Mutational analysis of the Wolfram syndrome gene in two families with chromosome 4p-linked bipolar affective disorder
Abstract
Bipolar affective disorder (BPAD) is a complex disease with a significant genetic component. Heterozygous carriers of Wolfram syndrome (WFS) are at increased risk of psychiatric illness. A gene for WFS (WFS1) has recently been cloned and mapped to chromosome 4p, in the general region we previously reported as showing linkage to BPAD. Here we present sequence analysis of the WFS1 coding sequence in five affected individuals from two chromosome 4p-linked families. This resulted in the identification of six polymorphisms, two of which are predicted to change the amino acid sequence of the WFS1 protein, however none of the changes segregated with disease status. Am. J. Med. Genet. (Neuropsychiatr. Genet.) 96:158–160, 2000. © 2000 Wiley-Liss, Inc.
INTRODUCTION
Approximately 1% of people will suffer from bipolar affective disorder (BPAD, also termed manic depression) at some point during their lifetime. The disease is characterized by mood swings to both depressed and elated states. Little is known about the cellular and molecular basis of BPAD, but genetic predisposition is an important factor. Relatives of affected individuals have an elevated risk for the disorder, rising from the 1% population risk to 15–20% in co-twins of affected DZ twins and to 75–80% in co-twins of affected MZ twins [Bertelsen et al., 1977].
We aim to find a gene that predisposes to bipolar affective disorder by studying a large pedigree (F22) that segregates the disorder. Previously, we scanned the entire genome in F22 for linkage to affective disorder, and found a maximum multipoint lod score of 4.8 in the region D4S431–D4S403 [Blackwood et al., 1996]. Subsequently, four other groups have also found evidence for linkage of affective disorders to this region [Polymeropoulos and Schaffer, 1996; Ascherson et al., 1998; Ewald et al., 1998; Detera-Wadleigh et al., 1999]. In addition, a locus for mental health wellness has also been mapped to this region [Ginns et al., 1998]. Two recent publications report the identification of the gene for Wolfram syndrome (WFS) from an overlapping region of chromosome 4p [Inoue et al., 1998; Strom et al., 1998]. Linkage and haplotype analysis indicated that the WFS gene (WFS1) lay close to D4S431, in the interval between D4S431 and D4S500, and this location was then confirmed by physical mapping [Inoue et al., 1998].
WFS is an autosomal recessive disorder estimated to affect 1 in 770,000 [Collier et al., 1996] that is characterized by a number of neurodegenerative symptoms [Wolfram and Wagener, 1938; Barrett and Bundey, 1997]. The minimal criteria for diagnosis are juvenile-onset diabetes mellitus and optic atrophy, but additional symptoms, which include diabetes insipidus, sensorineuronal deafness, urinary tract atony, ataxia, peripheral neuropathy, mental retardation, and psychiatric illness are seen in the majority of patients. In addition, heterozygous carriers for WFS (estimated at 1 in 354 of the population) [Collier et al., 1996] also display an estimated 26-fold increased incidence of psychiatric disorders, most often affective illnesses, over the population norm [Swift et al., 1998]. The WFS1 gene was found to encode a novel membrane protein of unknown function [Inoue et al., 1998; Strom et al., 1998].
In light of the proximity of the two loci, and the increased risk for affective illness in carriers for WFS, we have examined the coding sequence of WFS1 in affected individuals from F22 and from F59, a small BPAD pedigree that generates a positive lod score for linkage to the same region of chromosome 4p [Blackwood et al., 1996].
MATERIALS AND METHODS
Families
Families F22 and F59 have been described previously [Blackwood et al., 1996]. We examined three affected and three unaffected individuals from F22 and two affected and two unaffected individuals from F59.
Polymerase Chain Reaction
The coding exons of the WFS1 gene were amplified in 13 segments using the primer pairs described by Strom et al. [1998] with the exception of primer pairs 3 and 5, which were as described by Inoue et al. [1988], and pairs 6, 8.1, and 8.2 where alternative primers were designed (Table I).
| Exon | Sense primer | Antisense primer |
|---|---|---|
| 6 | ctatgatccccagaacgtagga | cagaacactgagccccaaac |
| 8.1 | cgtgagatgggagcagtgg | gaagacagagagcaggaaatgg |
| 8.2 | aacttccgcaccctcacc | catgcggaagaagagatagagc |
Mutation Detection
The coding sequence of the WFS1 gene was investigated by sequence comparison of polymerase chain reaction (PCR) products produced from the 10 individuals under study. PCR products were prepared for sequencing by use of PCR product pre-sequencing kit (Amersham) according to the manufacturer's instructions. These products were then subjected to automatic sequencing on an ABI 377 Automated Sequencer using Rhodamine dye terminator Sequencing kit (ABI Technologies) in accordance with the manufacturer's instructions. Forward and reverse sequence reads from each individual were aligned using the CONSED package [Gordon et al., 1998]. The study was carried out blind to affected status.
RESULTS
The seven coding exons of the WFS1 gene were amplified (in the form of 13 fragments) from patient DNAs and sequenced. The changes found are described in Table II. Six polymorphisms were found in the WFS1 gene, but none of these segregated with disease status in either of the families studied. Two of the polymorphisms are predicted to alter the amino acid sequence of the WFS1 protein, but both of these conservative changes have been observed in control (non-affected) individuals in the previous studies of this gene [Inoue et al., 1998; Strom et al., 1998].
| Position of polymorphism | Codon number | Amino acid change? | Reported previously? | Segregates with affected status? |
|---|---|---|---|---|
| 1155 A→G | 333 | Ile→Val | Yes | No |
| 1181 C→T | 341 | No | No | No |
| 1343 C→T | 395 | No | Yes | No |
| 1571 C→T | 575 | No | No | No |
| 1678 G→A | 611 | Arg→His | Yes | No |
| 2411 A→G | 855 | No | Yes | No |
DISCUSSION
The WFS1 gene is a good candidate gene for genetic predisposition to affective illnesses because of the psychiatric phenotypes observed in WFS carriers and patients and due to the location of the WFS1 gene in a region that has been linked to BPAD. Although WFS is a rare disorder (1 in 770,000) the estimated carrier frequency is relatively high (1 in 354). This means that WFS carriers could make up a significant proportion of individuals with chromosome 4p-linked affective disorders. We have found that mutations that cause WFS are not responsible for BAPD in the two families tested here. This, however, does not rule out involvement of the WFS1 gene in the four other studies that have demonstrated linkage of BPAD to this region. In addition, although we have ruled out mutations in the coding region of the WFS1 gene, there may be changes in non-coding regions of this gene that could be responsible for the illness seen in these or other families. Thus, WFS1 should continue to be considered a valid candidate until genetic recombinants or positive mutation analysis of new candidate genes in the region can formally exclude it.
