Cyclophilin A and Nuclear Factor of Activated T Cells Are Essential in Cyclosporine-Mediated Suppression of Polyomavirus BK Replication

Materials and cell culture

Mouse anti-SV40 TAg antibody, which can also recognize BKV TAg, was purchased from Calbiochem (La Jolla, CA, USA). Anti-BKV VP1 antibody was the gift of Abnova Co. (Taipei, Taiwan). Antiflag antibody and CsA were purchased from Sigma (Sigma Chemical Company Ltd., Poole, UK). CypA, CypB and NFATc3 siRNA were obtained from Dharmacon Inc. (Lafayette, CO, USA). Goat anti-NFATc3 antibody was purchased from R&D Systems (Minneapolis, MN, USA) and rabbit anti-NFATc4 antibodies were purchased from Santa Cruz Biotech, Inc. (Santa Cruz, CA, USA).

Immortalized human renal proximal tubular cells, HK-2, were cultured as described previously (23).

Flag-epitope (DYKDDDDK) cDNA was attached to the full-length coding sequences of CypA, CypB, NFATc3 and NFATc4, which are obtained by qPCR from human genomic DNA using the standard technique (24).

Real-time quantitative polymerase chain reaction (qPCR)

qPCR was performed as described previously (25). Briefly, total RNA was isolated from cells and reverse-transcribed to DNA. qPCR was performed according to the manufacturer's instructions using an ABI-Prism 7700 with SYBR Green I (PE-Applied Biosystems, Cheshire, UK, Britain). Primers used to assay BKV TAg and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcript levels (BKV TAg: 5-CTGTCCCTAAAACCCTGCAA-3 and 5- GCCTTTCCTTCCATTCAACA -3; GAPDH: 5-TTCCAGGAGCGAGATCCCT-3 and 3-CACCCATGACGAACATGGG-5) were constructed to be compatible with a single reverse transcription-PCR thermal profile (95°C for 10 min, 40 cycles of 95°C for 30 s and 60°C for 1 min). Experimental results are presented as the transcript level of the analyzed genes relative to GAPDH transcript level.

To determine viral load, BKV and cellular DNA were extracted from cell lysate using a QIAamp® DNA Mini Kit (Qiagen, Hilden, Germany). qPCR was performed as described above. The BKV DNA was normalized by analyzing samples in parallel by the quantitative PCR for the cellular tubulin β2A DNA using the commercial primers and probes (Hs00742533_s1*, probe: GTCCTCAAGCATGGTCTTTCTACTT; Applied Biosystems).

Gene silencing by short interfering RNA (siRNA)

RNA interference was used to reduce CypA, CypB and NFATc3 expressions. Briefly, 0.5–1.5 μg of siRNA against CypA, CypB, NFATc3 or control siRNA was diluted in the serum-free medium to give a final volume of 100 μL. Subsequently, RNAiFectI transfection reagent was mixed with diluted siRNA at ratio from 6:1 to 3:1. Following incubation for 15 min at room temperature, the mixture was added to the culture medium.

Luciferase assay

The NCCR of the BKV and BKV TAg were constructed as described previously (14). The BKV NCCR in early and late orientation was used in this study. Luciferase assays utilized the Dual-Luciferase Report Assay (Promega, Madison, WI, USA) applied according to the manufacturer's recommendations. Luciferase activity was measured using a luminometer (MLX micro titer plate luminometer, Dynex Ltd., Chantilly, VA, USA) and examined on duplicates of each sample. Experimental results were presented as firefly luciferase activity normalized to Renilla luciferase activity.

Western blot analysis

Total cellular protein extraction was performed as described previously (26). Protein samples mixed with reducing SDS sample buffer were resolved on a 10% SDS-PAGE and then electroblotted. Nonspecific binding was blocked with a 5% nonfat milk solution. The membrane was then incubated with primary antibody overnight at 4°C followed by incubation with a horseradish peroxidase (HRP) conjugated secondary antibody. Proteins were visualized using enhanced chemiluminescence (Amersham Biosciences, Amersham, UK). Protein bands of Western blot analysis were quantified using Quantity One software (BioRad). The density of each protein band was normalized with that of tubulin.

Chromatin immunoprecipitation

DNA was cross-linked with 1% formaldehyde at 37°C for 10 min and cells were then resuspended in a SDS lysis buffer. Cell lysate was sonicated and supernatants were diluted 10-fold in a ChIP diluation buffer and precleared with salmon sperm DNA/protein A agarose 50% slurry (Millipore, Billerica, MA, USA). Following brief centrifugation, the supernatant fraction was immunoprecipitated with rabbit anti-NFATc3 or anti-NFATc4 overnight. After the addition of protein A agarose slurry, samples were incubated for 1 h at 4°C. Pellet agarose was washed once with wash buffer I (Millipore, Billerica, USA) and buffer II (Millipore, Billerica, MA, USA). DNA was eluted in 1% SDS, 0.1 M NaHCO3 at room temperature for 1 h. Following proteinase K digestion, DNA was recovered with phenol/chloroform extraction and ethanol precipitation. After the addition of glycogen, DNA was amplified by qPCR using SYBR Green Master Mix as described above. Primers were designed for the BKV NCCR as follows: forward 5′-GCAAAAATTGCAAAAGAATAGG-3′ and reverse 5′-TTCCAGTCCAGGTTTTACCAA-3′.

Electrophoretic mobility shift assay

Electrophoretic mobility shift assay (EMSA) was employed for the analysis of NCCR DNA binding ability by the purified recombinant NFATc3 and NFATc4 protein. Briefly, the pGEX vector for expression in BL21 (DE3) Escherichia coli (Merck) was used to produce the GST-tagged recombinant proteins. Proteins were over-expressed through induction with 0.2 mM Isopropyl β-D-1-thiogalactopyranoside (IPTG) at 16°C for 10 h. Both of the recombinant NFATc3 and NFATc4 were purified through affinity chromatography. For NFAT-DNA binding followed by EMSA, essentially a 20 μL reaction comprised of purified protein, ³²p-labelled double-stranded DNA (BKV NCCR) and 125 μg/uL poly dI-dC buffered in 12 mM HEPES pH 7.8, 75 mM KCl, 1 mM EDTA, 4 mM GTP and 12.5% glycerol was incubated at room temperature for 1 h. The protein–DNA mixtures were subsequently loaded onto a 6% DNA Retardation Gel (Invitrogen) alongside “no protein” and “no DNA” controls, and migrated in a 0.5 × TBE running buffer for 1.5 h. Competition experiments were performed with 100-fold excess of the respective unlabelled probes.

Viral progeny

Viral progeny is measured as described by Moriyama et al. (27). Briefly, infected cells were extracted and lysates were undiluted or diluted to 1: 10 or 1:100 and then seeded on cells in 8-well chamber slides for 72 h. Cells were then fixed with 3% paraformaldehyde and permeabilized with 0.2% Triton in PBS. Subsequently, cells were incubated with the mouse anti-SV40 TAg antibody overnight and then incubated with FITC-conjugated antibody at for 1 h. Slides were finally mounted using the Vectashield mounting medium (Vector Laboratories) containing 4′,6′-diamidino-2-phenylindole (dapi) (Molecular Probes, California, USA) to stain nuclei. The fluorescence-forming unit was calculated according to the protocol (27).

Immunohistochemistry

Under permission of the ethics committee of our hospital, residual renal biopsy specimens obtained from 2 PVAN patients were analyzed for deposition of NFATc3 and TAg expressions. Normal tissue away from the edge of renal cell carcinoma (RCC) obtained from one RCC patient undergoing nephrectomy was used as a negative control. Kidney specimens were fixed with 4% paraformaldehyde and embedded in paraffin. Following deparaffinization, sections were then immersed in 3% H₂O₂ in methanol and blocked with 5% bovine albumin/PBS for 20 min. Following incubation with anti-NFATc3 or anti-SV40 TAg for 1 h, sections were treated with relevant biotin-conjugated antibodies and the NFATc3 or TAg immunostaining was then displayed using a Vectastain ABC kit (Vector Laboratories).

Statistical analysis

All the data were presented as means ± SEM. Statistical analysis was performed using the unpaired Student's t-test. A value of p<0.05 was considered to represent a significant difference.

Inhibition of CypA but not CypB expression reduced BKV replication

To determine whether CypA is required in BKV (TU strain) replication, endogenous CypA expression was knocked down by gene silencing. Inhibition of CypA expression by CypA siRNA was confirmed by Western blot analysis which showed a significant decrease in CypA protein expression (Figure 1A). Blockade of CypA expression led to a reduction in BKV TAg expression (Figure 1A). Similarly, inhibition of CypA expression resulted in a decrease in the level of TAg transcripts as determined by qPCR (Figure 1B).

To assess whether CypA knockdown-mediated inhibition of BKV replication could be rescued by reintroduction of CypA into cells, endogenous CypA expression was suppressed using CypA siRNA followed by CypA overexpression. Following inhibition of CypA expression, BKV TAg expression was suppressed while BKV TAg expression was enhanced after the reintroduction of CypA into cells (Figure 2A). Similarly, the results of qPCR also confirmed that the reintroduction of CypA into cells led to an increase in the level of TAg transcripts (Figure 2B) and viral load (Figure 2C). To measure the infectious progeny, viral lysates were collected at the end of the experiments and seeded on the new cells for 72 h. The result confirmed that knockdown of CypA reduced BKV load and the reintroduction of exogenous CypA restored this inhibition (Figure 2D).

In addition to CypA, it has been reported that CypB is also required for viral replication (28, 29). To establish whether CypB participates in BKV replication, endogenous CypB expression was inhibited by CypB siRNA. Western blot analysis showed that, in contrast to CypA, knockdown of CypB slightly increased BKV TAg expression (Figure 3A). Similarly, inhibition of CypB expression slightly enhanced the level of TAg transcripts (Figure 3B) and viral load (Figure 3C). These results suggest an indispensable role of CypA but not CypB in BKV replication.

CypA overexpression attenuated CsA-mediated suppression of BKV replication

To assess whether CypA is crucial in CsA-mediated inhibition of BKV replication, cells were transfected with the CypA-expressing plasmids followed by administration of CsA for 72 h. In accordance with our previous study (14), administration of CsA (1 μg/mL) resulted in a reduction in BKV TAg expression. Importantly, overexpression of CypA significantly attenuated CsA-mediated inhibition in BKV TAg expression compared with transfection of the control vector (Figure 4). At high CypA expression levels, CypA overexpression even surpassed the CsA-mediated inhibitory effect and led to a significant enhancement in BKV TAg expression.

NFAT is crucial for BKV replication

Since NFAT is a major downstream transcription factor of the cyclophilin/calcineurin complex (30), we therefore assessed whether NFAT plays a role in BKV replication. Results demonstrated that NFATc3 and NFATc4 were prominently expressed in HK-2 cells, whereas NFATc1 and NFATc2 were weakly detected in cells (data not shown). To clarify the effect of NFATc3 and NFATc4 on BKV replication, NFATc3 or NFATc4 was overexpressed overnight, followed by addition of BKV to cells. The result demonstrated that overexpression of NFATc3 enhanced BKV TAg expression (Figure 5A). Similarly, NFATc4 overexpression also facilitated BKV TAg expression (Figure 5B). These results indicate that there is a stimulatory effect of NFATc3 and NFATc4 on BKV replication.

BKV NCCR is the main regulatory region of BKV replication. To assess whether NFAT can regulate BKV NCCR, plasmids expressing NFATc3 or NFATc4 and the BKV NCCR luciferase reporter in early or late orientation were cotransfected in cells. NFATc3 or NFATc4 overexpression led to an increase in promoter activity of the BKV NCCR luciferase reporter in early orientation, reaching a 2.9- or 3.4-fold increase respectively when compared with that of the mock transfection (Figure 5C). Similarly, the activity of the late NCCR promoter reporter was increased 2.5- or 2.7-fold, respectively, by NFATc3 or NFATc4 overexpression (Figure 5D).

To assess whether NFAT can bind to the BKV promoter, cells were transfected with the plasmids expressing BKV NCCR (Figure 6A) or infected with BKV (Figure 6B) for 48 h and chromatin was then immunoprecipitated with anti-NFATc3 or anti-NFATc4 antibody followed by qPCR to quantify the binding of the viral promoter to NFATc3 or NFATc4. Results of the ChIP assay demonstrated that the levels of the BKV promoter DNA binding to NFATc3 and NFATc4 were increased 2.1- and 1.9-fold, respectively, by transfection with the plasmids expressing BKV NCCR or increased 1.6- and 1.5-fold respectively by BKV infection when compared to that of the DNA immunoprecipitated with a nonspecific IgG antibody (Figures 6A and B). To support the results of the ChIP assay, we performed EMSA by in vitro mixture of recombinant NFATc3 or NFATc4 proteins and ³²p-labelled double-stranded DNA (BKV NCCR) prior to gel shift analysis. Results clearly demonstrated an increase in binding of NFATc3- (Figure 6C) and NFATc4 (Figure 6D) with BKV NCCR.

To further verify the role of NFAT in BKV replication, NFATc3 expression was suppressed by NFATc3 siRNA and cells were then infected with BKV. Western blot analysis showed that knockdown of NFATc3 expression reduced BKV TAg expressions (Figure 7A). Similarly, knockdown of NFATc3 by siRNA also reduced the promoter activity of the BKV NCCR luciferase reporter (Figure 7B). These data confirm that NFAT are essential for BKV replication.

CsA-mediated inhibition of BKV replication was rescued by NFAT overexpression

CsA inhibits calcineurin activity and causes NFAT phosphorylation that inactivates NFATs and prevents subsequent nuclear translocation to trigger transcription of target genes in immune cells (31). To appreciate whether CsA can cause NFATc3 phosphorylation and then inactivate NFATc3 in HK-2 cells, CsA was added to HK-2 cells for 24 h. NIM811, a CsA derivative, which cannot inhibit calcineurin activity and cause NFAT activation, was used as a control. The results revealed that the administration of CsA led to slow migration of NFATc3, indicating phosphorylation and inactivation of NFATc3 activity by CsA (Figure 8A). In contrast, the addition of NIM811 did not result in slow migration of NFATc3, implying the lack of an inhibitory effect on NFATc3 activity. Interestingly, while CsA suppressed BKV TAg expression, NIM811 did not alter BKV TAg expression (Figure 8A). This result suggests that NFATc3 activity is implicated in CsA-mediated suppression of BKV replication.

To verify the crucial role of NFATc3 in CsA-imposed suppression of BKV replication, NFATc3 was overexpressed in the presence of CsA. Western blot analysis showed that NFATc3 or NFATc4 overexpression diminished the inhibitory effect of CsA on BKV TAg expressions, while overexpression of the control vector did not reverse CsA-mediated inhibition of BKV TAg expression (Figures 8B and C) and viral load (Figure 8D). In addition, NFATc3 or NFATc4 overexpression even surpassed the CsA-induced reduction in the BKV early promoter activity (Figure 8E). These results suggest that NFAT is essential mediators in CsA-mediated suppression of BKV replication.

NFAT expression is increased in PVAN

Since NFAT is crucial for BKV replication, NFATc3/NFATc4 expression in renal biopsy specimen obtained from two patients with PVAN was assessed. Results of immunohistochemistry revealed that NFATc3/NFATc4 staining was prominently increased in the cytoplasm and nuclei of renal tubules and interstitial lymphocytes in the kidney of PVAN (Figures 9B and F; NFATc4 staining: not shown) when compared with that of the normal control (Figures 9A and E). PVAN was confirmed as BKV TAg expression was detected in the tubules (Figures 9D and G).