Volume 2025, Issue 1 3550069

Research Article

Open Access

Molecular Characterization and Phylogenetic Analysis of Velogenic NDV Genotype VII Isolated From an Outbreak in Genotype II-Vaccinated Poultry Flocks of the Southern Region of Pakistan

Johar Hussain

orcid.org/0000-0002-5909-4043

DOW Institute of Biological , Biochemical and Pharmaceutical Sciences , DOW University of Health Sciences , Karachi , Pakistan , duhs.edu.pk

Department of Microbiology , University of Karachi , Karachi , Pakistan , uok.edu.pk

Search for more papers by this author

Muhammad Sohail,

Muhammad Sohail

orcid.org/0000-0002-7208-9441

Department of Microbiology , University of Karachi , Karachi , Pakistan , uok.edu.pk

Search for more papers by this author

Aqeel Ahmad,

Aqeel Ahmad

orcid.org/0000-0001-7292-1691

Department of Biosciences , Salim Habib University , Karachi , Pakistan , shu.edu.pk

Search for more papers by this author

Faiz Muhammad,

Faiz Muhammad

orcid.org/0000-0002-0657-9004

Department of Microbiology Faculty of Life Science and Information , Balochistan University of IT Engineering and Management Science , Quetta , Pakistan

Search for more papers by this author

Syed Khurram Fareed,

Syed Khurram Fareed

orcid.org/0000-0001-7417-6429

DOW Institute for Advanced Biological & Animal Research , Dow University of Health Sciences , Karachi , Pakistan , duhs.edu.pk

Search for more papers by this author

Shakeel Ahmed Khan,

Corresponding Author

Shakeel Ahmed Khan

[email protected]

orcid.org/0000-0002-8260-3643

Department of Microbiology , University of Karachi , Karachi , Pakistan , uok.edu.pk

Department of Biosciences , Salim Habib University , Karachi , Pakistan , shu.edu.pk

Search for more papers by this author

Johar Hussain,

Johar Hussain

orcid.org/0000-0002-5909-4043

DOW Institute of Biological , Biochemical and Pharmaceutical Sciences , DOW University of Health Sciences , Karachi , Pakistan , duhs.edu.pk

Department of Microbiology , University of Karachi , Karachi , Pakistan , uok.edu.pk

Search for more papers by this author

Muhammad Sohail,

Muhammad Sohail

orcid.org/0000-0002-7208-9441

Department of Microbiology , University of Karachi , Karachi , Pakistan , uok.edu.pk

Search for more papers by this author

Aqeel Ahmad,

Aqeel Ahmad

orcid.org/0000-0001-7292-1691

Department of Biosciences , Salim Habib University , Karachi , Pakistan , shu.edu.pk

Search for more papers by this author

Faiz Muhammad,

Faiz Muhammad

orcid.org/0000-0002-0657-9004

Department of Microbiology Faculty of Life Science and Information , Balochistan University of IT Engineering and Management Science , Quetta , Pakistan

Search for more papers by this author

Syed Khurram Fareed,

Syed Khurram Fareed

orcid.org/0000-0001-7417-6429

DOW Institute for Advanced Biological & Animal Research , Dow University of Health Sciences , Karachi , Pakistan , duhs.edu.pk

Search for more papers by this author

Shakeel Ahmed Khan,

Corresponding Author

Shakeel Ahmed Khan

[email protected]

orcid.org/0000-0002-8260-3643

Department of Microbiology , University of Karachi , Karachi , Pakistan , uok.edu.pk

Department of Biosciences , Salim Habib University , Karachi , Pakistan , shu.edu.pk

Search for more papers by this author

First published: 28 April 2025

https://doi.org/10.1155/bmri/3550069

Academic Editor: Iftikhar Ahmed

Share a link

Email
Wechat
Bluesky

Abstract

Despite the administration of multiple doses of the Newcastle disease virus (NDV) vaccine, a high mortality rate (20%–40%) due to NDV was observed in the southern region of Pakistan. In the current study, clinical samples were obtained from affected areas with NDV infection. The clinical examination revealed characteristics signs and symptoms of NDV and 40% mortality. Furthermore, necropsy revealed characteristic lesions commonly associated with NDV infection. NDV antibodies were detected by ELISA in 27% of breeders, 45% of layers, and 62% of broiler flocks. The RT-PCR confirmed the infection in 15% of breeders, 17% of layers, and 21% of broilers. Phylogenetic analysis of the Fusion gene revealed that the outbreaks in vaccinated flocks of three districts were hit by NDV Genotype VII and in one district by Genotype II. The virulence factors of local isolates were determined based on amino acid analysis of the Fusion protein cleavage motif from 112–117 sites. The virulence factors (amino acids 112–117) of local isolates were compared with the virulent factors of the Fusion protein of the reported strains. All the new isolates from the three districts were found to contain polybasic amino acid 112 RRQRR↓F117 with F at the 117th position in the Fusion protein cleavage motif, which is a characteristic of the velogenic type of NDV. Isolates from one of the districts contained the monobasic amino acid 112 G, R, Q, G, R↓L 117 at the cleavage site, which is considered as an avirulent NDV type. Some substitution mutations in the amino acids of Fusion protein were observed among the new isolates, where the amino acid serine (S) was replaced by proline (P) at position 105, and serine/thymine (S/T) was replaced by alanine (A) at position 107. The data partially suggest that the NDV outbreak in the southern region of Pakistan with variant genetic group Genotype VII corresponds to a velogenic pathotype, and the mutations may be responsible for enhanced fatal consequences in affected flocks.

1. Introduction

The southern region of Pakistan, specifically Sindh (located at 25.8943° N, 68.5247° E) [1], plays a significant role in the transmission and spread of Newcastle disease virus (NDV) due to its geographical and ecological characteristics. This region, which includes a vast coastal area, lakes like Khanjar and Manchar, and dams, is a major hub for migratory birds and hosts a rich variety of wild fauna. The presence of diverse bird species, including cormorant ducks and geese, during the winter season, creates a favorable environment for the incubation, propagation, mutation, and transmission of disease particularly NDV, to commercial poultry flocks.

Previous studies reported the prevalence of velogenic NDV in wild migratory birds [2–4]. The wild bird’s comomorant is considered a potential source for the spread of NDV in South Asia [5]. The seasonal migration of wild birds contributes to the widespread of disease within the same or other species [6–9]. Highly virulent NDV strains are commonly found in all types of domestic poultry, from pigeons to ostriches, and in wild birds. Capturing wild birds and caging them with fancy birds in live wet markets in mixed bird populations provide a favorable environment for the emergence, transmission, and spread of NDV viruses [10]. NDV infects many avian species of birds and mammals [11] with a wide range of mortality [12] and causes severe economic impacts [13]. It causes asymptomatic to systematic infection with severe clinical manifestations that depend on the virulence of the NDV [14].

Newcastle disease is an economically important neurological and enteric disease in poultry. The causative agent of NDV is a negative sense single-stranded nonsegmented RNA virus. NDV belongs to the genus Avulavirus and the Paramyxoviridae family [15]. The NDV genome encodes six proteins, namely, nucleoprotein (NP), phosphoprotein (PP), matrix (M) protein, Fusion protein, hemagglutinin–neuraminidase (HN), and the RNA-dependent RNA polymerase (L) [16]. NDV strains are classified into a single serotype, but there is significant genetic and antigenic variation among different strains. This diversity has led to the classification of NDV into different genotypes and subgenotypes based on partial or complete sequences of the Fusion gene [17–19]. Based on genome size, avian paramyxovirus type-1 (APMV-1) is classified into two classes: Class I and Class II. Class I NDVs consist of apathogenic viruses that are usually found in wild birds and rarely found in poultry. Class II NDVs encompass low virulence (lentogenic), medium virulence (mesogenic), and highly virulent (velogenic) pathotypes [20]. These strains have been detected in various species of commercial, domestic and wild birds worldwide. Class I NDV has a single genotype, while Class II NDV has 20 distinct genotypes [21–24]. Different genetic groups are prevalent in different geographical regions of the world [25]. The clinical manifestation of NDV infection is variable, mild to severe, with a high range of mortality [26].

Different techniques such as ICPI, IVPI, and MDT are used to evaluate the pathogenesis of NDV [27]. The availability of gene sequencing has added a great understanding of NDV pathogenicity at the molecular level [15, 1621]. NDV strains are highly prone to mutations leading to the evolution of new variants or genotypes [28]. The NDV Fusion protein is considered a major determinant of NDV pathogenicity; cleavage of F0 into F1 and F2 makes the NDV infectious, enabling the fusion of the viral envelope with the host membrane [29]. A variable amino acid sequence is found at the Fusion protein cleavage site. The amino acid sequence of the Fusion cleavage site determines the ubiquitous cleavage of the Fusion protein by different proteases, present in multiple organs of the host. Strains containing the polybasic amino acid R/G/KR-Q/K-K/R-R↓F (RRQRR or RRQKR), at their cleavage site, can be cut by a wide range of proteases present in the host, allowing the virus to spread to multiple organs and become more infectious or highly virulent. However, avirulent strains have monobasic amino acids that can be cleaved by a limited range of proteases present in the host [29, 30]. The monobasic sequence 112GR/K-Q-G-R↓L117 can only be cleaved by trypsin-like enzymes present in the upper respiratory tract; hence, fatal infections are limited to the upper respiratory tract [31–35].

With the expansion of the poultry industry in Pakistan, NDV has become a major concern for poultry farmers, posing significant threats to the vaccinated flocks. This situation might be threatened by the rich wild fauna in the water habitat areas of the southern region. Previous reports indicate the circulation of different genotypes in commercial and backyard poultry in various parts of the Punjab province [36–38]. Owing to dense poultry sites, various studies have been conducted with particular emphasis on the molecular epidemiology of NDV in Punjab. However, this area of research has remained neglected to explore epidemiological markers for poultry in the southern part of the country. Such lapse needs to be filled as the NDV outbreak has commenced in vaccinated flocks with huge mortality. In the region where poultry flocks are vaccinated with live and killed vaccines with repeated shots, failure to protect against field challenge summons further molecular investigation. Therefore, isolation and identification of NDV from vaccinated flocks, gene sequencing, strain typing, and genetic grouping of field strains are of critical importance. The aim of this study was to isolate and identify NDV from vaccinated flocks, evaluate the pathogenicity of NDV isolates by analyzing the Fusion protein, and develop a phylogenic link between new isolates and different epidemiological or genetic groups, circulating in the world, by utilizing RT-PCR, sequencing, and phylogenetic analysis of NDV Fusion gene.

2. Materials and Method

2.1. Study Area

The study area for this investigation encompassed four key districts in the southern region of Pakistan, which are rich in water habitat, that is, near coastal regions (Karachi and Hyderabad), lakes (Thatta), and river (Dadu), with a predominance of commercial birds and dense population of migratory birds that seasonally reside near the targeted study areas.

2.2. Collection of Samples

A total of 877 serum and 370 tissue samples were collected from commercial poultry flocks including breeders, layers, and broilers of varying ages across the selected areas. Samples were collected under aseptic conditions from the lungs, intestines, and trachea of diseased, freshly dead, and euthanized birds. The adapted vaccination schedule in the investigated flock is given in Table 1. The vaccination schedule in the investigated flocks included multiple shots of live and inactivated NDV vaccines singly or in combination with other vaccines [39].

Table 1. Routine vaccination program in different types of flocks in the south region.

Routine vaccination schedule of NDV usually practiced in different flocks
Sr. No.	No. of samples		Flock type	Age at sample collection	Age in days	Schedule of vaccination adapted in Sindh
Sr. No.	Tissue/swab samples	Blood samples	Flock type	Age at sample collection	Age in days	Schedule of vaccination adapted in Sindh
1	35	71	Broiler	7–30 D	1 D	ND (hatchery)
					5 D	ND 1B
					12 D	NDV Lasota
					21 D	NDV clone

2	42	55	Broiler	7–30 D	1 D	ND (Hatchery)
					5 D	ND 1B
					15 D	NDV Lasota
					24 D	NDV clone

3	64	108	Broiler	7–30 D	1 D	ND (Hatchery)
					7 D	ND 1B
					15 D	NDV Lasota
					28 D	NDV clone

4	51	207	Breeder	10–80 W	1D	NDV + IBV(Hatchery)
					7 D	NDV Lasota
					14 D	IBH + NDV killed
					28 D	ND + IBV live
					35 D	ND + IBV killed
					42 D	IBH + NDV killed
					63 D	NDV Lasota
					100 D	NDV Lasota
					126 D	NDV + IBV

5	56	180	Breeder	10–80 W	1D	NDV + IBV (hatchery)
					5 D	NDV Lasota
					14 D	IBH + NDV killed
					30 D	ND + IBV live
					35 D	ND + IBV killed
					42 D	IBH + NDV killed
					60 D	NDV Lasota
					80 D	NDV Lasota
					133 D	NDV + IBV + EDS

6	28	63	Layer	8–110 W	1 D	ND + IB (hatchery)
					7 D	NDV + IBV killed
					28 D	IB + NDV live
					35 D	ND + IBV killed
					60 D	IB + NDV live
					133 D	NDV + IB live

7	52	115	Layer	8–110 W	1 D	ND + IB (hatchery)
					6 D	ND Lasota
					7 D	NDV + IBV killed
					28 D	IB + NDV live
					35 D	ND + IBV killed
					60 D	IB + NDV live
					140 D	NDV + IB live

8	42	78	Layer	8–110 W	1 D	ND + IB (hatchery)
					6 D	ND Lasota
					7 D	NDV + IBV killed
					28 D	IB + NDV live
					35 D	ND + IBV killed
					60 D	IB + NDV live
					142 D	NDV + IB live

Total	370	877

Abbreviations: D, days; W, weeks.

2.3. Blood Sample Collection

Blood samples were collected from the wing veins of the affected birds using a syringe (3 mL). The wing was pulled outward until the wing vein became evident. Feathers that obscured the vein were plucked away. The area around the bleeding site was disinfected with 70% alcohol. The needle was inserted under the tendon and directed to the wing vein in the direction of the blood flow avoiding any deep insertion of the needle. Once the tip of the needle was in the vein, blood was allowed to flow into the syringe by gently pulling the plunger. The collected blood was immediately transferred to vacutainer tubes and kept at 2°C–8°C for 12 h for separation of serum. The separated serum was then collected and heat-inactivated by incubating at 56°C for 1 h and stored at 2°C–8°C for immediate use and at −80°C for long-term storage.

2.4. Necroscopy and Collection of Tissue Sample

Primarily, birds were screened for infection based on clinical signs (coughing sneezing, lacrimation, swelling of the eye, and wattles), morbidity, and mortality. The selected severely morbid birds were isolated by housing separately and then euthanized by slaughtering. The slaughtered birds were laid on their backs, examined externally, and then wet ventrally with soapy water. The skin was cut and peeled back from the midline of the chest to expose the muscle. The midline of the chest was sheared with scissors, and the birds were opened with forceps; specific lesions were identified in targeted organs, for example, the intestine, proventriculus, trachea, and lungs. Tissue samples were collected from the targeted organs.

2.5. Virus Isolation From Tissue Samples

2.5.1. Virus Isolation by Embryonated Eggs

The collected tissue samples were placed in the transport medium containing 1 mL of 50% glycerol, 50% phosphate-buffered saline, streptomycin (200 mg/L), penicillin (2 × 106 U/L), and amphotericin B (250 mg/L) and immediately transferred to the lab. Tissue homogenate was prepared by mincing 0.5 g tissue per 1.5 mL PBS, and virus suspension was prepared by centrifugation at 10,000 × g for 5 min and then passing the supernatant through a 0.45-μm membrane filter. The filtrate (100 μL) was inoculated into semi-SPF embrocated eggs (10 days old) by adopting the method described by WOAH [40]. The eggs were incubated for 48 h at 37°C and then chilled at 4°C for 24 h. After 24 h of incubation, the blunt end of the eggs was removed using sterilized scissors, and allantoic fluid (AF) was harvested and separated by centrifugation at 10,000 × g for 5 min.

2.5.2. Virus Titration by Heamagglutination (HA) Reaction

The presence of heamagglutinin agents in the AF was confirmed by HA reaction [40]. Saline (100 μL) was dispensed into all wells of U-shaped microtiter plates. AF (100 μL) was added to the 1^st column of plates and two-fold dilution was performed up to the 11^th column. The 12^th column was used as the negative control. RBCs (0.7%, 100 μL) were then added to each well and incubated at 37°C for 30 min. The tubes were observed for agglutination reaction and button formation. HA titer was expressed in terms of log₂.

2.6. Serological Detection of NDV

2.6.1. Detection of NDV Exposure by ELISA

The collected serum samples were further investigated by ELISA (IDEXX kit) for the detection of NDV infection.

2.6.1.1. ELISA Procedure

The serum sample was diluted to 1:500 by transferring 1 μL of the serum sample to 449 μL of dilution buffer. An NDV-coated plate was obtained, and the seal was removed. The negative and positive controls were dispensed (100 μL) in duplicates. Prediluted serum sample (100 μL) were added to each well (except the negative and positive controls) and incubated for 30 min at 18°C–26°C (± 2 min). The solution was aspirated from each well, and the plate was washed with distilled water (350 μL) five times. Before drying the plate, 100 μL of conjugate was added to each well and incubated for 30 min at 18°C–26°C (± 2 min). This was followed by the removal of liquid from the wells of the plate using an automatic plate washer and washing the plate with distilled water (350 μL) five times. Substrate solution (100 μL) was added to each well and incubated for 15 (± 1) min at 18°C–26°C. Finally, 100 μL of stop solution was added and absorbance was recorded at 650 nm.

The relative level of antibody in the sample was determined by calculating the sample-to-positive (S/P) ratio.

SP is the sample to positive. PCx is the positive control means. NCx is the negative control mean. The endpoint titer was calculated using the equation described below

Interpretation is as follows: negative S/P ≤ 0.20; positive S/P > 0.20.

The infection of NDV was detected by comparing the limit of vaccine titer in different weeks with the observed titer during the investigation (Table 2).

Table 2. The limit and specific threshold of vaccine titer for detecting NDV infection by using NDV IDEXX ELISA kit.

S/no	Limit of vaccine titer at different ages
S/no	DOC	5–6 weeks	10–12 weeks	22–55 weeks	Older than 55 weeks
Breeder	1500–4000	3500–6000	5000–8000	7000–9000	6000–8000
Layer	3000–4000	3000–4000	4000–6000	7000–9000	6000–8000
Broiler	4000–7000	500–2000

Abbreviation: DOC, day-old chicks.

2.7. Biological Characterization

2.7.1. Intracerebral Pathogenicity Index (ICPI) Assessment

AF harvested from inoculated eggs showing HA titer > 1/16 (HA titer > 24) was diluted 1/10 in PBS, and 0.05 mL was injected (intracerebral space) in 10 chicks (day-old). The inoculated chicks were observed with an interval of 1 day for 8 days, and then, the score of the birds was recorded according to OIE 2012. At each observation, the birds are scored as follows: 0 if normal, 1 if sick, and 2 if dead. An ICPI score ≥ 0.70 was considered pathogenic [41].

2.7.2. Mean Death Time (MDT) of the Minimum Lethal Dose (MLD)

The MDT was investigated for 10-day-old embrocated eggs. Serial dilutions of allantois fluid of each local virus isolate were prepared, and then, 0.1 mL of each dilution (10^–6, 10^–7, 10^–8, and 10^–9) was inoculated into the allantois cavity of eggs. The highest dilution at which all inoculated embryos died soon after was noted, and the MLD and MDT were calculated [42, 43].

2.8. Molecular Detection

2.8.1. RNA Extraction

NDV RNA was extracted from the harvested allantois fluid after 48 h of incubation at 37°C. The fluid was centrifuged at 8000 × g for 5 min, and NDV RNA was extracted according to the manufacturer’s instructions (Life Technologies). Viral RNA was extracted from HA-positive samples using a TRIzol RNA extraction kit (Catalog Numbers 15596026 and 15596018). After thawing, 250 μL of HA-positive allantois fluid was mixed with 750 μL of TRIzol reagent (1:3 ratio) and incubated at room temperature for 10 min. After incubation, the mixture was centrifuged at 12,000 g for 10 min. The supernatant was transferred to a fresh 1.5 mL tube and 250 μL chloroform was added and incubated at room temperature for 10 min. The mixture was centrifuged at x12,000 g for 15 min at 4°C. The aqueous phase containing RNA was transferred into a fresh tube, and then, chilled isopropanol (350 μL) was added into the tube and incubated at room temperature for 10 min to precipitate RNA. Centrifugation was performed for 10 min at 10,000 g at 4°C. The supernatant was discarded, and 750 μL of chilled ethanol was added to the tube. Final centrifugation was performed for 5 min at 7500 g to wash the RNA pellet. This step was repeated three times. The RNA pellet was dissolved in RNase-free water and stored at −80°C. The extracted RNA was quantified using a NanoDrop spectrophotometer. The final extract was dissolved in RNase-free water (Promega) and used for RT-PCR.

2.8.2. RT-PCR

2.8.2.1. RT-PCR Reaction Mixture

Molecular identification was carried out by RT-PCR targeting the Fusion gene of NDV. The RT-PCR reaction was performed in 50 μL reaction mixture containing reagents 10 μL AMV/Tft 5x reaction buffer, 0.2 mM/μL of dNTPs, 1 mM MgSO₄, 0.1 μM of forward primer (4306F) 5⁣^′GACCGCTGACCACGAGGTTA⁣^′3, reverse primer (5005R) 5⁣^′AGTCGGAGGATGTTGGCAGC⁣^′3, 0.1 U/μL of AMV reverse transcriptase, Tft DNA polymerase, and 8.42 ng/μL RNA template. After the addition of all reagents, the volume was raised up to 50 μL with RNase-free water.

2.8.2.2. RT-PCR Conditions

RT-PCR was carried out to synthesize cDNA at 45°C for 60 min followed by PCR. The 30 cycles of PCR consisted of an initial denaturation at 95°C for 1 min, cycling denaturation at 94°C for 1 min, annealing at 50°C for 1 min, and extension at 72°C for 3 min with the final extension of 72°C for 10 min [44]. The PCR products (700 bp) were visualized on a 2% agarose gel after staining with ethidium bromide.

2.9. Molecular Characterization

2.9.1. Nucleotide Sequencing

The bands (700 bp of Fusion gene) were cut and excised from the gel and purified by using the Promega purification kit Wizard SV Gel and PCR Clean-Up System (Promega, Co., Madison, Wisconsin, United States) according to the manufacturer’s instruction and product was sequenced by dideoxy method. The sequenced data were submitted to GenBank, and the accession numbers were obtained as given hereunder.

1.
IsolateChicken/Pakistan/691, NDV accession NoMN096605.
2.
IsolateChicken/Pakistan/633, NDVaccession NoMN096604.
3.
IsolateChicken/Pakistan/697, NDV accession NoMN096603.
4.
IsolateChicken/Pakistan/688, NDV accession NoMN096606.

2.9.2. Phylogenetic Analysis

The sequence of previously characterized reference strains of Asia, the Middle East, and isolates consisting of Genotypes (I–IX) from other parts of the world were retrieved from GenBank (http://www.ncbi.nlm.nih.gov). The sequence data was imported into Clustal W for alignment. The aligned file was imported into Gene DOC for multiple sequence alignment. The multiple sequences alignment file was created and imported into MEGA 11 software for phylogenetic analysis. The phylogenetic analysis was done by the maximum likelihood method [45, 46]. The substitution mutation analysis of the Fusion gene cleavage site was done by comparing the sequence of local isolates and the sequence of reference strains.

2.9.3. Determination of Amino Acid Sequence at Cleavage Site of Fusion Protein

For molecular pathotyping of NDV, the nucleotide sequence in the Fusion gene cleavage site was translated into amino acids using MEGA Version 11, and the amino acid sequence at the Fusion protein cleavage site was determined and compared with the amino acid sequence of previously published reference isolates retrieved from the GenBank. Pathotyping was done by identifying the molecular pathogenic factors (R, R Q, R, R, and ^↓F) present in the targeted cleavage site of Fusion protein at the position of 112–117.

3. Results

3.1. Clinical Findings

Mortality rates of up to 40% were observed in vaccinated birds, and even these birds had adequate vaccine titers, as indicated in Table 3. The affected birds were found to have clinical signs in the respiratory and nervous system. The clinical signs included difficulty in breathing, coughing, sneezing, nasal discharge, swollen eyes, and greenish diarrhea. The birds succumbed to death a week after clinical manifestation, with the following postmortem lesions.

Table 3. Observed clinical signs and symptoms in morbid birds and postmortem lesions in the respiratory and gastrointestinal tract of dead birds.

Flocks	Age (weeks)	Examined bird	Birds status	No. of birds show lesions	Previous vaccine^a	Mortality	Observed clinical signs/lesions
					Titer
Broiler	3–7	141	Morbid/dead	72	4–6 log₂	25%–40%	1 respiratory
Flock 1	5	21	Morbid/dead	13	5.3 log2	31	• Difficulties in breathing
Flock 2	4.1	13	Morbid/dead	7	4.9 log2	37	• Nasal discharge
Flock 3	6	23	Morbid/dead	9	5.7 log2	28	• Swollen eyes
Flock 4	5.2	18	Morbid/dead	11	5.3 log2	26	• Swelling of the head
Flock 5	5	22	Morbid/dead	8	5.7 log2	25	• Difficulties in breathing
Flock 6	4	24	Morbid/dead	11	4.1 log2	40	• Sleepy appearance
Flock 7	4.6	20	Morbid/dead	13	5.1 log2	27	2 production
							• Poor weight gain
							3 neurological disorder
							Tremors
							• Paralysis of wings and legs
							Muscle
							• Dizzy
							4 hemorrhagic
							• Trachitis
							• Intestine
							• Proventriculus
							• Ceacal tonsil

Layer	8–110	122	Dead	61	7–8.5 log₂	10%–16%	1 respiratory
Flock 1	110	25	Morbid/dead	10	7.6 log₂	13	• Difficulties in breathing
Flock 2	25	18	Morbid/dead	11	8.1 log₂	10	• Nasal discharge
Flock 3	14	31	Morbid/dead	17	8.5 log₂	16	• Swollen eyes
Flock 4	55	28	Morbid/dead	14	7.3 log₂	13	• Swelling of the head
Flock 5	98	20	Morbid/dead	9	7 log₂	10	• Difficulties in breathing
							• Sleepy appearance
							2 production
							• Low egg production
							3 neurological disorder
							Tremors
							• Paralysis of wings and legs
							Muscle
							• Dizzy
							4 hemorrhagic
							• Trachitis
							• Intestine
							• Proventriculus
							• Ceacal tonsil

Breeder	10–80	107	Dead	38	7–8.3 log₂	8%–12%	1 respiratory
Flock 1	34	20	Morbid/dead	7	8.3 log₂	10	• Difficulties in breathing
Flock 2	10	28	Morbid/dead	11	8 log₂	8	• Nasal discharge
Flock 3	80	34	Morbid/dead	15	7.8 log₂	12	• Swollen eyes
Flock 4	53	25	Morbid/dead	5	7.3 log₂	8	• Swelling of the head
							• Difficulties in breathing
							• Sleepy appearance
							2 production
							• Low egg production
							3 neurological disorder
							Tremors
							• Paralysis of wings and legs
							Muscle
							• Dizzy
							4 hemorrhagic
							• Trachitis
							• Intestine
							• Proventriculus
							• Ceacal tonsil

Total		370		171

^aRetrieved from the history of the investigated flock.

3.2. Postmortem Findings

During necropsy, severe NDV-associated gross lesions such as congestion of the trachea, petechial hemorrhages in the intestine and proventriculus, congested lungs, swollen kidneys, and necrotic foci in the spleen were observed. The observed lesions are indicative of infection with the velogenic type of NDV (Figures 1 and 2).

Details are in the caption following the image — **Figure 1**
Open in figure viewer PowerPoint

Petechial hemorrhages in the intestine indicate the infection of NDV.

A total of 141 broiler birds, 122-layer birds, and 107 breeder birds were subjected to necropsy. Of these, 72 broilers, 61 layers, and 38 breeder birds exhibited clear postmortem lesions consistent with NDV infection. The mortality rate was 25%–40%, 10%–16%, and 8%–12% in broilers, layers, and breeders, respectively. The vaccine titer (presented by the farmer) in affected birds was found 4–6 log₂ in broiler flocks, 7–8.5 log₂ in layer, and 7–8.3 log₂ in breeder flocks (Table 3). Despite the significant HI titer, infection in vaccinated flocks indicates the circulation of genetic variants in the fields.

3.3. Serological Detection of NDV Infection

3.3.1. ELISA Titer Greater Than the Limit of Vaccine Titer

During the investigation of serum samples, infection with NDV was detected in vaccinated flocks by observing maximum CV values and ELISA titers greater than the limit of the vaccine titer. The higher antibody titer compared to the vaccine titer (Table 4) suggested NDV infection in 368 out of 877 serum samples collected from sick birds (Figure 3). The serum samples of infected birds showed an ELISA titer greater than the limit of the vaccine titer, indicating infection.

Table 4. Detection of NDV infection based on ELISA titer and coefficient of variation (CV%) in different investigated flocks.

Flock	Tested serum samples	Positive by ELISA	Prevalence %	Mini CV%	Max CV%	Max titer	Indications by
Flock	Tested serum samples	Positive by ELISA	Prevalence %	Mini CV%	Max CV%	Max titer	CV%	ELISA titer
Breeder	387	105	27%	36.6	42.1	25020	Exposure	Exposure
Layer	256	116	45%	39.8	52.3	20732	Exposure	Exposure
Broiler	234	147	62%	33.4	37.3	4173	Exposure	Exposure

The observed antibody titer in breeder flocks was up to 25,020 with a minimum CV% value of 36.3 to a max CV% value of 42.1. Both the ELISA titer and CV% indicated NDV infection in the folks. In the layer flock, the maximum ELISA titer was found 20,732 with CV% values of minimum 39.8 to max 52.3. The maximum ELISA titer in broiler flocks was 4173 with a CV% value minimum of 33.4 to a maximum of 37.3. Both the ELISA titer and CV% values in layer and broiler flocks also indicate the infection of NDV in tested flocks. The infection of NDV in breeder flocks was found to be 27%, layer 45%, and broiler 62% by ELISA (Table 4).

3.3.2. Detection of Higher ELISA Titer in the Affected Flock

The elevated antibody titer was quantified using ELISA. The ELISA titer at 5–6 weeks in the breeder, layer, and broiler flocks was greater than the vaccine titer provided by the manufacturer (breeder < 8000, layer < 5000, and broiler < 4000). ELISA titers at 10–12 and 22–25 weeks in the breeder and layers were greater than the vaccine titer (breeder < 25,000 and layer < 20,000). The ELISA titer above 55 weeks in the breeder and flock also indicated infection (breeder < 25,000; layer < 1900) (Figure 3). All observed titers in different flocks suggested NDV infection in the investigated flocks.

3.4. Molecular Diagnosis

3.4.1. Molecular Diagnosis of NDV by RT-PCR

The results of RT-PCR showed a higher prevalence of NDV in the selected area. NDV infection was confirmed by RT-PCR in AF collected after 48 h of incubation. Out of 167 HA-positive AF, 66 AF samples were found positive for NDV by amplifying the Fusion gene which produced the expected band size of 700 bp (Figure 4). The RT-PCR product was subsequently used for the molecular characterization of NDV by gene sequencing.

3.4.2. Prevalence of NDV Detected by RT-PCR

NDV infection was detected by Fusion gene-based RT-PCR in the affected flocks. Different prevalence percentages of NDV were detected in previously vaccinated (multiple dose) infected flocks. The prevalence of NDV was 21% in broiler flocks, 17% in layers, and 15% in breeders (Table 5).

Table 5. Detection of NDV in different vaccinated flocks by RT-PCR targeting the Fusion gene.

Bird types	Investigated bird status	Vaccine shots up to culling	Vaccine strain	Total sample collected	Positive by culture and Fusion gene PCR	% of positive
Broiler	Morbid/dead	4 times	Genotype II	141	29	21
Layer	Morbid/dead	9 times	Genotype II	122	21	17
Breeder	Morbid/dead	6–9 times	Genotype II	107	16	15
Total				370	66	18

3.4.3. Phylogenetic Analysis of NDV Based on Fusion Gene

Phylogenetic analysis of the partial Fusion gene sequence of the selected isolates revealed high diversity among NDV field isolates and vaccine strains (Genotype II) used in the southern region. All selected local isolates (e.g., Chicken/Pakistan/691 NDV with the accession No. MN096605; Chicken/Pakistan/633 NDV with the accession No. MN096604, and Chicken/Pakistan/688 NDV with Accession No. MN096606) were clustered closely and showed proximity with NDV Genotype VII, which is considered a velogenic NDV type as shown in Figure 5. In contrast, one isolate (Chicken/Pakistan/697/2017 with Accession No. MN096603) was grouped with NDV Genotype II (Figure 5).

3.5. Pathotyping of NDV

3.5.1. Detection of Biological Factors Involve in Pathogenicity

The isolates of NDV (66) obtained from different regions were characterized biologically using methods such as calculation of ICPI in day-old chicks and MDT after inoculation into 10-day-old embryonated eggs [47]. During biological characterization, the ICPI index in day-old chicks was observed from 0.4 to 2 in all isolates, and the MDT was recorded from 48 to > 90 h. During the biological characterization of a total of 66 tested isolates, 57 isolates scored an ICPI index of 1.7–2 with an MDT of 48–53 h and were classified as velogenic. The other nine isolates scored an ICPI index of 0.4–0.5 with the MDT > 90 h and were classified as a lentogenic type. Based on ICPI and MDT, 57 isolates were considered velogenic, and nine isolates were characterized as lentogenic (Table 6).

Table 6. Biological characterization of NDV isolated from different districts of Sindh Karachi, Hyderabad, Thata, and Dado by ICPI and MDT methods.

Region	No. of isolates	0.2	0.3	0.4	0.5	1.6	1.7	1.8	1.9	2	48	49	50	51	52	53	54	72	> 90	Pathotype
Region	No. of isolates				ICPI index									MDT (h)						NDV
Karachi	20	0	0	0	0	0	6	4	2	8	10	2	4	2	2	0	0	0	0	Velogenic
Hyderabad	9	0	0	6	3	0	0	0	0	0	0	0	0	0	0	0	0	0	9^a	Lentogenic^a
Theta	23	0	0	0	0	0	5	8	3	7	12	6	4	1	0	0	0	0	0	Velogenic
Dado	14	0	0	0	0	0	1	5	2	6	6	1	4	3	0	0	0	0	0	Velogenic
Total	66	0	0	6	3	0	12	17	7	21	28	9	12	6	2	0	0	0	9

^aPrevalence of low pathogenic type.

3.5.2. Detection of Molecular Factors Involved in Pathogenicity

The molecular factors (amino acids) involved in the pathogenicity of the NDV Fusion protein were determined. The amino acid sequence of Fusion protein region 112–117 was compared with the previously published amino acid sequence of isolates retrieved from GenBank (Table 1). All field isolates (such as Chicken/Pakistan/691 NDV, Chicken/Pakistan/633 NDV, and Chicken/Pakistan/688 NDV) show similar velogenic cleavage sites with four basic amino acid residues R, R Q, R, R, and ^↓F with phenylalanine (F) at position 117. These sequences have been postulated to be potent molecular determinants for severe velogenic effects during infection [48, 49]. Analysis of the amino acid sequence of the Fusion protein cleavage site showed that all isolates of NDV belong to the virulent type of NDV. Only one isolate, Chicken/Pakistan/697, showed two basic amino acids G, R, Q, G, and R^↓L in their cleavage site indicating their lentogenic nature (Table 7).

Table 7. Molecular pathotyping of NDV based on the amino acid sequence at the cleavage site of Fusion protein in local isolates and previously reported different isolates retrieved from GenBank.

Strain	Fusion protein sequence 109–120												Pathotype
				Fusion protein cleavage motif									Based on Fusion protein cleavage site
Accession no.	109	110	111	112	113	114	115	116	117	118	119	120	Based on Fusion protein cleavage site
EU293914.1	S	G	G	R	R	Q	R	R	↓F	I	G	A	Virulent
AY741404.1	S	G	G	R	R	Q	R	R	↓F	I	G	A	Virulent
GU187941.1	S	G	G	R	R	Q	R	R	↓F	I	G	A	Virulent
FJ436302.1	S	G	G	R	R	Q	R	R	↓F	I	G	A	Virulent
JX518883.1	S	G	G	R	R	R	R	R	↓F	V	G	A	Virulent
AY845400.2	S	G	G	G	R	Q	G	R	↓L	I	G	A	Avirulent
AJ629062.1	S	G	G	G	R	Q	G	R	↓L	I	G	A	Avirulent
X04719.1	S	G	G	R	R	Q	K	R	↓L	I	G	A	Virulent
AY935499.2	S	G	G	R	K	Q	G	R	↓L	I	G	A	Avirulent
HM063422.1	S	G	G	E	R	Q	G	R	↓L	I	G	A	Avirulent
EF201805.1	S	G	G	R	R	Q	R	R	↓F	I	G	A	Virulent
JX173098.1	S	G	G	R	R	Q	K	R	↓F	I	G	A	Virulent
KJ450980.1	S	G	G	R	R	Q	K	R	↓F	I	G	A	Virulent
KY693681.1	S	G	G	R	R	Q	K	R	↓F	I	G	A	Virulent
KU365652.1	S	G	G	R	R	Q	K	R	↓F	I	G	A	Virulent
^aMN096604	S	G	G	R	R	Q	K	R	↓F	I	G	A	Virulent
^aMN096606	S	G	G	R	R	Q	K	R	↓F	I	G	A	Virulent
^aMN096605	S	G	G	R	R	Q	K	R	↓F	I	G	A	Virulent
^aMN096603	S	G	G	G	R	Q	G	R	↓L	I	G	A	Avirulent
GQ288388.2	S	R	G	R	R	Q	K	R	↓F	V	G	A	Virulent
FJ766526.1	S	G	G	R	R	Q	K	R	↓F	I	G	A	Virulent
AY734534.1	S	G	G	R	R	Q	K	R	↓F	I	G	A	Virulent

^aLocal Pakistani isolates.

3.6. Amino Acid Substitution in Fusion Protein

The substitution mutation in the amino acid sequence of the Fusion protein was determined by reverse transcription of the Fusion gene sequence of a selective NDV isolate. A unique substitution in the amino acid sequence of the Fusion protein at Positions 105 and 107 in Pakistani isolates Chicken/Pakistan/633 NDV (MN096604) and Chicken/Pakistan/691 NDV (MN096605) was observed. Serine (S) was replaced with proline (P) and serine/thymine (S/T) was replaced with alanine (A), while all other reference isolates showed S at position 105 and S/T at position 107 of the Fusion proteins. Another selective isolate Chicken/Pakistan/688 NDV (MN096606) showed a substitution at position 107, where S/T was replaced by A. Only one isolate Chicken/Pakistan/697 NDV (MN096603) showed a similar amino acid pattern with other reference avirulent NDVs. The dotted lines in the box represent identical sequences of amino acid mentioned in the first row; the single alphabet in the box represents differences in amino acid sequences (Table 8).

Table 8. Substitution of amino acid sequence at Positions 105 and 107 in Fusion protein of NDV local isolates. The sequence was compared with the sequence of reference strains retrieved from GenBank.

Reference strains	1	2	3	4	5	6	7	8	9	10	11	12	20	105	107
	The variable amino acid sequence of Fusion protein of NDV field isolate and reference strains
JX173098.1	M	G	S	K	P	S	R	I	P	E	S	S	M	S	S
KJ450980.1	—	—		—	—	—	—	—	—	A	P	L	—	—	—
KY693681.1	—	—	P	—	—	—	—	T	—	A	P	L	—	—	—
KU365652.1	—	—	—	—	—	—	—	—	—	A	P	L	—	—	—
^aMN096605	—	—	—	—	—	—	—	—	—	A	P	L	—	^sP	^sA
^aMN096604	—	—	—	—	—	—	—	—	—	A	P	L	—	^sP	^sA
^aMN096606	—	—	—	—	—	—	—	—	—	A	P	L	—	—	^sA
FJ766526.1	—	D	—	—	—	H	—	—	—	A	P	L	T	—	—
GQ288388.2	—	—	P	—	—	—	—	T	—	A	P	L	T	—	T
AY734534.1	—	—	—	—	S	—	—	—	—	T	P	L	L	—	T
EU293914.1	—	—	—	R	S	—	—	—	T	V	P	L	A	—	T
AY741404.1	—	—	—	R	S	—	—	—	—	V	P	P	V	—	T
GU187941.1	—	—	—	R	S	—	—	T	—	A	H	L	A	—	T
FJ436302.1	—	—	P		S	—	N	V	—	A	P	L	A	—	T
JX518883.1	—	—	—	Q	S	—	W	—	—	I	F	P	V	V	T
EF201805.1	—	—	P	R	S	—		—	—	V	P	L	T	T	T
AY845400.2	—	—	—	R	—	—	K	N	—	A	P	M	A	A	T
AJ629062.1	—	—	—	R	—	—	K	N	—	A	P	M	A	A	T
^aMN096603	—	—	—	R	—	—	K	N	—	A	P	M	A	A	T
X04719.1	—	—	P	R	—	—	K	N	—	V	P	M	A	A	T
AY935499.2	—	—	—	—	S	—	—	F	—	V	P	L	—	T	T
HM063422.1	—	—	—	R	S	—	—	—	—	V	P	L	A	A	T

^aLocal isolates
^sAmino acid substitution.

3.7. Distribution of NDV Genotypes in the South Region

The NDV Genotype VII was found to be prevalent in the targeted district of the southern region (Sindh) with the exception of Hyderabad, where NDV Genotype II was predominant. The prevalence of NDV Genotype VII was detected in all the selected regions including Karachi (30%), Dadu (21%), and Thatta (35%) while Genotype II was prevalent in Hyderabad (13%). The highest prevalence of NDV Genotype VII was recorded in Thatta District, followed by Karachi and Dadu District (Figure 6).

4. Discussion

NDV is endemic in Pakistan and poses a significant threat to the poultry industry [50]. The high mortality in the vaccinated poultry flocks indicates the circulation of the virulent strains in the field. As a mitigation strategy, it is essential to characterize the prevalent strains and to identify the genetic cluster of the NDV in the region. Based on its Fusion gene sequence, various diverse genetic clusters of NDV have been identified [22, 51], which have been further divided into subtypes. The prevalence of diversified genetic groups of NDV V, VI, VII, and VIII has been reported from different geographic regions including Pakistan [37, 52], China, Malaysia, Kazakhstan, Kyrgyzstan [53, 54], and Africa [55]. Among these, Genotypes V, VI, VII, and VIII are considered as most prevalent genotypes in the world while genotype VII has been found a prevalent subtype in Asia [56]. Circulation of VII and other genetic groups have also been reported from different regions of Pakistan [36–38], but molecular epidemiology of the NDV has rarely been reported from the southern region.

Interestingly, the vaccine against Genotype II is commonly used in the southern region of Pakistan with the repeated shots twice per month. Despite extensive vaccination, NDV outbreak in the vaccinated commercial poultry flocks was noted in this region. Although protective HI titers ranging from 4 to 8 log₂ were present, a very high mortality rate was observed in the vaccinated flock. The susceptible birds initially showed clinical signs and symptoms related to NDV and then succumbed to death a week later; the presence of severe postmortem lesions in various organs indicated the infection by a virulent strain. The results of the ELISA test confirmed the infection by NDV. This situation indicated a distinct genetic group of the infective agent than the vaccine strain. Molecular characterization and phylogenetic analysis of the selected isolates revealed the presence of a single Genotype VII of NDV in vaccinated flocks. Indeed, all the selected isolates were clustered with Genotype VII. In contrast, the involvement of two genotypes, VI and VII, was reported in 2010 [52], while the lentogenic Type II and velogenic Type VII were reported from different regions of Punjab [37, 57]. Following these reports, another study revealed the prevalence of a single Type VII from different regions of Panjab highlighting an outbreak of this velogenic type [37]. This finding also indicated the replacement of previously reported genotypes (II, IV, and XIII) from 2010 to 2015. This finding is also supported by previous studies which revealed the replacement of Genotype XIII with a new emerging genotype VII [58, 59]. Consequently, Genotype VII was found continually associated with fatal outbreaks in the vaccinated flocks as an endemic type from northern to southern regions. Although its origin is not certainly known, the growing number of reports suggests its transmission from densely populated regions of Punjab.

Punjab is a densely populated region where different types of poultry flocks prevail including GP, breeder, commercial layer, and broiler. On the other hand, the wild birds are crucial in NDV epizootic [58]. Various species of wild birds play a significant role in the transmission of NDV. Some incidence was reported from seven districts of the southern region where wild peacocks have been affected by the virulent type of NDV [36]. Hence, it is assumed that wild birds may be a potential source of virulent NDV transmission in the southern region, because the southern region is a major hub for wild birds where various species of migratory birds are inhabitated during the summer and winter seasons. Particularly the lakes, Kanjher and Manchar, reportedly receive 98 and 39 migratory water bird species [60, 61]. Likewise, the other hotspots in the southern region including Hub Dam, Jhimpir Wind Corridor, and the Coastal wetland received 134, 79, and 75 migratory birds, respectively [62, 63]. As these lakes, dams, and wetlands are of socioeconomic importance where villagers depend on their maximum livelihood; therefore, these may act as a source for the dissemination of disease from wild birds to the backyard followed by commercial poultry. It is of particular interest as earlier reports indicate the presence of Genotype VII in backyard poultry [37]. NDV of Genotype VII has also been associated with the outbreak in the Middle East [64] that may have been reached to the southern region of Pakistan through wild birds as this genotype has also been reported in the wild birds [65]. Hence, a comprehensive investigation is required to investigate the role of water birds in the dissemination of NDV.

The virulent infection in the vaccinated flocks [37, 38] indicated the continuous evolution in Genotype VII and consistent circulation in the fields affecting the flocks vaccinated with Genotypes II and III. All types of flocks in open and controlled houses were found to be affected by the NDV Genotype VII indicating its persistence. The variation between the vaccine strains and the field type poses a great challenge [66, 67]. The emergence and circulation of new genetic groups among vaccinated flocks have been reported earlier [57, 68]. The emergence of diverse genotypes and their significant threats was also recognized by Miller et al. [69]. The spread of Genotype VII and its significant impact on vaccination programs was noted globally, especially in South America [70] and the Far East [71, 72]. Recently, vaccine failure leading to a change in the vaccination program has also been recommended in Egypt [73]. These findings raised the questions against conventional vaccines and suggested changes in vaccination programs worldwide.

For a long time, it was commonly accepted that the conventional NDV vaccines (G II) are effective in controlling NDV infection; however, experimental studies reported a failure in preventing infection caused by a completely different genotype circulating in the field [74–77]. Recent studies claim that vaccines based on genetically related types provide better protection against the GVII field virus compared with Genotype II NDV vaccines [73, 74, 77–80]. The phylogenic gaps between the vaccine strain and field-challenged virus were observed during the investigation which may be attributed to a lack of protection in the vaccinated flocks.

The failure of protection for the birds vaccinated with the live vaccine demands a nationwide comprehensive molecular epidemiological investigation on a regular basis. This will aid in making the vaccination program effective.

This study also revealed the pathogenic potential of the circulating NDV which was attributed to the amino acid sequence of the cleavage motif in Fusion protein [31, 33, 81, 82]. The amino acid analysis of the Fusion protein cleavage site of the selected NDV isolates had polybasic amino acids from positions 112–117 (R¹¹²R¹¹³Q¹¹⁴K¹¹⁵R^{116 ↓}F¹¹⁷) with F at Position 117. The presence of these factors in the Fusion proteins indicates that all isolates belonged to the highly pathogenic velogenic type. The sequence analysis of the Fusion protein confirmed that the outbreak of this velogenic type had a pathogenic identity with previously reported velogenic types isolated from 2012 to 2013 in Panjab and other regions of Pakistan [38, 57]. The in vivo pathogenicity assays, ICPI and MDT, also classified the isolate into two pathotypes, velogenic and lentotype.

Fusion protein plays a pivotal role in NDV virulence as some of its substituted amino acid mutations have an association with the pathogenic potentials by increasing the fusogenic ability of the NDV [83]. Some point mutations in Fusion protein have been reported in the isolates from Pakistan [37]; however, their role in pathogenicity has not been fully elucidated. A unique substitution mutation in the amino acid sequence of Fusion protein was found at Positions 105 and 107 where S was substituted by P in isolates of Chicken/Pakistan/633/2016 (NDV), Chicken/Pakistan/691/2016 (NDV), and another isolate Chicken/Pakistan/688/2017 (NDV), where S/T amino acid was substituted by A at the position of 107. These mutations indicate the genetic diversity of selected isolates. The unique substitution mutation of amino acid in the Fusion protein of selected isolates may be another virulent factor responsible for increasing the pathogenic potentials and vaccine failure with fatal consequences in vaccinated flocks. In previous studies, it was noted that a mutation in the Fusion protein cleavage site potentially affects the pathogenicity of NDV [84]. Such findings need detailed investigations.

The epizootic and favorable situation for NDV in Pakistan adds a potential risk for sweeping of current genotype with a newly emerging genotype which exacerbates the vaccination program and risk of repeated outbreaks. The replacement of previously prevalent Genotype II with Genotype VII NDV throughout Pakistan raises the question of improving the preventive measures in commercial poultry.

Addressing these issues requires a comprehensive approach including proper vaccine selection based on the current molecular epidemiological situation, storage and maintenance of cold chain, handling of vaccine, and administration of vaccine and measures to improve overall flock health. Additionally, ongoing surveillance of circulating NDV strains and vaccination efficacy can help inform decision-making and control strategies.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding

This project was funded by the University of Karachi.

Open Research

Data Availability Statement

The data associated with this manuscript can be provided on reasonable request.

References

1 Ghalib S. A., Kanwal R., Zehra A., Siddiqui S., Hussain B., Yasmeen G., Ullah U., Manzoor U., Raza N., and Begum A., Review of the distribution, status and conservation of wildlife of Sindh, Canadian Journal of Pure and Applied Sciences. (2018) 12, no. 2, 4519–4533.
Google Scholar
2 Sultan S., Eldamarany N. M. I., Abdelazeem M. W., and Fahmy H. A., Active surveillance and genetic characterization of prevalent velogenic Newcastle disease and highly pathogenic avian influenza H5N8 viruses among migratory wild birds in Southern Egypt during 2015–2018, Food and Environmental Virology. (2022) 14, no. 3, 280–294, https://doi.org/10.1007/s12560-022-09532-1, 35948740.
10.1007/s12560-022-09532-1
CAS PubMed Web of Science® Google Scholar
3 Dizaji R. E., Ghalyanchilangeroudi A., Marandi M. V., Hosseini H., Karimi V., Ziafatikafi Z., Molouki A., and Mehrabadi M. H. F., Complete genome sequence of a subgenotype XXI.1.1 pigeon paramyxovirus type 1 virus (PPMV-1) isolated from Iran in 2018 and phylogenetic analysis of a possible novel, but unassigned, PPMV-1 group isolated in 2014, Comparative Immunology, Microbiology and Infectious Diseases. (2020) 73, 101565, https://doi.org/10.1016/j.cimid.2020.101565, 33126169.
10.1016/j.cimid.2020.101565
PubMed Web of Science® Google Scholar
4 Liu Y.-P., Lee F., Cheng M.-C., Chang C.-Y., Chiou C.-J., and Tsai H.-J., Genetic diversity of avian paramyxoviruses isolated from wild birds and domestic poultry in Taiwan between 2009 and 2020, Journal of Veterinary Medical Science. (2022) 84, no. 3, 378–389, https://doi.org/10.1292/jvms.21-0608, 35082196.
10.1292/jvms.21-0608
CAS PubMed Web of Science® Google Scholar
5 Karamendin K. and Kydyrmanov A., Cormorants as a potentially important reservoir and carrier of Newcastle disease virus on the Asian continent, Frontiers in Veterinary Science. (2021) 8, 648091, https://doi.org/10.3389/fvets.2021.648091, 34195243.
10.3389/fvets.2021.648091
PubMed Web of Science® Google Scholar
6 Ross C. S., Mahmood S., Skinner P., Mayers J., Reid S. M., Hansen R. D. E., and Banyard A. C., JMM profile: Avian paramyxovirus type-1 and Newcastle disease: a highly infectious vaccine-preventable viral disease of poultry with low zoonotic potential, Journal of Medical Microbiology. (2022) 71, no. 8, 001489.
10.1099/jmm.0.001489
CAS Web of Science® Google Scholar
7 Zhang Y., Wang W., Li Y., Liu J., Wang W., Bai J., Yang Z., Liu H., and Xiao S., A pigeon paramyxovirus type 1 isolated from racing pigeon as an inactivated vaccine candidate provides effective protection, Poultry Science. (2022) 101, no. 10, 102097, https://doi.org/10.1016/j.psj.2022.102097, 36055029.
10.1016/j.psj.2022.102097
CAS PubMed Web of Science® Google Scholar
8 Zhan T., Xiaolong L., He D., Xiaomin Gao Y., Chen Z. H., Wang X., Shunlin H., and Liu X., Phylogenetic analysis and pathogenicity assessment of pigeon paramyxovirus Type 1 circulating in China during 2007–2019, Transboundary and Emerging Diseases. (2022) 69, no. 4, 2076–2088, https://doi.org/10.1111/tbed.14215, 34213072.
10.1111/tbed.14215
CAS PubMed Web of Science® Google Scholar
9 Esmaeelzadeh-Dizaji R., Molouki A., Hosseini H., Fallah-Mehrabadi M. H., Ziafati-Kafi Z., Takalou A., Eram N., Kumar N., Ashuri A., Sadri N., and Ghalyanchi-Langeroudi A., Molecular characterization of a pigeon paramyxovirus Type 1 virus isolated from Eurasian collared doves in Iran, 2017, Journal of Veterinary Science. (2022) 23, no. 3, https://doi.org/10.4142/jvs.21254.
10.4142/jvs.21254
PubMed Web of Science® Google Scholar
10 Msoffe P. L. M., Chiwanga G. H., Cardona C. J., Miller P. J., and Suarez D. L., Isolation and characterization of Newcastle disease virus from live bird markets in Tanzania, Avian Diseases. (2019) 63, no. 4, 634–640, https://doi.org/10.1637/aviandiseases-D-19-00089, 31865678.
10.1637/aviandiseases-D-19-00089
PubMed Web of Science® Google Scholar
11 Rima B., Balkema-Buschmann A., Dundon W. G., Duprex P., Easton A., Fouchier R., Kurath G., Lamb R., Lee B., Rota P., Wang L., and ICTV Report Consortium, ICTV Virus Taxonomy Profile: Paramyxoviridae, Journal of General Virology. (2019) 100, no. 12, 1593–1594, https://doi.org/10.1099/jgv.0.001328.
10.1099/jgv.0.001328
CAS PubMed Web of Science® Google Scholar
12 Mngumi E. B., Mpenda F. N., and Buza J., Epidemiology of Newcastle disease in poultry in Africa: systematic review and meta-analysis, Tropical Animal Health and Production. (2022) 54, no. 4, https://doi.org/10.1007/s11250-022-03198-4, 35705876.
10.1007/s11250-022-03198-4
PubMed Web of Science® Google Scholar
13 Khorajiya J. H., Joshi B. P., Mathakiya R. A., Prajapati K. S., and Sipai S. H., Economic impact of genotype-XIII Newcastle disease virus infection on commercial vaccinated layer farms in India, International Journal of Livestock Research. (2018) 8, no. 5, 280–288.
10.5455/ijlr.20170820030455
Google Scholar
14 I. Capua and D. J. Alexander, Avian Influenza and Newcastle Disease: A Field and Laboratory Manual, 2009, Springer Science & Business Media, https://doi.org/10.1007/978-88-470-0826-7, 2-s2.0-84900614585.
10.1007/978-88-470-0826-7
Google Scholar
15 Kuhn J. H., Wolf Y. I., Krupovic M., Zhang Y.-Z., Maes P., Dolja V. V., and Koonin E. V., Classify viruses — the gain is worth the pain, Nature. (2019) 566, no. 7744, 318–320, https://doi.org/10.1038/d41586-019-00599-8, 2-s2.0-85061786563, 30787460.
10.1038/d41586-019-00599-8
PubMed Web of Science® Google Scholar
16 Seal B. S., King D. J., and Sellers H. S., The avian response to Newcastle disease virus, Developmental & Comparative Immunology. (2000) 24, no. 2–3, 257–268, https://doi.org/10.1016/S0145-305X(99)00077-4, 2-s2.0-0034163334.
10.1016/S0145-305X(99)00077-4
CAS PubMed Web of Science® Google Scholar
17 Butt S. L., Taylor T. L., Volkening J. D., Dimitrov K. M., Williams-Coplin D., Lahmers K. K., Miller P. J., Rana A. M., Suarez D. L., Afonso C. L., and Stanton J. B., Rapid virulence prediction and identification of Newcastle disease virus genotypes using third-generation sequencing, Virology Journal. (2018) 15, no. 1, https://doi.org/10.1186/s12985-018-1077-5, 2-s2.0-85057084775, 30466441.
10.1186/s12985-018-1077-5
PubMed Web of Science® Google Scholar
18 Nooruzzaman M., Barman L. R., Mumu T. T., Chowdhury E. H., Dimitrov K. M., and Islam M. R., A pigeon-derived sub-genotype XXI. 1.2 Newcastle disease virus from Bangladesh induces high mortality in chickens, Viruses. (2021) 13, no. 8, https://doi.org/10.3390/v13081520, 34452385.
10.3390/v13081520
PubMed Google Scholar
19 da Silva A. P., Aston E. J., Chiwanga G. H., Birakos A., Muhairwa A. P., Kayang B. B., Kelly T., Zhou H., and Gallardo R. A., Molecular characterization of Newcastle disease viruses isolated from chickens in Tanzania and Ghana, Viruses. (2020) 12, no. 9, https://doi.org/10.3390/v12090916, 32825492.
10.3390/v12090916
PubMed Google Scholar
20 Suarez D. L., Miller P. J., Koch G., Mundt E., and Rautenschlein S., Newcastle disease, other avian paramyxoviruses, and avian metapneumovirus infections, Diseases of Poultry. (2020) 109–166, https://doi.org/10.1002/9781119371199.ch3.
10.1002/9781119371199.ch3
Google Scholar
21 Dimitrov K. M., Abolnik C., Afonso C. L., Albina E., Bahl J., Berg M., Brian F.-X., Brown I. H., Cho K.-S., Chvala I., Diel D. G., Durr P. A., Ferreira H. L., Fusaro A., Gild P., Goujgoulova G. V., Grund C., Hicks J. T., Joannis T. M., Torchetti M. K., Kolosov S., Lambrecht B., Lewis N. S., Liu H., Liu H., McCullough S., Miller P. J., Monne I., Muller C. P., Munir M., Reischak D., Sabra M., Samal S. K., Servan R., de Almeida I., Shittu C. J., Snoeck D. L., SuarezS.Van, Borm Z. W., and Wong F. Y. K., Updated unified phylogenetic classification system and revised nomenclature for Newcastle disease virus, Infection, Genetics and Evolution. (2019) 74, 103917, https://doi.org/10.1016/j.meegid.2019.103917, 2-s2.0-85067419347, 31200111.
10.1016/j.meegid.2019.103917
PubMed Web of Science® Google Scholar
22 Kim L. M., King D. J., Curry P. E., Suarez D. L., Swayne D. E., Stallknecht D. E., Slemons R. D., Pedersen J. C., Senne D. A., Winker K., and Afonso C. L., Phylogenetic diversity among low-virulence Newcastle disease viruses from waterfowl and shorebirds and comparison of genotype distributions to those of poultry-origin isolates, Journal of Virology. (2007) 81, no. 22, 12641–12653, https://doi.org/10.1128/JVI.00843-07, 2-s2.0-36049049543, 17855536.
10.1128/JVI.00843-07
CAS PubMed Web of Science® Google Scholar
23 Courtney S. C., Susta L., Gomez D., Hines N. L., Pedersen J. C., Brown C. C., Miller P. J., and Afonso C. L., Highly divergent virulent isolates of Newcastle disease virus from the Dominican Republic are members of a new genotype that may have evolved unnoticed for over 2 decades, Journal of Clinical Microbiology. (2013) 51, no. 2, 508–517, https://doi.org/10.1128/JCM.02393-12, 2-s2.0-84873040103, 23196361.
10.1128/JCM.02393-12
PubMed Web of Science® Google Scholar
24 Diel D. G., da Silva L. H. A., Liu H., Wang Z., Miller P. J., and Afonso C. L., Genetic diversity of avian paramyxovirus type 1: proposal for a unified nomenclature and classification system of Newcastle disease virus genotypes, Infection, Genetics and Evolution. (2012) 12, no. 8, 1770–1779, https://doi.org/10.1016/j.meegid.2012.07.012, 2-s2.0-84865849138, 22892200.
10.1016/j.meegid.2012.07.012
PubMed Web of Science® Google Scholar
25 Eid A. A., Hussein A., Hassanin O., Elbakrey R. M., Daines R., Sadeyen J. R., Abdien H. M., Chrzastek K., and Iqbal M., Newcastle disease genotype VII prevalence in poultry and wild birds in Egypt, Viruses. (2022) 14, no. 10, https://doi.org/10.3390/v14102244, 36298799.
10.3390/v14102244
PubMed Google Scholar
26 Getabalew M., Alemneh T., Akeberegn D., Getahun D., and Zewdie D., Epidemiology, diagnosis & prevention of Newcastle disease in poultry, American Journal of Biomedical Science and Research. (2019) 3, no. 1, 50–59, https://doi.org/10.34297/AJBSR.2019.03.000632.
10.34297/AJBSR.2019.03.000632
Google Scholar
27 Alexander D. J., Newcastle disease and other avian paramyxovirus, Revue Scientifique et Technique-Office International des Epizooties. (2000) 19, no. 2, 443–462, https://doi.org/10.20506/rst.19.2.1231, 2-s2.0-0040187643.
10.20506/rst.19.2.1231
CAS PubMed Web of Science® Google Scholar
28 Ewies S. S., Ali A., Tamam S. M., and Madbouly H. M., Molecular characterization of Newcastle disease virus (genotype VII) from broiler chickens in Egypt, Beni-Suef University Journal of Basic and Applied Sciences. (2017) 6, no. 3, 232–237, https://doi.org/10.1016/j.bjbas.2017.04.004.
10.1016/j.bjbas.2017.04.004
Google Scholar
29 Toyoda T., Sakaguchi T., Imai K., Inocencio N. M., Gotoh B., Hamaguchi M., and Nagai Y., Structural comparison of the cleavage-activation site of the fusion glycoprotein between virulent and avirulent strains of Newcastle disease virus, Virology. (1987) 158, no. 1, 242–247, https://doi.org/10.1016/0042-6822(87)90261-3, 2-s2.0-0023235834, 3576973.
10.1016/0042-6822(87)90261-3
CAS PubMed Web of Science® Google Scholar
30 Glickman R. L., Syddall R. J., Iorio R. M., Sheehan J. P., and Bratt M. A., Quantitative basic residue requirements in the cleavage-activation site of the fusion glycoprotein as a determinant of virulence for Newcastle disease virus, Journal of Virology. (1988) 62, no. 1, 354–356, https://doi.org/10.1128/jvi.62.1.354-356.1988, 3275436.
10.1128/jvi.62.1.354-356.1988
CAS PubMed Web of Science® Google Scholar
31 Morrison T. G., Structure and function of a paramyxovirus fusion protein, Biochimica et Biophysica Acta (BBA)-Biomembranes. (2003) 1614, no. 1, 73–84, https://doi.org/10.1016/S0005-2736(03)00164-0, 2-s2.0-0037810998.
10.1016/S0005-2736(03)00164-0
CAS PubMed Web of Science® Google Scholar
32 Leeuw D., Olav S., Koch G., Hartog L., Ravenshorst N., and Peeters B. P. H., Virulence of Newcastle disease virus is determined by the cleavage site of the fusion protein and by both the stem region and globular head of the haemagglutinin–neuraminidase protein, Journal of General Virology. (2005) 86, no. 6, 1759–1769, https://doi.org/10.1099/vir.0.80822-0, 2-s2.0-20044375021, 15914855.
10.1099/vir.0.80822-0
CAS PubMed Web of Science® Google Scholar
33 Miller P. J., Decanini E. L., and Afonso C. L., Newcastle disease: evolution of genotypes and the related diagnostic challenges, Infection, Genetics and Evolution. (2010) 10, no. 1, 26–35, https://doi.org/10.1016/j.meegid.2009.09.012, 2-s2.0-72149126867, 19800028.
10.1016/j.meegid.2009.09.012
CAS PubMed Web of Science® Google Scholar
34 Panda A., Elankumaran S., Krishnamurthy S., Huang Z., and Samal S. K., Loss of N-linked glycosylation from the hemagglutinin-neuraminidase protein alters virulence of Newcastle disease virus, Journal of Virology. (2004) 78, no. 10, 4965–4975, https://doi.org/10.1128/JVI.78.10.4965-4975.2004, 2-s2.0-2342544913, 15113876.
10.1128/JVI.78.10.4965-4975.2004
CAS PubMed Web of Science® Google Scholar
35 Maminiaina O. F., Gil P., Briand F.-X., Albina E., Keita D., Andriamanivo H. R., Chevalier V., Lancelot R., Martinez D., Rakotondravao R., Rajaonarison J.-J., Koko M., Andriantsimahavandy A. A., Jestin V., and Servan de Almeida R., Newcastle disease virus in Madagascar: identification of an original genotype possibly deriving from a died out ancestor of genotype IV, PLoS One. (2010) 5, no. 11, e13987, https://doi.org/10.1371/journal.pone.0013987, 2-s2.0-78649751254, 21085573.
10.1371/journal.pone.0013987
PubMed Web of Science® Google Scholar
36 Munir M., Shabbir M. Z., Yaqub T., Shabbir M. A. B., Mukhtar N., Khan M. R., and Berg M., Complete genome sequence of a velogenic neurotropic avian paramyxovirus 1 isolated from peacocks (Pavo cristatus) in a wildlife park in Pakistan, Genome Announcement. (2012) 86, no. 23, 13114, https://doi.org/10.1128/JVI.02358-12, 2-s2.0-84869205696.
10.1128/JVI.02358-12
Google Scholar
37 Siddique N., Naeem K., Abbas M. A., Malik A. A., Rashid F., Rafique S., Ghafar A., and Rehman A., Sequence and phylogenetic analysis of virulent Newcastle disease virus isolates from Pakistan during 2009–2013 reveals circulation of new sub genotype, Virology. (2013) 444, no. 1–2, 37–40, https://doi.org/10.1016/j.virol.2013.05.040, 2-s2.0-84882862374, 23810483.
10.1016/j.virol.2013.05.040
CAS PubMed Web of Science® Google Scholar
38 Rehmani S. F., Wajid A., Bibi T., Nazir B., Mukhtar N., Hussain A., Lone N. A., Yaqub T., and Afonso C. L., Presence of virulent Newcastle disease virus in vaccinated chickens in farms in Pakistan, Journal of Clinical Microbiology. (2015) 53, no. 5, 1715–1718, https://doi.org/10.1128/JCM.02818-14, 2-s2.0-84928023433, 25694525.
10.1128/JCM.02818-14
PubMed Web of Science® Google Scholar
39 Rehmani S. F., Newcastle disease vaccination: a comparison of vaccines and routes of administration in Pakistan, Preventive Veterinary Medicine. (1996) 25, no. 3–4, 241–248, https://doi.org/10.1016/0167-5877(95)00487-4, 2-s2.0-0040058486.
10.1016/0167-5877(95)00487-4
Web of Science® Google Scholar
40 World Organization for Animal Health (WOAH), WOAH-Terrestrial Animal Health Code Twenty-third edition, 2014, WOAH.
Google Scholar
41 World Organization for Animal Health (WOAH), Manual of Diagnostic Tests and Vaccines for Terrestrial Animals: Mammals, Birds and Bees, 2004, Office International des Epizooties, Paris.
Google Scholar
42 OIE Terrestrial Manual, Chapter 2.3.14. Newcastle disease, Manual of diagnostic tests and vaccines for terrestrial animals, 2012, World Organization for Animal Health (OIE), Paris, 1–19.
Google Scholar
43 Pedersen J. C., Procedure for determining mean death time for Newcastle disease virus isolates, 2011, National Veterinary Services Laboratories Testing Protocol, Ames, Iowa, USA.
Google Scholar
44 Aldous E. W., Mynn J. K., Banks J., and Alexander D. J., A molecular epidemiological study of avian paramyxovirus Type 1 (Newcastle disease virus) isolates by phylogenetic analysis of a partial nucleotide sequence of the fusion protein gene, Avian Pathology. (2003) 32, no. 3, 237–255, https://doi.org/10.1080/0307945031000097831.
10.1080/0307945031000097831
Web of Science® Google Scholar
45 Tamura K., Stecher G., and Kumar S., MEGA11: molecular evolutionary genetics analysis Version 11, Molecular Biology and Evolution. (2021) 38, no. 7, 3022–3027, https://doi.org/10.1093/molbev/msab120, 33892491.
10.1093/molbev/msab120
CAS PubMed Web of Science® Google Scholar
46 Tamura K. and Nei M., Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees, Molecular Biology and Evolution. (1993) 10, no. 3, 512–526, 8336541.
10.1029/96PA03934
CAS PubMed Web of Science® Google Scholar
47 World Organization for Animal Health (WAH), Newcastle disease, Manual of standards for diagnostic tests and vaccines, 2000, 4th edition, OIE, Paris, 221–232.
Google Scholar
48 Lamb R. A. and Kolakofsky D. J. F. V., Paramyxoviridae: the viruses and their replication, Fields virology, 1996, Lippincott-Raven Press.
Web of Science® Google Scholar
49 Kattenbelt J. A., Stevens M. P., and Gould A. R., Sequence variation in the Newcastle disease virus genome, Virus Research. (2006) 116, no. 1–2, 168–184, https://doi.org/10.1016/j.virusres.2005.10.001, 2-s2.0-32344436982.
10.1016/j.virusres.2005.10.001
CAS PubMed Web of Science® Google Scholar
50 Habib-ur-Rehman N. F., Abbas G., Naheed G., Siddique B., Afzal F., Munawar J., Aurangzeb M., Atif M., Imtiaz-ul-Haq J. S., Farooq M. S., Tahir Z. A., Qamar M., Hussain A., Saleem M., Naseem M. T., and Javed M., Surveillance of poultry diseases in Punjab province, Pakistan; special reference to Newcastle disease, Research Journal for Veterinary Practitioners. (2013) 1, 1–4.
Google Scholar
51 Ballagi-Pordany A., Wehmann E., Herczeg J., Belak S., and Lomniczi B., Identification and grouping of Newcastle disease virus strains by restriction site analysis of a region from the F gene, Archives of Virology. (1996) 141, no. 2, 243–261, https://doi.org/10.1007/BF01718397, 2-s2.0-0030019118, 8634018.
10.1007/BF01718397
CAS PubMed Web of Science® Google Scholar
52 Khan T. A., Rue C. A., Rehmani S. F., Ahmed A., Wasilenko J. L., Miller P. J., and Afonso C. L., Phylogenetic and biological characterization of Newcastle disease virus isolates from Pakistan, Journal of Clinical Microbiology. (2010) 48, no. 5, 1892–1894, https://doi.org/10.1128/JCM.00148-10, 2-s2.0-77951824657, 20237105.
10.1128/JCM.00148-10
CAS PubMed Web of Science® Google Scholar
53 Bogoyavlenskiy A., Berezin V., Prilipov A., Usachev E., Lyapina O., Korotetskiy I., Zaitceva I., Asanova S., Kydyrmanov A., Daulbaeva K., Shakhvorostova L., Sayatov M., and King D., Newcastle disease outbreaks in Kazakhstan and Kyrgyzstan during 1998, 2000, 2001, 2003, 2004, and 2005 were caused by viruses of the genotypes VIIb and VIId, Virus Genes. (2009) 39, no. 1, 94–101, https://doi.org/10.1007/s11262-009-0370-1, 2-s2.0-67649491101.
10.1007/s11262-009-0370-1
CAS PubMed Web of Science® Google Scholar
54 Wang Z., Liu H., Jiangtao X., Bao J., Zheng D., Sun C., Wei R., Song C., and Chen J., Genotyping of Newcastle disease viruses isolated from 2002 to 2004 in China, Annals of the New York Academy of Sciences. (2006) 1081, no. 1, 228–239, https://doi.org/10.1196/annals.1373.027, 2-s2.0-33845693376.
10.1196/annals.1373.027
CAS PubMed Web of Science® Google Scholar
55 Snoeck C. J., Ducatez M. F., Owoade A. A., Faleke O. O., Alkali B. R., Tahita M. C., Tarnagda Z., Ouedraogo J.-B., Maikano I., Mbah P. O., Kremer J. R., and Muller C. P., Newcastle disease virus in West Africa: new virulent strains identified in non-commercial farms, Archives of Virology. (2009) 154, no. 1, 47–54, https://doi.org/10.1007/s00705-008-0269-5, 2-s2.0-58149305795, 19052688.
10.1007/s00705-008-0269-5
CAS PubMed Web of Science® Google Scholar
56 Xiao S., Paldurai A., Nayak B., Samuel A., Bharoto E. E., Prajitno T. Y., Collins P. L., and Samal S. K., Complete genome sequences of Newcastle disease virus strains circulating in chicken populations of Indonesia, Genome Announcement. (2012) 86, no. 10, 5969–5970, https://doi.org/10.1128/JVI.00546-12, 2-s2.0-84861314591.
10.1128/JVI.00546-12
CAS Google Scholar
57 Farooq M., Saliha U., Munir M., and Khan Q. M., Biological and genotypic characterization of the Newcastle disease virus isolated from disease outbreaks in commercial poultry farms in northern Punjab, Pakistan, Virology Reports. (2014) 3-4, 30–39, https://doi.org/10.1016/j.virep.2014.10.002, 2-s2.0-84919327083.
10.1016/j.virep.2014.10.002
Google Scholar
58 Miller P. J., Haddas R., Simanov L., Lublin A., Rehmani S. F., Wajid A., Bibi T., Khan T. A., Yaqub T., Setiyaningsih S., and Afonso C. L., Identification of new sub-genotypes of virulent Newcastle disease virus with potential panzootic features, Infection, Genetics and Evolution. (2015) 29, 216–229, https://doi.org/10.1016/j.meegid.2014.10.032, 2-s2.0-84917710744, 25445644.
10.1016/j.meegid.2014.10.032
PubMed Web of Science® Google Scholar
59 Umar S., Retracted article: emergence of new sub-genotypes of Newcastle disease virus in Pakistan, World′s Poultry Science Journal. (2017) 73, no. 3, 567–580, https://doi.org/10.1017/S0043933917000411, 2-s2.0-85021795797.
10.1017/S0043933917000411
Google Scholar
60 WWF, Detail ecological assisment of fauna including limnology studies at Khanjar Lake, 2008, WWF Report.
Google Scholar
61 WWF, Ecological assessment of fauna at Manchhar Lake, District Dadu, Sindh Baseline Survey 2010 – 2011, 2011, WWF Survey.
Google Scholar
62 Begum A., Zubair A., Hussain S. E., and Khan A. R., Water birds diversity and conservation at hub dam Lasbella, Karachi, Pakistan, African Journal of Science and Research. (2013) 2, no. 3, 22–26.
Google Scholar
63 Ghalib S. A., Zaheer Khan M., Ahmed S. M., Begum A., Hussain B., and Ahmed W., Study of the wildlife of Jhimpir wind corridor, district Thatta, Sindh and development of bird monitoring strategy in the area, African Journal of Science and Research. (2014) 3, no. 6, 1–9.
Google Scholar
64 Radwan M. M., Darwish S. F., El-Sabagh I. M., El-Sanousi A. A., and Shalaby M. A., Isolation and molecular characterization of Newcastle disease virus genotypes II and VIId in Egypt between 2011 and 2012, Virus Genes. (2013) 47, no. 2, 311–316, https://doi.org/10.1007/s11262-013-0950-y, 2-s2.0-84885374387, 23842723.
10.1007/s11262-013-0950-y
CAS PubMed Web of Science® Google Scholar
65 Gaurav S., Deka P., Das S., Deka P., Hazarika R., Kakati P., Kumar A., and Kumar S., Isolation of genotype VII avian orthoavulavirus serotype 1 from barn owl from Northeast India, Avian Pathology. (2022) 51, no. 1, 45–50, https://doi.org/10.1080/03079457.2021.1999388, 34709097.
10.1080/03079457.2021.1999388
CAS PubMed Web of Science® Google Scholar
66 Alexander D. J., Aldous E. W., and Fuller C. M., The long view: a selective review of 40 years of Newcastle disease research, Avian Pathology. (2012) 41, no. 4, 329–335, https://doi.org/10.1080/03079457.2012.697991, 2-s2.0-84867867776, 22834545.
10.1080/03079457.2012.697991
PubMed Web of Science® Google Scholar
67 Susta L., Jones M. E. B., Cattoli G., Cardenas-Garcia S., Miller P. J., Brown C. C., and Afonso C. L., Pathologic characterization of genotypes XIV and XVII Newcastle disease viruses and efficacy of classical vaccination on specific pathogen-free birds, Veterinary Pathology. (2015) 52, no. 1, 120–131, https://doi.org/10.1177/0300985814521247, 2-s2.0-84919973538, 24510948.
10.1177/0300985814521247
CAS PubMed Web of Science® Google Scholar
68 Perozo F., Marcano R., and Afonso C. L., Biological and phylogenetic characterization of a genotype VII Newcastle disease virus from Venezuela: efficacy of field vaccination, Journal of Clinical Microbiology. (2012) 50, no. 4, 1204–1208, https://doi.org/10.1128/JCM.06506-11, 2-s2.0-84858591275, 22238433.
10.1128/JCM.06506-11
PubMed Web of Science® Google Scholar
69 Miller P. J., Mia Kim L., Ip H. S., and Afonso C. L., Evolutionary dynamics of Newcastle disease virus, Virology. (2009) 391, no. 1, 64–72, https://doi.org/10.1016/j.virol.2009.05.033, 2-s2.0-67650725425.
10.1016/j.virol.2009.05.033
CAS PubMed Web of Science® Google Scholar
70 Diel D. G., Susta L., Garcia S. C., Killian M. L., Brown C. C., Miller P. J., and Afonso C. L., Complete genome and clinicopathological characterization of a virulent Newcastle disease virus isolate from South America, Journal of Clinical Microbiology. (2012) 50, no. 2, 378–387, https://doi.org/10.1128/JCM.06018-11, 2-s2.0-84856152239, 22135263.
10.1128/JCM.06018-11
CAS PubMed Web of Science® Google Scholar
71 Cho S.-H., Kim S.-J., and Kwon H.-J., Genomic sequence of an antigenic variant Newcastle disease virus isolated in Korea, Virus Genes. (2007) 35, no. 2, 293–302, https://doi.org/10.1007/s11262-007-0078-z, 2-s2.0-34447649070, 17318427.
10.1007/s11262-007-0078-z
CAS PubMed Web of Science® Google Scholar
72 Choi K.-S., Kye S.-J., Kim J.-Y., To T. L., Nguyen D. T., Lee Y.-J., Choi J.-G., Kang H.-M., Kim K.-I., Song B.-M., and Lee H.-S., Molecular epidemiology of Newcastle disease viruses in Vietnam, Tropical Animal Health and Production. (2014) 46, no. 1, 271–277, https://doi.org/10.1007/s11250-013-0475-3, 2-s2.0-84898636793, 24061688.
10.1007/s11250-013-0475-3
PubMed Web of Science® Google Scholar
73 Naggar E., Rania F., Rohaim M. A., Bazid A. H. H., Ahmed K. A., Hussein H. A., and Munir M., Biological characterization of wild-bird-origin avian avulavirus 1 and efficacy of currently applied vaccines against potential infection in commercial poultry, Archives of Virology. (2018) 163, no. 10, 2743–2755, https://doi.org/10.1007/s00705-018-3916-5, 2-s2.0-85048825236, 29922856.
10.1007/s00705-018-3916-5
PubMed Google Scholar
74 Miller P. J., King D. J., Afonso C. L., and Suarez D. L., Antigenic differences among Newcastle disease virus strains of different genotypes used in vaccine formulation affect viral shedding after a virulent challenge, Vaccine. (2007) 25, no. 41, 7238–7246, https://doi.org/10.1016/j.vaccine.2007.07.017, 2-s2.0-34648846704, 17719150.
10.1016/j.vaccine.2007.07.017
CAS PubMed Web of Science® Google Scholar
75 Miller P. J., Afonso C. L., El Attrache J., Dorsey K. M., Courtney S. C., Guo Z., and Kapczynski D. R., Effects of Newcastle disease virus vaccine antibodies on the shedding and transmission of challenge viruses, Developmental & Comparative Immunology. (2013) 41, no. 4, 505–513, https://doi.org/10.1016/j.dci.2013.06.007, 2-s2.0-84883808132.
10.1016/j.dci.2013.06.007
CAS PubMed Web of Science® Google Scholar
76 Liu J., Zhu J., Xu H., Li J., Hu Z., Hu S., Wang X., and Liu X., Effects of the HN antigenic difference between the vaccine strain and the challenge strain of Newcastle disease virus on virus shedding and transmission, Viruses. (2017) 9, no. 8, https://doi.org/10.3390/v9080225, 2-s2.0-85027501691, 28809802.
10.3390/v9080225
PubMed Google Scholar
77 Shahar E., Haddas R., Goldenberg D., Lublin A., Bloch I., Hinenzon N. B., and Pitcovski J., Newcastle disease virus: is an updated attenuated vaccine needed?, Avian Pathology. (2018) 47, no. 5, 467–478, https://doi.org/10.1080/03079457.2018.1488240, 2-s2.0-85049584152, 29897786.
10.1080/03079457.2018.1488240
CAS PubMed Google Scholar
78 Kapczynski D. R., Afonso C. L., and Miller P. J., Immune responses of poultry to Newcastle disease virus, Developmental & Comparative Immunology. (2013) 41, no. 3, 447–453, https://doi.org/10.1016/j.dci.2013.04.012, 2-s2.0-84883054704.
10.1016/j.dci.2013.04.012
CAS PubMed Web of Science® Google Scholar
79 Ji Y., Liu T., du Y., Cui X., Yu Q., Wang Z., Zhang J., Li Y., and Zhu Q., A novel genotype VII Newcastle disease virus vaccine candidate generated by mutation in the L and F genes confers improved protection in chickens, Veterinary Microbiology. (2018) 216, 99–106, https://doi.org/10.1016/j.vetmic.2018.01.021, 2-s2.0-85041799652, 29519533.
10.1016/j.vetmic.2018.01.021
CAS PubMed Web of Science® Google Scholar
80 Ayoub M. A., Elfeil W. K., El Boraey D., Hammam H., and Nossair M. A., Evaluation of some vaccination programs in protection of experimentally challenged broiler chicken against Newcastle disease virus, American Journal of Animal and Veterinary Sciences. (2019) 14, no. 3, 197–206, https://doi.org/10.3844/ajavsp.2019.197.206, 2-s2.0-85073720579.
10.3844/ajavsp.2019.197.206
Google Scholar
81 WOAH Terrestrial Manual, Chapter 3.3.14. – Newcastle disease (infection with Newcastle disease virus), 2021, Newcastle Disease (Infection With Newcastle Disease Virus).
Google Scholar
82 Alexander D. J., Saif Y. M., Barnes H. J., Fadly A. M., Glisson J. R., McDougald L. R., and Swayne D. E., Diseases of poultry chapter (Newcastle disease, other avian paramyxoviruses, and pneumovirus infections), 2003, Iowa State University Press, Ames, Iowa, https://doi.org/10.1111/1750-3841.12436, 2-s2.0-84899980975.
Google Scholar
83 Ji Y., Liu T., Jia Y., Liu B., Qingzhong Y., Cui X., Guo F., Chang H., and Zhu Q., Two single mutations in the fusion protein of Newcastle disease virus confer hemagglutinin-neuraminidase independent fusion promotion and attenuate the pathogenicity in chickens, Virology. (2017) 509, 146–151, https://doi.org/10.1016/j.virol.2017.06.021, 2-s2.0-85021117256, 28646649.
10.1016/j.virol.2017.06.021
CAS PubMed Web of Science® Google Scholar
84 Cho S.-H., Kwon H.-J., Kim T.-E., Kim J.-H., Yoo H.-S., Park M.-H., Park Y.-H., and Kim S.-J., Characterization of a recombinant Newcastle disease virus vaccine strain, Clinical and Vaccine Immunology. (2008) 15, no. 10, 1572–1579, https://doi.org/10.1128/CVI.00156-08, 2-s2.0-55449097019, 18768673.
10.1128/CVI.00156-08
CAS PubMed Web of Science® Google Scholar

All articles

Molecular Characterization and Phylogenetic Analysis of Velogenic NDV Genotype VII Isolated From an Outbreak in Genotype II-Vaccinated Poultry Flocks of the Southern Region of Pakistan

Abstract

1. Introduction

2. Materials and Method

2.1. Study Area

2.2. Collection of Samples

2.3. Blood Sample Collection

2.4. Necroscopy and Collection of Tissue Sample

2.5. Virus Isolation From Tissue Samples

2.5.1. Virus Isolation by Embryonated Eggs

2.5.2. Virus Titration by Heamagglutination (HA) Reaction

2.6. Serological Detection of NDV

2.6.1. Detection of NDV Exposure by ELISA

2.6.1.1. ELISA Procedure

2.7. Biological Characterization

2.7.1. Intracerebral Pathogenicity Index (ICPI) Assessment

2.7.2. Mean Death Time (MDT) of the Minimum Lethal Dose (MLD)

2.8. Molecular Detection

2.8.1. RNA Extraction

2.8.2. RT-PCR

2.8.2.1. RT-PCR Reaction Mixture

2.8.2.2. RT-PCR Conditions

2.9. Molecular Characterization

2.9.1. Nucleotide Sequencing

2.9.2. Phylogenetic Analysis

2.9.3. Determination of Amino Acid Sequence at Cleavage Site of Fusion Protein

3. Results

3.1. Clinical Findings

3.2. Postmortem Findings

3.3. Serological Detection of NDV Infection

3.3.1. ELISA Titer Greater Than the Limit of Vaccine Titer

3.3.2. Detection of Higher ELISA Titer in the Affected Flock

3.4. Molecular Diagnosis

3.4.1. Molecular Diagnosis of NDV by RT-PCR

3.4.2. Prevalence of NDV Detected by RT-PCR

3.4.3. Phylogenetic Analysis of NDV Based on Fusion Gene

3.5. Pathotyping of NDV

3.5.1. Detection of Biological Factors Involve in Pathogenicity

3.5.2. Detection of Molecular Factors Involved in Pathogenicity

3.6. Amino Acid Substitution in Fusion Protein

3.7. Distribution of NDV Genotypes in the South Region

4. Discussion

Conflicts of Interest

Funding

Open Research

Data Availability Statement

References

Figures

References

Related

Information