2.1 Cell culture

A first-trimester extravillous cytotrophoblast cell line (HTR8-SVneo) was obtained from ATCC, and the human choriocarcinoma cell lines JAR and JEG3 cells were purchased from the Chinese Academy of Sciences. All cell lines were identified by the short tandem repeat (STR) genotyping. HTR-8/SVneo and JAR cells were maintained in Roswell Park Memorial Institute (RPMI) 1640 and JEG3 cells was cultured in Dulbecco's modified Eagle's medium/F12 supplemented with 10% fetal bovine serum (FBS), penicillin (100 U/ml), and streptomycin (100 ng/ml). All cell lines were incubated in a humidified atmosphere of 5% CO₂ at 37°C. Cells were treated with hypoxia-mimetic agent CoCl₂ (Sigma) at 150 µM to induce hypoxia and cycloheximide (CHX; ApexBio) at 25 µM to inhibit translation. For the exposure of cells to a low oxygen atmosphere (2%), trophoblasts were cultured in a hypoxic multi-incubator (Hypoxia Incubator Chamber) containing 2% O₂, 5% CO₂, and 93% N₂ for 24 h.

2.2 RNA isolation, reverse transcription, and qRT-PCR

Total RNA was extracted from cultured cells with Trizol reagent (Takara). For real-time quantitative polymerase chain reaction (qRT-PCR), 1 μg of total RNA was reverse-transcribed into complementary DNA (cDNA) by using the Prime Script RT Reagent Kit (TakaRa). Synthesized cDNA was then amplified with a SYBR® Premix Ex Taq™ II (Perfect Real-Time) Kit (Takara). Melting curve for each target gene was generated to ensure PCR specificity. Relative abundance of messenger RNA (mRNA) was calculated by normalization to GAPDH mRNA expression. All the primers sequences used for amplification were listed in Table 1.

2.3 Small interfering RNA (siRNA) transfection and lentivirus production and infection

JAR and JEG3 cells were transfected with a small interfering RNA (siRNA) specific for human HIF-1α (GenePharma) using Lipofectamine 2000 (Invitrogen) for 48 h. The HIF-1α-specific RNAi target sequence was as follows: siHIF-1α#1: 5′-CAG AAA UGG CCU UGU GAA ATT -3′; siHIF-1α#2: CAU GAG GAA AUG AGA GAA ATT. A nontargeting siRNA (5′-UUC UCC GAA CGU GUC ACG UTT-3′) was used as a negative control. For lentiviral infection, SPOP expression vector, a control vector, the shRNA targeting SPOP and a negative control vector were designed and constructed by Sunbio Medical Biotechnology Co., Ltd. The sequences of shRNA oligonucleotides against SPOP were as follows: shSPOP#1: CCGGCACAAGGCTATCTTAGCAGCTCTCGAGAGCTGCTAAGATAGCCTTGTGTTTTTTG; shSPOP#2: CCGGCACAGATCAAGGTAGTGAAATCTCGAGATTTCACTACCTTGATCTGTGTTTTTTG; shSPOP#3: CCGGGGAGAGTCAACGGGCATATAGCTCGAGATATGCCCGTTGACTCTCCATTTTTTTG. These vectors were transfected into JAR cells when cells fusion reached 50%. After 24 h, the culture medium was substituted with fresh medium. After 72 h of transfection, puromycin was added to the culture medium at a concentration of 5 mg/ml for 2 weeks to generate stable cell lines. Stable SPOP over-expressing or silenced cell lines were confirmed by western blot analysis and qRT-PCR.

2.4 Transwell assays

The cell invasion and migration assays were done in 24-well Transwell plates with or without pre-coated Matrigel. Briefly, 3 × 10⁴ JAR cells infected with lentiviral stabilized overexpression or knockdown SPOP and the corresponding negative control cells were suspended in 200 μl serum free RPMI-1640 medium into the upper chamber. The upper chamber contained an 8-μm pore size membrane (BD Biosciences). In the lower chamber, 500 μl RPMI-1640 medium containing 20% FBS was added. After 48 h of incubation, JAR cells remaining in the upper chamber were softly removed by cotton swab scrubbing. The cells that successfully migrated through the membrane and invaded through the Matrigel were fixed in 4% paraformaldehyde for 20 min and stained with crystal violet dye for 15 min. The cell numbers were counted at six randomly selected views, and the average value was calculated.

2.5 Cell fractionation assays

Nucleoprotein and cytoplasmic protein were extracted according to Nucleoprotein and Cytoplasmic Protein Extraction Kit (Beyotime). The three trophoblasts were seeded in Petri dishes and cultured to 70% confluence. Cells were treated with hypoxia-mimetic agent CoCl₂ (150 µM) for 0 h and 24 h, respectively. Centrifugation was used to collect the cells, absorbing the supernatant as much as possible, and leaving the cell precipitation. According to the instructions of the Extraction Kit, cytoplasmic protein and nuclear protein were extracted step by step, the extracted cytoplasmic and nuclear proteins were stored at −80℃ for future use.

2.6 Western blot analysis

The equivalent amounts of protein were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes. Nonspecific binding sites of the membranes were blocked and incubated overnight with specific primary antibodies at 4°C. Then blots were probed with horseradish peroxidase-conjugated anti-rabbit (Proteintech, SA00001-2) or anti-mouse (Zhongshan Company, Beijing, ZB-2305) secondary antibodies for 1.5 h at room temperature. The primary antibodies used were as follows: HIF-1α (Santa Cruz, sc-13515), SPOP (Proteintech, 16750-1-AP), p-PI3K (phospho‑Tyr467, Cell Signaling Technology, 17366), t-PI3K (Cell Signaling Technology, 4292), p-AKT(phospho‑Tyr473, Cell Signaling Technology, 9271s), t-AKT (Proteintech, 10176-2-AP), p-GSK3β (phospho‑S9, Cell Signaling Technology), t-GSK3β (Cell Signaling Technology, 9315), GAPDH (Beyotime, AF5009), Histone H3 (Beyotime, AH433), and Tubulin (Beyotime, AT819). Immunoreactive bands were measured by enhanced chemiluminescence system (Millipore, WBKLS0100). Signals of the western blot bands were analyzed using the Image Lab program.

2.7 Immunofluorescence

Cells were seeded on chamber cover slips above 24 h and were fixed with 4% paraformaldehyde solution at room temperature for 20 min. After cells on cover slips were permeabilized and blocked in 3% BSA for 1 h, the cells were incubated with HIF-1α or SPOP antibodies (HIF-1α, Santa Cruz, sc-13515, 1:200; SPOP, Proteintech, 16750-1-AP, 1:200) at 4°C overnight, then Alexa Fluor 488- or 595-conjugated goat secondary antibodies (Beyotime) at 37°C for 1 h. For nuclear staining, cells were incubated with DAPI for 5 min. Cell images were captured with a confocal microscope (Nikon).

2.8 Statistical analyses

All statistical analyses were performed using the Graph Pad prism version 8.0 (Graph Pad Software). The statistical analyses were evaluated using a two-tailed Student's t-test and one-way analysis of variance. Data in this study were presented as mean ± SD. All results were from at least three independent experiments.

3.1 Activation of HIF-1α signaling in trophoblast-derived cell lines exposed to hypoxia

Two different human trophoblast-derived choriocarcinoma cell lines JAR and JEG3, and a first-trimester extravillous cytotrophoblast cell line HTR8-svneo have been widely used as in vitro models for human trophoblast studies. We characterized the expression and subcellular localization of HIF-1α in trophoblast-derived cell lines exposed to hypoxia-mimetic agent CoCl₂ (150 µM) or cultured in a hypoxic multi-incubator (2% O₂). Hypoxia-induced changes in protein expression and subcellular localization of HIF-1α were determined by western blot analysis and immunofluorescence staining. Western blot analysis of whole cell lysates showed that treatment of the three trophoblast-derived cells with CoCl₂ significantly increased cellular HIF-1α protein compared to control cells (Figure 1a). Besides, in contrast to standard culture conditions (20% O₂), exposure of trophoblast-derived cells to low oxygen levels (2% O₂) also remarkably enhanced HIF-1α protein levels (Figures 1a and S1a).

Next, we determined the subcellular localization of HIF-1α in the three trophoblasts, immunofluorescence analysis showed that HIF-1α was predominantly labeled in the nucleus of all three trophoblast-derived cells under CoCl₂-mimicked hypoxia conditions or 2% O₂ exposure (Figure 1c). As demonstrated by western blot analysis, HIF-1α protein was significantly increased in the nuclear extracts after low oxygen stimulations (Figure 1b). In summary, these results demonstrated that HIF-1α is activated by hypoxic stimulation in the three trophoblast-derived cell lines.

3.2 SPOP expression is induced by CoCl₂-mimicked hypoxia

Due to the limitation of experimental conditions, trophoblasts were subjected to CoCl₂ treatment in the following experiments to establish an in vitro hypoxia model, rather than exposed to 2% O₂ in a multigas incubator. As shown in Figure 2a,b, human choriocarcinoma cell lines received CoCl₂ treatment resulted in significantly improved expression of HIF-1α, and a gradual increase of SPOP level both at the protein levels. Importantly, we constructed two HIF-1α siRNA vectors and selected the siHIF-1α#2 sequence with the most obvious knockdown effect for subsequent experiments (Figure S1b). Compared with control cells, transfection with siRNA against HIF-1α remarkably restrained the expression of SPOP in JAR and JEG3 cells following CoCl₂ treatment (Figure 2c). However, no significant changes in SPOP expression were observed between HIF-1α siRNA and control groups in the absence of CoCl₂ (Figure 2d), indicating that the basal level of SPOP production is independent of HIF-1α.

3.3 SPOP is stabilized by HIF-1α at posttranscription

The protein expression of SPOP was positively correlated with the expression of HIF-1α in trophoblast-derived cell lines after CoCl₂ treatment. However, the mRNA level of SPOP had no obvious change neither by CoCl₂ treatment (Figure 3a) nor HIF-1α knockdown (Figure 3b), implying that the effect of HIF-1α on SPOP protein levels was not mediated through the increase of SPOP mRNA expression, and SPOP might be regulated at the posttranscriptional levels. In addition, the stability of SPOP protein was significantly affected by protein synthesis inhibitor CHX treatment, the treatment of CoCl₂ remarkably extended the half-life of SPOP protein in JAR and JEG3 cells (Figure 3c,d). Conversely, the stability of SPOP protein was further reduced by CHX treatment after HIF-1α knockdown compared with negative control cells (Figure 3e,f). These results suggested that HIF-1α stabilized the expression of SPOP at posttranscription level.

3.4 Hypoxia could drive SPOP accumulation in the nucleus

SPOP was first identified as a nucleoprotein (Nagai et al., 1997). Previous studies have shown that the subcellular localization patterns of some proteins are differentially altered in response to hypoxia (Wang et al., 2018; Yunes-Medina et al., 2017). Considering the different functions of SPOP in cytoplasm and nucleus, we examined the subcellular localization pattern of endogenous SPOP in trophoblasts. Immunofluorescence analysis revealed that SPOP was localized exclusively in the nucleus in the majority of the trophoblasts (Figure 4a–c). However, in a small number of trophoblasts, SPOP was labeled in both the nucleus and cytoplasm. CoCl₂ treatment markedly enhanced the fluorescence intensity of SPOP in the nucleus (Figure 4a–c). In addition, SPOP accumulation in the nucleus under CoCl₂-mimicked hypoxic conditions was further verified by cell fractionation assays (Figure 4d–f). Taken together, these findings suggested that CoCl₂ treatment could dramatically influence the localization of SPOP in trophoblast-derived cell lines, especially the accumulation of SPOP into the nucleus.

3.5 SPOP regulates migration and invasion of trophoblasts through the PI3K/AKT/GSK3β signaling pathway

To determine the biological roles of SPOP in the development and progression of trophoblasts, we stably overexpressed and knocked down SPOP in JAR cells using a lentivirus-based system. Levels of SPOP in these resultant cell lines were confirmed by western blot analysis and qRT-PCR (Figure 5a,b). Three SPOP interference vectors were constructed, of which shSPOP#1 was the most effective for subsequent functional experiments (Figure S1c). Functionally, transwell assays revealed that forced expression of SPOP obviously inhibited the migration and invasion abilities of JAR cells, whereas knockdown of SPOP significantly increased the number of migrated and invaded cells (Figure 5c,d).

To further investigate whether PI3K/AKT/GSK3β signaling pathway is involved in the regulation of trophoblasts by SPOP, we identified the expression levels of associated proteins. As seen in Figure 5e, JAR cells with SPOP overexpression resulted in decreased levels of phosphorylated AKT and GSK-3β, whereas the decrease of AKT and GSK-3β phosphorylation were reversed after SPOP depletion. These data indicate that SPOP restrains the activation of the PI3K/AKT/GSK3β pathway in JAR cells. Next, we treated JAR cells overexpressing SPOP with insulin-like growth factor 1 (IGF-1), which is an activator of the PI3K/AKT pathway. We found that IGF-1 treatment at least partially rescued the SPOP-induced inhibition of JAR cell migration and invasion. Conversely, the suppression of the PI3K/AKT pathway by wortmanin abrogated the effects of SPOP loss on cell migration and invasion (Figure 5f). Thus, our results imply that the effect of SPOP on trophoblasts mobility may be mediated by regulating PI3K/AKT/GSK3β signaling.

3.6 SPOP mediates CoCl₂-inducible PI3K/AKT/GSK3β pathway inactivation in placental trophoblasts

We first investigated whether CoCl₂ incubation induced the activation of the PI3K/AKT pathway in trophoblast cell lines, JAR cells were subjected with CoCl₂-mimicked hypoxia treatment for 6 h or 24 h. The results showed that CoCl₂ treatment dramatically attenuated the expressions of phospho-Ser-473 AKT and phospho-Ser-9 GSK-3β in comparison to control cells, which was more marked at 24 h than at 6 h. Especially, early hypoxia (6 h) stimulation caused a slightly elevation in phospho-Ser-9 GSK-3β expression. Moreover, to verify that the effect of CoCl₂ incubation on AKT and GSK-3β phosphorylation was not due to a change in the total amount of AKT and GSK-3β protein, western blot for total protein were performed. A 6 and 24 h incubation time of CoCl₂ did not alter the total protein level of GSK-3β, while longer CoCl₂ treatment (24 h) caused a significant decrease in total AKT protein expression compared to the control group (Figure 6a).

To examine whether SPOP is involved in CoCl₂-induced the inhibition of PI3K/AKT/GSK3β pathway in placental trophoblasts. We simultaneously knockdown SPOP in JAR cells under CoCl₂-mimicked hypoxia conditions, the results showed that SPOP knockdown reversed the downregulation of AKT and GSK-3β phosphorylation levels in CoCl₂ treated cells (Figure 6b), implying that inhibition of SPOP expression at least partially alleviated the dephosphorylation of AKT and GSK-3β induced by CoCl₂. Furthermore, CoCl₂ treatment of JAR cells for 24 h or 48 h significantly suppressed the migration and invasion, this suppression was blocked in the presence of SPOP depletion (Figure 6c,d). Altogether, these results suggested that CoCl₂-inducible upregulation of SPOP expression compromises trophoblastic invasion and migration through the PI3K/AKT/GSK3β signaling pathway.