the eastern population (MT346713 and MT346714) were nested within the western population, nor any genetic differentiation among N. oxiana populations in the Trans-Caspian region (northeastern Iran, Turkmenistan, and Afghanistan), as these populations formed a single well-supported clade with the other clades of Asian cobras (1.00 BI and 100 Ml). Moreover, our finding of Nkaouthia and N. sagittifera being recovered as sister taxa (1.00 BI and 100 Ml), and in turn as sister clades to N. oxiana with high support values (1.00 BI and 92 Ml) (Figure 3) is new.

Details are in the caption following the image
Bayesian tree reconstructed using the concatenated mtDNA dataset (branching pattern and clade positions are concordant with the ML tree), using two out-groups (N. nivea and N. haje). Nodal support at each node indicates BI (left) and ML (right) support values. The six species in square bracket at the top are spitters, the three species underlined in black (N. atra, N. kaouthia, N. sagittifera) are possible spitters, and the two species underlined in red at the bottom (N. oxiana and N. naja) are nonspitters

3.2 Haplotype networks

We detected 23 haplotypes for N. oxiana using 38 novel sequences. The haplotype network plotted by SplitsTree v4.6 (Figure 4) using the concatenated mtDNA matrix (40 samples of N. oxiana and 45 samples of the other Asian cobras) detected 12 distinct haplogroups within Asian cobras, in accordance with the phylogenetic tree. Based on the phylogenetic network, N. kaouthia and N. sagitifera separated from each other with high statistical value (100 bootstrap support) and diverged from N. oxiana with 100 bootstrap value. Moreover, these three haplogroups differed from N. atra and N. kaouthia-north lineage with 98% bootstrap value. All these haplogroups separated from southeastern Asian cobras including N. samarensis, N. philippinensis, N. sumatrana, N. siamensis, N. manadalayensis, and N. sputatrix with 100% bootstrap support. In addition, N. naja showed a divergence from all Asiatic Naja with high bootstrap value (100%).

Details are in the caption following the image
SplitsTree network using a 1,759-bp concatenated dataset (85 sequences) detected 12 distinct haplogroups within Asian cobras, in accordance with the phylogenetic tree. N. nivea and N. haje were used as out-groups. Colors correspond to those shown in Figure 2 (top) and Figure 3

Furthermore, using the concatenated mtDNA matrix of N. oxiana and in line with the phylogenetic reconstructions, TCS version 1.21 found no significant haplotype clusters from Afghanistan, Turkmenistan, and northeastern Iran (Figure 5). All populations were accompanied by multiple shared haplotypes, connected to each other by small numbers of mutational steps (1–6 steps). In addition, the BAPS analysis placed N. oxiana populations into one cluster (Figure 6), congruent with the haplotype network.

Details are in the caption following the image
Haplotype network of N. oxiana from the Trans-Caspian region (38 sequences). The central haplotype includes samples from Central Khorasan, Northern Khorasan, Golestan, Turkmenistan, and Afghanistan. Mutational steps are indicated by dash symbols along each line connecting haplotypes and branch lengths roughly correspond to mutation steps. Circle sizes correlate with haplotype frequencies. Black circles represent extinct or unsampled haplotypes. Colors correspond to those shown in Figure 2 (bottom)
Details are in the caption following the image
Bayesian spatial clustering for groups of individuals of N. oxiana performed in BAPS. The mixture analysis was set for K = 1 (one cluster)

3.3 Divergence times

Analyses of divergence placed the basal cladogenesis among the Asian cobras in the late Miocene (Tortonian Age) at approximately 8.82 Mya (95% HPD: 5.96–11.99 Mya; Figure 7: node A), with the nonspitting N. naja (Wüster & Thorpe, 1992) emerging as the basal clade of all Asian cobras. Subsequent cladogenetic events dating to late Miocene (Messinian Age) at ∼6.07 Mya (95% HPD: 4.21–8.02 Mya; Figure 7: node B) isolated the ancestor of spitting cobras of southeastern Asia (N. siamensis, N. sumatrana, N. philippinensis, N. samarensis, N. sputatrix, and N. mandalayensis) from non/occasional spitters (N. oxiana, N. kaouthia, N. atra, and N. sagittifera). Later cladogenetic events between N. atra and western-central-southern Asian cobras (N. oxiana, N. kaouthia, and N. sagittifera) dated to early Pliocene (Zanclean Age) (3.98 Mya, 95% HPD: 2.56–5.49 Mya; Figure 7: node C), whereas the divergence between N. oxiana and its sister taxa, N. kaouthia and N. sagittifera, took place during late Pliocene (Piacenzian Age) (3.21 Mya, 95% HPD: 1.94–4.48 Mya; Figure 7: node D). However, our molecular dating showed that a cladogenetic event dating to late Pliocene at ∼2.95 Mya (95% HPD: 1.54–4.42 Mya; Figure 7: node E) isolated the nominated “north-eastern population of N. kaouthia” of Nakhon Ratchasima Province, Thailand, a paraphyletic taxon that has been recently proposed as a new Naja for Asia (Ratnarathorn et al., 2019). Finally, the last divergence of non/occasional spitting cobras occurred between N. kaouthia and N. sagittifera at 1.81 Mya (95% HPD: 0.99–2.61 Mya; Figure 7: node F) during early Pleistocene (Gelasian Age).

Details are in the caption following the image
Chronogram resulting from dating analyses using the concatenated mtDNA dataset (cyt b + ND4) with 116 sequences (40 sequences from Naja oxiana, 47 sequences from the other 10 Asiatic cobras, and 29 sequences from 9 genera as out-groups), generated by BEAST version 1.8.0 (Drummond & Rambaut, 2007). Branch numbers display times of divergence. Colors correspond to lineage colors in Figure 2 (top), Figure 3, and Figure 4. A–F refer to divergence nodes within Asiatic cobras. The three calibration points are indicated by red stars

3.4 Demographic history

EBSP indicated a population growth curve for N. oxiana since ∼5 Kya (Figure 8a). This plot revealed a gradual expansion since ∼5 Kya and a considerable increase in population size since 2 Kya up to the present day. Also, the demographic events estimated based on analysis of pairwise mismatch distribution of cyt b and ND4 haplotypes found a unimodal mismatch distribution for N. oxiana (Figure 8b). Furthermore, the significantly negative values of Fu' Fs reported here (Fu' Fs = −20.40 and Tajima D = −2.52) strongly suggest a recent expansion for this clade (Rogers & Harpending, 1992; Slatkin & Hudson, 1991).

Details are in the caption following the image
Extended Bayesian Skyline Plot, (a): x-axis visualizes time before present (Mya), and y-axis represents effective population sizes (Ne). Dark shaded regions depict confidence intervals (95% HPD limits), and the dashed line expresses median value for the log10 of Ne, (b): Mismatch distribution demonstrates the demographic history of N. oxiana. Dotted black line represents the expected distributions, and the solid red curve indicates distributions under a constant-sized population assumption

4 DISCUSSION

4.1 Phylogenetic and phylogeographic patterns of the Asiatic Naja

The evolutionary relationships among lineages of the Asiatic Naja have not yet been clearly refined and addressing the issue of the evolution of spitting behavior in African and Asiatic cobras seems to be the core subject for generating a comprehensive and robust phylogenetic resolution for cobras (Wüster et al., 2007). Considering that N. naja and N. oxiana are nonspitters, N. sputatrix, N. siamensis, N. philippinensis, N. samarensis, N. mandalayensis and N. sumatrana are spitters, and N. kaouthia, N. atra, and N. sagittifera are non/occasional spitters (Ratnarathorn et al., 2019; Wüster & Thorpe, 1992), the concurrence of spitting and nonspitting cobras within the Asiatic Naja group may support the hypothesis that postulates multiple colonization events of Asia by African cobras (Ineich, 1995; Minton, 1986). However, Wüster et al. (2007) argued against this hypothesis and proposed that Asiatic Naja originated from a single invasion of Asia from Africa.

Barbour (1922) suggested that spitting evolved in African cobras to defend against large ungulates on their paths in African grasslands. This hypothesis, however, was criticized by Wüster et al. (2007) as spitting behavior evolved earlier than the first emergence of the great grasslands of Africa and therefore before the appearance of large ungulates in these habitats. Also, spitting cobras of the Asian Naja were at no risk of facing ungulate herds due to their forest-like habitat type in southeastern Asia. Wüster et al. (2007) argue that cobras' spitting behavior may have evolved three times and their phylogeographic patterns appear to be the result of a complex interplay of geological and ecological factors. Recently, Kazandjian et al. (2020) showed that spitting behavior in cobras has evolved independently in three spitting lineages as a defensive mechanism. Their results demonstrated that venom of cobras from these lineages was endowed with an upregulation of the activity of phospholipase A2 (PLA2) enzyme, a common toxin in venom of snakes, which triggers the activity of venom cytotoxins resulting in the activation of mammalian sensory neurons, thereby causing increased pain. Based on their divergence time estimates, spitting behavior possibly evolved following the appearance of bipedal hominids in African grasslands and later in Asia. Nevertheless, at present, we have no explanation for why the nonspitting N. naja forms the basal lineage to Asiatic Naja, within which several spitting elapids are nested. The spitting behavior, however, appears to have been lost in this subgenus from the east toward the west (Trans-Caspia) of Asia.

Our reconstruction of the phylogenetic relationships among Asiatic cobras at interspecific levels recovered a generally well-supported phylogenetic structure for the Asiatic Naja. Our results continue to strongly confirm the monophyly of the Asiatic Naja group, in congruence with previous studies based on molecular and morphological evidence (Slowinski & Keogh, 2000; Szyndlar & Rage, 1990; Wüster, 1990; Wüster et al., 2007). Moreover, our phylogenetic reconstructions confirmed that N. naja formed a basal lineage relative to other Asiatic Naja species, a finding similar to previous studies (Ashraf et al., 2019; Wallach et al., 2009; Wüster et al., 2007). Excluding N. naja, which forms the basal clade for our phylogenetic tree, we could distinguish two broad groups of taxa: (a) southeastern Asian cobras including N. siamensis, N. sumatrana, N. philippinensis, N. samarensis, N. sputatrix, and N. mandalayensis, and (b) western, central, southern, and eastern Asian cobras including Noxiana, Nkaouthia, N. sagittifera, and Natra. It appears that this classification is in concordance with patterns of spitting behavior as southeastern Asiatic cobras are known to spit venom, whereas central, western, southern, and eastern Asiatic cobras are regarded as nonspitting or occasional spitters (Wüster et al., 2007).

Our finding of Nkaouthia and N. sagittifera being recovered as sister taxa to each other and in turn sister clades to N. oxiana is new. However, Santra et al. (2019) revealed a different phylogenetic position for Noxiana using a single mitochondrial marker (16S), incongruent with the results of Wüster et al. (2007), Wallach et al. (2009), Shoorabi et al. (2017), Kazandjian et al. (2020), and the present study. The three Noxiana samples used in their study belonged to the eastern population of this species from Himachal Pradesh, India. This incongruence may have been the result of the low variability of this gene and the short length of sequences (488 bp) generated in their study, which failed to fully resolve the phylogenetic relationships of Asian cobras.

4.2 Phylogenetic and phylogeographic patterns of N. oxiana

In this study, we attempted to present a first view of the phylogeny of the Caspian cobra relative to other Asiatic cobras. At the intraspecies level, our phylogenetic trees revealed no diversification between N. oxiana's eastern and western populations, although this finding remains tentative due to the small number of samples from the eastern population. Similarly, no divergence was detected within the western populations in Iran, Afghanistan, and Turkmenistan. The haplotype network showed a large number of common haplotypes between N. oxiana populations, suggestive of high rates of gene flow. Moreover, the results of the genetic structure of N. oxiana populations are consistent with the phylogenetic trees, showing an integrative genetic group across the entire distribution of the Caspian cobra. Population genetic analyses revealed low haplotype and nucleotide diversities, in line with an earlier study using the D-loop gene which found low (2–5) mutational steps among haplotypes from northeast of Iran (Shoorabi et al., 2017). However, other intraspecies studies demonstrated several different lineages in some species of Asiatic cobras. For instance, Ratnarathorn et al. (2019) showed that N. kaouthia populations diverged into four lineages, suggesting cryptic speciation for N. kaouthia populations in northeast of Thailand, affected by climatic or geographical differences. Similarly, two distinct lineages were recovered for N. atra in China (Lin et al., 2014).

According to the EBSP results, our demographic history reconstruction exhibited that N. oxiana's western ranges expanded between 1,000 and 2,000 years ago during the last age (Meghalayan) of Holocene series (Walker et al., 2019). Furthermore, mismatch distribution provided strong evidence for N. oxiana's unimodal distribution, which is associated with a panmictic population undergone sudden demographic expansion in its evolutionary history (Rogers & Harpending, 1992; Slatkin & Hudson, 1991). In addition, the star-shaped structure of the haplotype network evidently indicates a sudden expansion (Kerdelhué et al., 2009; Slatkin & Hudson, 1991). Both Tajima's D and Fu's Fs produced significantly negative values for Caspian cobra populations, implying that western populations have at least experienced one expansion phase. A similar pattern was detected for N. atra where populations in a vast range of the species' range were affected by no reproductive isolations during the Quaternary glacial period and therefore experienced a sudden range expansion (Lin et al., 2012).

Our molecular dating showed that the divergence between N. oxiana and its sister taxa, N. kaouthia and N. sagittifera, took place during late Pliocene (3.21 Mya in Piacenzian Age), though with wide 95% confidence intervals ranging from early Pliocene (4.48 Mya in Zanclean Age) to early Pleistocene (1.94 Mya in Gelasian Age). At the end of the cold and short Zanclean Age, a warm and wet period of the Piacenzian Age appeared in the northern hemisphere. During the Piacenzian, the ice sheets of Antarctica were less developed and sea levels were about 20 m higher than today. Also, temperature levels were 2–3°C higher. Therefore, we may cautiously infer that at the end of the Zanclean (approximately 3.6 Mya) and with the onset of the warm and wet Piacenzian period (3.60–2.58 Mya), gene flow occurred toward the eastern borders of Afghanistan and Pakistan. The massive Hindu Kush Mountains formed an impassable barrier to Naja dispersal. Thus, gene flow was only allowed via the southern parts of Afghanistan, from above the Registan Desert toward Iran's borders and from below this desert toward Balochistan, Pakistan. The occurrence of N. oxiana in provinces of Sistan & Baluchistan, Southern Khorasan, and Central Khorasan in Iran supports the proposed hypothesis. Unfortunately, for years, Afghanistan has failed to maintain security for researchers to conduct surveys, resulting in a general lack of scientific data in the region. Hence, we urge caution in concluding that eastern and western N. oxiana populations are markedly distinct, as new N. oxiana records have lately emerged from southern, western, and northern Afghanistan. Rapid expansion of Naja from the east toward Afghanistan and Pakistan and eventually to the east and northeast of Iran is not beyond the bounds of possibility for Naja species with such long-range dispersal potential.

Cyclical climatic fluctuations of the Pleistocene are assumed to have had an integral role in determining the spatial distribution, patterns of genetic diversity and historical demography of a multitude of Palearctic species (Avise, 2000; Hewitt, 2001). Studies on snakes living at high altitudes highlight that mountain vipers have been modified during the glacial climates of Pleistocene and have diversified as a result of the progression and recession of glaciers (Behrooz et al., 2018; Ding et al., 2011). Our findings corroborated that the western population of N. oxiana has a genetically uniform structure belonging to a single genetically homogeneous population, while also acknowledging the small number of samples from Afghanistan and Turkmenistan in our study. We posit that N. oxiana was not influenced by cold Pleistocene periods and therefore not restricted to glacial refugia, in that it typically inhabits arid and semiarid regions, or rocky, shrub or scrub-covered foothills and tends to avoid high-altitude mountain habitats which were subject to past glacial episodes in Iran (Moghimi, 2008, 2010).

Also, no geographical barriers, such as impenetrable mountains, large aquatic structures, or urban areas, have existed to limit the gene flow of N. oxiana in this region. We suppose that rapid dispersal of N. oxiana from the westernmost extreme of its range toward eastern and northeastern Iran was facilitated by the lack of major dispersal barriers. This ultimately prevented the formation of spatially structured populations in the region. Benefiting from the absence of competitive taxa (e.g., levant viper Macrovipera lebetina), the Caspian cobra successfully colonized the entire range from plains and low-slope foothills of eastern and northeastern Iran to warm and humid plains along the eastern coast of the Caspian Sea.

Finally, although the present study offers the first insight into the phylogeny of N. oxiana relative to Asian cobras, we acknowledge that drawing inferences about the phylogeny and phylogeography and delimitation of conservation units based solely on mtDNA, single nDNA genes, or even combined mtDNA and nDNA data may be misleading (e.g., Ballard & Rand, 2005; Ballard & Whitlock, 2004; Rubinoff & Holland, 2005; Shaw, 2002; Wiens et al., 2010). Thus, population genomic studies using large numbers of unlinked nuclear loci are recommended for this species (both western and eastern populations) as well as other Asian cobras.

4.3 Conservation units and management propositions

For long, conservation managers have debated how to delineate the minimal units appropriate for conservation management purposes (Amato, 1991; Fraser & Bernatchez, 2001; O'Brien & Mayr, 1991). To fulfill this aim, the term evolutionarily significant unit (ESU) emerged to define special groups of taxa below the species level that warrant specific conservation due to their evolutionary originality (Moritz, 1994; Ryder, 1986). Yet, there exists no consensus on the definition of ESU, and here, we favored the one proposed by Fraser and Bernatchez (2001) as it is focused on isolated populations. They advocated that, for adaptive evolutionary conservation, ESUs are best represented by phylogenetic lineages that exchange gene flow within a species. Therefore, each isolated population of N. oxiana qualifies as a fitting ESU for conservation. In addition to being classified as Data Deficient (DD) by the IUCN, the conservation status of N. oxiana within the complex group of Naja has not yet been assessed and its national conservation has been largely neglected.

Here, we suggest that all N. oxiana populations in northeastern Iran, Afghanistan, and Turkmenistan could be treated as a single ESU. Due to the several potential and existing threats facing the Caspian cobra, such as habitat loss caused by agricultural development, horticulture, apiculture, limited movement between population patches, overgrazing and destruction of rangelands, we recommend conservation actions be targeted at this population in Iran. In addition, human-caused mortality (direct killings), road-kills due to vehicle collisions, and large-scale overharvesting by vaccine and serum institutes have also decimated native N. oxiana populations in Iran. Harvest of Caspian cobras generally occurs immediately after hibernation, dramatically lowering their chance of mating and successful reproduction. During the last five years, wild Caspian cobras have been captured on a minimum of 400–500 individuals per year to be milked by antivenom manufacturing laboratories under permits issued by the Department of Environment of Iran. Over the past decades, declines in N. oxiana populations have been documented throughout its range and local collectors have reported difficulties collecting sufficient numbers from wild populations. This situation is further aggravated by the lack of fundamental knowledge on the ecology and conservation status of venomous snakes in Iran, which poses a major obstacle to their conservation and management (Behrooz et al., 2018). Development of a national action plan is required to ensure long-term conservation of the Caspian cobra in Iran. This in turn calls for more comprehensive studies to identify the existing and potential threats facing Caspian cobra populations and to clarify the population size, gene flow, population isolation, and future distribution of the species under the impacts of climate change and habitat alteration.

ACKNOWLEDGMENTS

We would like to thank Atefeh Asadi and Ali Norouzi for their contribution to fieldwork, Faraham Ahmadzadeh for providing some of the samples, Kaveh Khosraviani for laboratory assistance, and Joseph B. Slowinski, Ihsan Insani, Tyler M. Sladen, Adam Francis, Krunal Trivedi, Albert Coritz, and N. Moinudheen for providing us with information and photographs. We are also grateful to conservation managers of the Department of Environment of Iran and rangers of protected areas for their help and expertise during the fieldwork. Access to computing and storage facilities owned by parties and projects contributing to the National Grid Infrastructure MetaCentrum provided under the program “Projects of Large Research, Development, and Innovations Infrastructures” (CESNET LM2015042) is greatly appreciated.

    CONFLICT OF INTEREST

    The authors declare to have no competing interests.

    AUTHOR CONTRIBUTIONS

    Elmira Kazemi: Conceptualization (equal); data curation (equal); formal analysis (equal); writing-original draft (equal). Masoud Nazarizadeh: Data curation (equal); formal analysis (equal); software (equal). Faezeh Fatemizadeh: Data curation (equal); formal analysis (equal); methodology (equal); writing-original draft (equal). Ali Khani: Methodology (equal); writing-original draft (equal). Mohammad Kaboli: Conceptualization (equal); formal analysis (equal); methodology (equal); supervision (equal); validation (equal); writing-review & editing (equal).

    Appendix A

    Species cyt b ND4 Locality

    References

    Vipera ursinii FR727046 FR726971 Italy Ferchaud et al. (2012)
    Vipera renardi ebneri FR727095 FR727028 Iran Ferchaud et al. (2012)
    Montivipera latifii MG021073 MG041967 Iran Behrooz et al. (2018)
    Montivipera wagneri AJ275725 Turkey Lenk et al. (2001)
    Montivipera xanthina KJ415303 Turkey Zinenko et al. (2015)
    Montivipera xanthina AJ275724 Turkey Lenk et al. (2001)
    Montivipera albizona AJ275727 Turkey Lenk et al. (2001)
    Montivipera bornmuelleri AJ275726 Lebanon Lenk et al. (2001)
    Macrovipera lebetina KJ415301 Uzbekistan Zinenko et al. (2015)
    Macrovipera lebetina KJ415300 Uzbekistan Zinenko et al. (2015)
    Macrovipera lebetina AJ275713 Turkmenistan Lenk et al. (2001)
    Bungarus fasciatus NC_011393 NC_011393
    Bungarus flaviceps AJ749351.1 Kuch (2007)
    Bungarus bungaroides AY973270 Vietnam Kuch (2007)
    Macrovipera schweizeri AJ275715 Greece Lenk et al. (2001)
    Sistrurus catenatus AY223610 AY223648 Texas Wüster et al. (2008)
    Sistrurus miliarius AY223611 U41889 Florida Wüster et al. (2008)
    Crotalus adamanteus AY223605 U41880 Florida Wüster et al. (2008)
    Crotalus ravus AY223609 AY223647 Mexico Wüster et al. (2008)
    Crotalus simus EU624302 AY704885 Costa Rica Wüster et al. (2008)
    Crotalus tigris AY223606 AF156574 Arizona Wüster et al. (2008)
    Porthidium arcosae AF292575 AF292613 Ecuador Wüster et al. (2008)
    Porthidium lansbergii rozei AF393623 AF393623 Venezuela Wüster et al. (2002)
    Porthidium nasutum AY223579 U41887 Costa Rica Wüster et al. (2008)
    Montivipera raddei MG020988 MG042007 Iran Behrooz et al. (2018)
    Montivipera kuhrangica MG021061 MG042036 Iran Behrooz et al. (2018)
    Montivipera albicornuta MG021002 MG041960 Iran Behrooz et al. (2018)
    Montivipera latifii MG021067 MG041959 Iran Behrooz et al. (2018)
    Porthidium nasutum AF292574 AF292612 Ecuador
    Hemachatus haemachatus AF217821 South Africa Slowinski and Keogh (2000)
    Naja nivea AF217827 AY058983 Wüster et al. (2007)
    Naja haje DQ897746 DQ897703 Tanzania Wüster et al. (2007)
    Naja mandalayensis MT346710 MT346906 Kazandjian et al. (2020)
    Naja mandalayensis MT346709 MT346905
    Naja mandalayensis AF155211 Myanmar Slowinski and Wüster (2000)
    Naja atra JN160649 China Lin et al. (2012)
    Naja atra JN160648 China Lin et al. (2012)
    Naja atra JN160647 China Lin et al. (2012)
    Naja atra JN160646 China Lin et al. (2012)
    Naja atra JN160645 China Lin et al. (2012)
    Naja atra JN160644 China Lin et al. (2012)
    Naja atra JN160643 China Lin et al. (2012)
    Naja naja GQ359506 AY713378 Nepal Wüster et al. (2008)
    Naja naja FR871895 Nepal
    Naja naja EU624299 AY713378 Nepal Wüster et al. (2008)
    Naja sputatrix DQ897734 DQ897691 Indonesia Wüster et al. (2007)
    Naja sputatrix MT346729 MT346921 Kazandjian et al. (2020)
    Naja sputatrix MT346730 MT346922 Kazandjian et al. (2020)
    Naja sumatrana MT346735 MT346931 Kazandjian et al. (2020)
    Naja sumatrana MT346736 MT346932. Kazandjian et al. (2020)
    Naja sumatrana MT346737 MT346933 Kazandjian et al. (2020)
    Naja sumatrana AB920240 Supikamolseni et al. (2015)
    Naja philippinensis MT346719 MT346915 Kazandjian et al. (2020)
    Naja philippinensis MT346718 MT346914 Kazandjian et al. (2020)
    Naja philippinensis MT346717 MT346913 Kazandjian et al. (2020)
    Naja philippinensis MT346716 MT346912 Kazandjian et al. (2020)
    Naja philippinensis MT346715 MT346911 Kazandjian et al. (2020)
    Naja sagittifera MT346721 MT346917 Kazandjian et al. (2020)
    Naja sagittifera MT346720 MT346916 Kazandjian et al. (2020)
    Naja samarensis MT346722 MT346918 Kazandjian et al. (2020)
    Naja samarensis MT346723 MT346919 Kazandjian et al. (2020)
    Naja samarensis MT346724 MT346920 Kazandjian et al. (2020)
    Naja siamensis MT346727 MT346925 Kazandjian et al. (2020)
    Naja siamensis MT346728 MT346926 Kazandjian et al. (2020)
    Naja siamensis MT346726 MT346924 Kazandjian et al. (2020)
    Naja siamensis MT346725 MT346923 Kazandjian et al. (2020)
    Naja siamensis AF155214 Slowinski and Wüster (2000)
    Naja siamensis AB920242 Supikamolseni et al. (2015)
    Naja oxiana MW172773 MW145451 Khorasan Razavi Province Present Study
    Naja oxiana MW172774 MW145452 Khorasan Razavi Province Present Study
    Naja oxiana MW172775 MW145453 Khorasan Razavi Province Present Study
    Naja oxiana MW172776 MW145454 Khorasan Razavi Province Present Study
    Naja oxiana MW172777 MW145455 Khorasan Razavi Province Present Study
    Naja oxiana MW172778 MW145456 Khorasan Razavi Province Present Study
    Naja oxiana MW172779 MW145457 Khorasan Razavi Province Present Study
    Naja oxiana MW172780 MW145458 Khorasan Razavi Province Present Study
    Naja oxiana MW172781 MW145459 Khorasan Razavi Province Present Study
    Naja oxiana MW172782 MW145460 Khorasan Razavi Province Present Study
    Naja oxiana MW172783 MW145461 South Khorasan Province Present Study
    Naja oxiana MW172784 MW145462 North Khorasan Province Present Study
    Naja oxiana MW172785 MW145463 North Khorasan Province Present Study
    Naja oxiana MW172786 MW145464 North Khorasan Province Present Study
    Naja oxiana MW172787 MW145465 Golestan Province Present Study
    Naja oxiana MW172788 MW145466 Turkmenistan Present Study
    Naja oxiana MW172789 MW145467 Turkmenistan Present Study
    Naja oxiana MW172790 MW145468 Turkmenistan Present Study
    Naja oxiana MW172791 MW145469 Turkmenistan Present Study
    Naja oxiana MW172792 MW145470 Turkmenistan Present Study
    Naja oxiana MW172793 MW145471 Turkmenistan Present Study
    Naja oxiana MW172794 MW145472 Afghanistan Present Study
    Naja oxiana MW172795 MW145473 Afghanistan Present Study
    Naja oxiana MW172796 MW145474 Afghanistan Present Study
    Naja oxiana MW172797 MW145475 Khorasan Razavi Province Present Study
    Naja oxiana MW172798 MW145476 Khorasan Razavi Province Present Study
    Naja oxiana MW172799 MW145477 Khorasan Razavi Province Present Study
    Naja oxiana MW172800 MW145478 Khorasan Razavi Province Present Study
    Naja oxiana MW172801 MW145479 Khorasan Razavi Province Present Study
    Naja oxiana MW172802 MW145480 North Khorasan Province Present Study
    Naja oxiana MW172803 MW145481 Golestan Province Present Study
    Naja oxiana MW172804 MW145482 North Khorasan Province Present Study
    Naja oxiana MW172805 MW145483 Golestan Province Present Study
    Naja oxiana MW172806 MW145484 Khorasan Razavi Province Present Study
    Naja oxiana MW172807 MW145485 Golestan Province Present Study
    Naja oxiana MW172808 MW145486 Golestan Province Present Study
    Naja oxiana MW172809 MW145487 Khorasan Razavi Province Present Study
    Naja oxiana MW172810 MW145488 Golestan Province Present Study
    Naja oxiana MT346714 MT346910 Kazandjian et al. (2020)
    Naja oxiana MT346713 MT346909 Kazandjian et al. (2020)
    Naja kaouthia MK721314 Nakhon Ratchasima Ratnarathorn et al. (2019)
    Naja kaouthia MK721310 Nakhon Ratchasima Ratnarathorn et al. (2019)
    Naja kaouthia MK721295 Thailand Ratnarathorn et al. (2019)
    Naja kaouthia MK721303 Pha Ngan Island Ratnarathorn et al. (2019)
    Naja kaouthia MK721269 Thailand Ratnarathorn et al. (2019)
    Naja kaouthia JF357930 Lukoschek et al. (2012)
    Naja kaouthia GQ359507 EU624209 Thailand Wüster et al. (2008)
    Naja kaouthia FR693733
    Naja kaouthia FR693728

    Behrooz et al. (2018); Douglas and Gower (2010); Ferchaud et al. (2012); Kazandjian et al. (2020); Kuch, 2007; Lenk et al. (2001); Lin et al. (2012); Lukoschek et al. (2012); Ratnarathorn et al. (2019); Slowinski and Keogh (2000); Slowinski and Wüster (2000); Supikamolseni et al. (2015); Wüster et al. (2002), Wüster et al. (2007), Wüster et al. (2008); Zinenko et al. (2015).

    DATA AVAILABILITY STATEMENT

    Dataset has been deposited in DRYAD (https://doi.org/10.5061/dryad.r7sqv9s97) and submitted to NCBI (MW172773-MW172810 for cyt b and MW145451-MW145488 for ND4).

      The full text of this article hosted at iucr.org is unavailable due to technical difficulties.