Characterization of 18 polymorphic microsatellite loci in the red-crowned crane (Grus japonensis), an endangered bird

The red-crowned crane is the second rarest crane species in the world, with a total population of approximately 2000 birds in the wild (Archibald 2000). Its status is considered to be endangered by the International Union for Conservation of Nature (IUCN). Due to the crane's rarity, it was also included in the Red List of Threatened Species (IUCN 1994). Therefore, all countries within its range were required to pass legislation for protecting this species.

At present, the migratory continental population of cranes is thought to be declining because of habitat loss in breeding grounds in north-east China and far eastern Russian and in the wintering grounds on the Korean peninsula and the east coast of China. Improved protection at these locations, including the work of the Northeast Asia Crane Site Network is essential for species survival. An action plan involving the major range countries has resulted in a coordinated action. A world standard for genetic information is needed for the same area. Microsatellites are powerful molecular markers that are used in population genetic studies and are likely candidates for developing such a protocol.

To date, only seven microsatellites have been isolated from the genome of red-crowned cranes and validated for population analysis (Hasegawa et al. 2000). However, such low numbers of microsatellites are not sufficient for genetic analysis, especially for establishing a standard molecular analytical protocol for the red-crowned crane population. Twelve microsatellites were isolated from the genome of red-crowned cranes and six loci isolated from the blue crane (Grus paradisea) were tested (Meares et al. 2008). All 18 loci were characterized by using samples from a wild and a semi-free population in Zhalong National Natural Reserve, China. Our results demonstrate that every combination of the 18 loci is effective for population genetic analysis.

Genomic DNA was isolated from blood samples obtained from cranes captured in the Zhalong Nature Reserve in China using a standard proteinase K-phenol-chloroform extraction protocol. Genomic DNA was digested initially with Mbo I (Promega, Madison, WI, USA). The digested DNA was separated by sucrose-density-gradient centrifugation. DNA fragments of 300–1000 bp in length were isolated from the sucrose solution and ligated to adaptors (A: 5′GATCGTCGACGGTACCGAATTCT3′ and B: 5′ GTCAAGAATTCGGTACCGTCGAC3′). The ligated products were used as templates for the first round of PCR using B as a primer. PCR products were hybridized to biotinylated (CAG) n (CA) n, and probes attached to streptavidin-coated magnetic beads (Dynal Biotech ASA, Oslo, Norway) according to Chang et al. (2005). Enriched fragments were used as templates for the second round of PCR, and products were ligated into plasmid vector, pMD-18, using T4 DNA ligase (TaKaRa, Dalian, China). The recombinant plasmid was transformed into competent Escherichia coli, DH5α. The enriched library was screened again by hybridization with ³²P-labelled probes (Chang et al. 2005).

Of 1856 colonies screened, 456 gave positive signals after hybridization, and 200 positive clones were sequenced. Approximately 75 sequences were found to contain microsatellites. Finally, 28 locus-specific primers were designed using Primer3 software (Rozen & Skaletsky 2000). Furthermore, 14 previously published microsatellite primer pairs from other crane species were also tested (Meares et al. 2008).

PCR was carried out in a 25 µL volume containing 1 × PCR buffer (10 mmol/L Tris-HCl pH 8.3, 50 mmol/L KCl, 2.0 mmol/L MgCl₂ and 0.01% gelatin), 200 µmol/L of each dNTP (TaKaRa, Dalian, China), 0.1 mmol/L of each primer, approximately 35 ng of genomic DNA and 0.75 U Taq polymerase (TaKaRa, Dalian, China). Amplifications were performed in a PerkinElmer 9600 thermal cycler using the following cycling program: 94°C for 3 min, 30 cycles of 94°C for 30 s, primer-specific annealing at 55–68°C for 30 s (Table 1), 72°C for 30 s, and a final step of 72°C for 10 min. Touchdown PCR was used for some of the primers (Table 1). The Touchdown PCR program used was 94°C for 3 min, two cycles of 94°C for 30 s, highest Ta decreasing in 2°C decrements per cycle, 72°C for 30 s, followed by 26 cycles of 94°C for 30 s, lowest Ta for 30 s, 72°C for 30 s, and completing the profile with an extension at 72°C for 10 min.

Of the 28 new primers designed for the red-crowned crane, 20 successfully amplified the target regions, and 12 of displayed polymorphisms (Table 1). For those previously published microsatellite markers, 10 of 14 succeeded in amplifying and 6 showed polymorphisms (Table 1). Thus, we obtained 18 polymorphic markers in total, and the upper stream primer of each locus was labeled with either carboxy-fluorescein (FAM) or tetramethyl-6-carboxyrhodamine (TAMRA) fluorescent dye. PCR products were separated by electrophoresis on an ABI 3730 DNA Analyzer (Applied Biosystems, Foster City, CA, USA).

To characterize the microsatellites, 11 feather pulp samples and 15 eggshells (after artificial hatching) were collected from the red-crowned crane's largest and key breeding ground: Zhalong National Nature Reserve, China. Six feather samples and three eggshells were collected from the wild population, and the remaining samples were taken from a semi-free population. These samples included feathers from wild rescued individuals and semi-free birds, and eggshells were obtained from the same populations. Due to the high gene flow between the wild and semi-free birds in our field research, these two populations were considered to be homogeneous (details to be published separately).

DNA was extracted from the feather pulp or eggshells (after artificial hatching) using a routine phenol chloroform method. PCR amplification and genotyping were performed according to the same procedure described above. Standard population genetic parameters of the new set of loci, including the number of alleles per locus (A) the expected (H_E) and observed (H_O) heterozygosity, polymorphic information content (PIC), and exclusion probability (PE-1, PE-2), were estimated using the program CERVUS 3.0 (Kalinowski et al. 2007). All loci conformed to Hardy–Weinberg Equilibrium using exact tests in Genepop (Raymond & Rousset 1995).

Results showed that the number of alleles ranged from 3 to 13, whereas the observed and expected heterozygosities ranged from 0.462 to 1.000 and from 0.483 to 0.884, respectively. The marker suite averaged 6.390 alleles per locus with an average polymorphic information content of 0.631. Three loci, Gj3108, Gj1385 and Gpa33, presented deviations from Hardy–Weinberg Equilibrium (P < 0.05) (Table 2). This difference was probably due to sample bias (cranes scattered across only one breeding site) and founder relatedness in the semi-free population.