The susceptibility to vitiligo is associated with NF-E2-related factor2 (Nrf2) gene polymorphisms: a study on Chinese Han population
Abstract
Abstract: Vitiligo is an acquired pigmentary disorder and its pathogenesis remains unclear. Oxidative stress is considered to be the initial pathogenic event in the melanocyte destruction. NF-E2-related factor2 (Nrf2) is a transcription factor regulating the expression of detoxifying and antioxidant genes. To investigate the association of the Nrf2 gene promoter polymorphisms with vitiligo in Chinese Han population, the genotypes of –686A/G, –684G/A and –650C/A and the genotyping of variable number of tandem repeat were detected. The data were analysed by the chi-square test and the risk was evaluated by calculating OR and 95% CI. There was statistically significant difference in genotypic and allelic frequencies of –650C/A between the two groups (P < 0.05). A−650 allele was significantly associated with the risk for vitiligo (OR = 1.724, χ2 = 18.096). Polymorphism of the Nrf2 gene promoter at –650C/A was associated with the development of vitiligo and A−650 allele may be one of the risk factors.
Background
Vitiligo is an acquired hypomelanotic disorder characterized by depigmented macules of the skin resulting from the loss of functional melanocytes. The pathogenesis of the disease remains unclear. Some results supported the genetic hypothesis (1,2), but recently the growing evidence has supported oxidative stress (3–6). NF-E2-related factor2 (Nrf2) belongs to the CNC family of transcription factors harbouring a characteristic basic-leucine zipper (b-Zip) motif and is essential for the basal and inducible expression of a battery of detoxifying genes [such as heme oxygenase 1 (HO-1), NAD(P)H-quinone oxidoreductase (NQO1)] and antioxidant enzyme/protein genes [such as GST, superoxide dismutase 3 (SOD3), peroxiredoxin 1 (PDX1)] (7–11). Susceptibility to hyperoxia turned out to be tightly linked to the Nrf2 locus (12). Nrf2-null mutant mice were found to be highly susceptible to hyperoxic lung injury (11). Available evidence indicates that the activation of Nrf2 is an important clue for the inducible expression of cytoprotective genes (13–17). Three single nucleotide polymorphisms (SNPs) (–650C/A, –684G/A, –686A/G) and one triplet repeat polymorphism (ccg) had been identified in the promoter region of the Nrf2 gene (18). Moreover, Marzec et al. reported that the –617 A SNP had a significantly higher risk for the developing acute lung injury (ALI) after major trauma (19).
Questions addressed
Therefore, it is worth notice that Nrf2 dysfunction maybe one of the important prerequisites for the development of a certain group of diseases, especially those related to oxidative stress, such as vitiligo. Up to now, many reports on the antioxidants or antioxidant enzymes were obtained in vitiligo, but there is no study on the Nrf2, an upstream regulator of antioxidant system, in vitiligo, though the polymorphisms in other diseases had been identified. In this study, we have examined polymorphisms of the Nrf2 gene to explore the association between the Nrf2 gene polymorphisms and the susceptibility to vitiligo in Han Chinese.
Experimental design
Three hundred patients without other autoimmune disease were randomly selected into the study. The subjects composed of 135 males and 165 females, whose mean onset ages were 24.2 ± 11.5 and 30.3 ± 12.9 years (range 18–58) respectively. There were of 60 localized, 159 sporadic, 15 generalized, 33 acromelic and 13 segmented cases. Three hundred healthy cases of Han Chinese without history of autoimmune diseases were served as controls (120 males, 180 females), the mean age 34.6 ± 11.42 years (ranged 18–58), matched with the sex and ages of the patients with vitiligo. All the cases studied had no family history of vitiligo (Table S1). The study was approved by the local ethics review committee and all subjects gave informed consent. Three SNPs and one variable number of tandem repeat were identified in promoter region of the Nrf2 gene (NM 006164). Genomic DNA was prepared from venous blood (3 ml) collected from the patients and the controls with Takara DNA isolation kit (Takara Bio Inc., Shiga, Japan). Primers Nrf2-F1/Nrf2-R1 (GCGTGGTGGCTGCGCTTT/GCCCGCGAGATAAAGAGTTG) were designed to amplify the promoter region. The genotypes of SNPs were determined by directly sequencing PCR products amplified with Nrf2-F1/Nrf2-R1 with ABI 3100 Prism DNA sequencer (GMI Inc., Minnesota, MN, USA). Primers Nrf2-F2/Nrf2-R2 (TAGCCGATTACCGAGTGCCG/GGCAGCTCCAAGTCCATCATG) were used to amplify the promoter region containing the triplet repeat by PCR, and the product was analysed by Gene Scan analysis with ABI 377 Prism DNA sequencer (GMI Inc.). The standard chi-square (χ2) test was used to determine the differences in genotype and allele frequencies between the patients and the controls. Environmental Health (EH) program was used to investigate the haplotype relative risk (20). P-values less than 0.05 were considered to indicate statistical significance.
Results
Our results (Figure S1) indicated that the genotype distribution and allele frequency at –650C/A differed significantly between the patients and the controls (genotype distribution, χ2 = 14.114, P < 0.01, allele frequency, χ2 = 18.096, P < 0.01). While the genotype distributions and allele frequencies at –684G/A (genotype distribution, χ2 = 0.629, P > 0.05, allele frequency, χ2 = 0.252, P > 0.05) and –686A/G (genotype distribution, χ2 = 1.000, P > 0.05, allele frequency, χ2 = 3.708, P > 0.05) did not show significant differences between the patients and the controls. In addition, no significant difference was observed at the triplet repeat between the patients and the controls (χ2 = 0.335, P > 0.05) (Table 1). There is no deviation from the Hardy–Weinberg equilibrium in the vitiligo patients (–650C/A, P = 0.929, –684G/A, P = 0.888, –686A/G, P = 0.582, (CCG)n, P = 0.587) or the controls (–650C/A, P = 0.755, –684G/A, P = 0.428, –686A/G, P = 0.985, (CCG)n, P = 0.927). Using EH program, A−650 allele associated with the risk for vitiligo was statistically significant (OR = 1.724, 95% CI: 1.345–2.211, χ2 = 18.096). Homozygote of A allele further increased the risk for vitiligo (OR = 2.902, 95% CI: 1.624–5.188, χ2 = 12.637). No significant differences were found in the other three polymorphisms between the two groups (Table 2). The results were not related to the sex, age, the clinical subgroups and the onset of age (data not shown). Ample evidences support that oxidative stress plays an important role in the pathogenesis of vitiligo (21–26). The reduced antioxidant capacity was found in the vitiligo patients, and which maybe partly related to polymorphism of the per se antioxidant genes, such as catalase and glutathione peroxidase (27,28). Interestingly, so far Nrf2 is an important regulator of detoxifying and antioxidant gene found. The polymorphisms in the promoter region of the Nrf2 gene had been identified, and no association of susceptibility with systemic lupus erthematosus (SLE) and chronic obstructive pulmonary disease (COPD) patients was observed (18). However, the result showed the –617 A SNP had significantly higher risk for the developing ALI after major trauma (19). In our study, it should be noticed is at the –650C/A, the A allele frequency in the patients was higher than that in the controls, which was 36.5% and 25.0%, respectively. Furthermore, A−650 allele was associated with risk for vitiligo significantly (OR = 1.724, χ2 = 18.096), and homozygote of A allele increase the risk for vitiligo obviously (OR = 2.902, χ2 = 12.637).
| Position | Genotype allele | Control (%) | Patient group (%) | χ2 value | OR | 95%CI |
|---|---|---|---|---|---|---|
| −686A/G | G/G G/AA/A G A | 81 (27.0) | 60 (20.0) | 3.7081 | 0.676 | 0.462–0.989 |
| 141 (47.0) | 150 (50.0) | |||||
| 78 (26.0) | 90 (30.0) | 1.0001 | 1.220 | 0.853–1.743 | ||
| 303 (50.5) | 270 (45.0) | |||||
| 297 (49.5) | 330 (55.0) | 3.4202 | 1.247 | 0.994–1.564 | ||
| −684G/A | G/G G/AA/A G A | 250 (83.3) | 258 (86.0) | 0.6291 | 1.229 | 0.787–1.918 |
| 47 (15.7) | 41 (13.7) | |||||
| 3 (1.0) | 1 (0.3) | 0.2521 | 0.331 | 0.034–3.201 | ||
| 547 (91.2) | 558 (93.0) | |||||
| 53 (8.8) | 42 (7.0) | 1.1432 | 0.777 | 0.510–1.184 | ||
| −650C/A | C/C C/AA/A C A | 170 (56.7) | 123 (41.0) | 14.1141** | 0.531 | 0.384–0.735 |
| 110 (36.7) | 135 (45.0) | |||||
| 20 (6.6) | 42 (14.0) | 7.9331* | 2.279 | 1.304–3.985 | ||
| 450 (75.0) | 381 (63.5) | |||||
| 150 (25.0) | 219 (36.5) | 18.0962* | 1.724 | 1.345–2.211 | ||
| (CCG)n | 4/4 4/5 5/5n = 4 n = 5 | 93 (31.0) | 81 (27.0) | 0.9791 | 0.823 | 0.578–1.172 |
| 140 (46.7) | 153 (51.0) | |||||
| 67 (22.3) | 66 (22.0) | 0.0001 | 0.981 | 0.667–1.442 | ||
| 326 (54.3) | 315 (52.5) | |||||
| 274 (45.7) | 285 (47.5) | 0.3352 | 1.076 | 0.858–1.351 |
- 1Homozygous population of one allele was compared to the rest population including the other allele.
- 2Comparison of allele frequency.
- *P < 0.05, **P < 0.01.
| Recessive1 | Additive | Dominant4 | ||
|---|---|---|---|---|
| 1 copy2 | 2 copy3 | |||
| OR | 2.279 | 1.696 | 2.902 | 0.531 |
| 95% CI | 1.304–3.985 | 1.204–2.389 | 1.624–5.188 | 0.384–0.735 |
| χ2 value | 7.933 | 8.688 | 12.637 | 14.114 |
| P-value | 0.005 | 0.003 | 0.000 | 0.000 |
- 1Comparison between low frequency homozygote with patients and controls and that with total other patients.
- 2Comparison of heterozygote and high frequency homozygote with patients and controls, respectively.
- 3Comparision of low and high frequency homozygote with patients and controls, respectively.
- 4Comparison between high frequency homozygote with patients and controls and that with total other patients.
Conclusions
To our knowledge, this study is the first insight look into the Nrf2 gene polymorphisms in which A−650 allele may be a risk factor associated with the development of vitiligo. It implies that Nrf2 associated antioxidant process, at least in part, play an active role in the pathogenesis of vitiligo.
