Volume 27, Issue 6 pp. 2042-2055

ORIGINAL ARTICLE

Full Access

High dietary lipid level decreases the immunity and disease resistance of abalone Haliotis discus hannai and affects the perilipin-2/TLR4, JNK and Keap1/Nrf2 pathways

Yanlin Guo

The Key Laboratory of Mariculture (Ministry of Education), The Key Laboratory of Aquaculture Nutrition and Feeds (Ministry of Agriculture and Rural Affairs), Fisheries College, Ocean University of China, Qingdao, China

Search for more papers by this author

Dong Huang,

Dong Huang

Search for more papers by this author

Mingzhu Pan,

Mingzhu Pan

Search for more papers by this author

Mengxi Yang,

Mengxi Yang

Search for more papers by this author

Kai Luo,

Kai Luo

Search for more papers by this author

Jiahuan Liu,

Jiahuan Liu

Search for more papers by this author

Chenglong Wu,

Chenglong Wu

School of Life Science, Huzhou University, Huzhou, China

Search for more papers by this author

Wenbing Zhang,

Corresponding Author

Wenbing Zhang

[email protected]

orcid.org/0000-0002-6546-3087

Correspondence

Wenbing Zhang, The Key Laboratory of Mariculture (Ministry of Education), The Key Laboratory of Aquaculture Nutrition and Feeds (Ministry of Agriculture and Rural Affairs), Fisheries College, Ocean University of China, Qingdao 266003, China.

Email: [email protected]

Search for more papers by this author

Kangsen Mai,

Kangsen Mai

Search for more papers by this author

Yanlin Guo,

Yanlin Guo

Search for more papers by this author

Dong Huang,

Dong Huang

Search for more papers by this author

Mingzhu Pan,

Mingzhu Pan

Search for more papers by this author

Mengxi Yang,

Mengxi Yang

Search for more papers by this author

Kai Luo,

Kai Luo

Search for more papers by this author

Jiahuan Liu,

Jiahuan Liu

Search for more papers by this author

Chenglong Wu,

Chenglong Wu

School of Life Science, Huzhou University, Huzhou, China

Search for more papers by this author

Wenbing Zhang,

Corresponding Author

Wenbing Zhang

[email protected]

orcid.org/0000-0002-6546-3087

Correspondence

Email: [email protected]

Search for more papers by this author

Kangsen Mai,

Kangsen Mai

Search for more papers by this author

First published: 21 September 2021

https://doi.org/10.1111/anu.13339

Citations: 9

Yanlin Guo and Dong Huang are contributed equally to this work.

Share a link

Email
Wechat
Bluesky

Abstract

A 100-day feeding trial was conducted to investigate the influences of dietary lipid levels on the immunity and mechanism in abalone Haliotis discus hannai Ino. Abalones (initial weight: 10.98 ± 0.05 g) were fed with graded levels of dietary lipid, which were 15.73, 23.41, 31.72, 38.25, 46.35, 55.63, 61.70 and 67.19 g/kg. Results showed that compared with the treatment with 38.25 g/kg of dietary lipid, 67.19 g/kg of dietary lipid increased the cumulative mortality of abalone after a challenge with Vibrio parahaemolyticus. Meanwhile, 67.19 g/kg of dietary lipid decreased the activities of lysozyme (LZ) and acid phosphatase (ACP) in serum, and the mRNA levels of β-defensin and mytimacin 6 in hepatopancreas of abalone. The mRNA levels of tumour necrosis factor α (tnfα), activator protein 1 (ap-1), nuclear factor κB (nf-κb), interleukin 1 receptor-associated kinase-4 (irak4), myeloid differentiation primary response protein MyD88 (myd88), toll-like receptor 2 (tlr2), tlr4 and perilipin-2, and the protein level of interleukin-1β (IL-1β), TNFα, NF-κBp65, AP-1, MyD88 and Perilipin-2 in hepatopancreas were up-regulated by 67.19 g/kg of dietary lipid. However, the mRNA levels of arginase and inhibitor of κBα (iκbα) were down-regulated. Besides, 67.19 g/kg of dietary lipid up-regulated the mRNA levels of executor apoptosis-related cysteine peptidase 3 (caspase-3), caspase-7 and B-cell lymphoma protein-2-associated X protein (bax), and the protein levels of caspase-3 and c-Jun N-terminal kinases (JNK) in hepatopancreas. Moreover, high dietary lipid level down-regulated the mRNA levels of copper/zinc superoxide dismutase (cuznsod), manganese superoxide dismutase (mnsod), catalase (cat), glutathione peroxidase (gpx), glutathione-S-transferase (gst) and NF-E2-related factor 2 (nrf2), while up-regulated the mRNA and protein levels of Kelch-like ECH-associated protein 1 (Keap1) in hepatopancreas. It was concluded that a high level (67.19 g/kg) of dietary lipid decreased the immunity of abalone, which might be related to the aggravated inflammation and apoptosis, and decreased anti-oxidative capacity under Perilipin-2/TLRs/MyD88/IRAK4/(NF-κB or AP-1), JNK/Bcl-2/Bax and Keap1/Nrf2 signalling.

1 INTRODUCTION

In recent years, with the rapid development of aquaculture industry, highly intensive culture is an inevitable choice to increase the output of aquatic product. However, higher culture density usually leads to decreased growth performance and immunity, elevated susceptibility to bacterial infection, higher mortality and so on (Castillo-Vargasmachuca et al., 2012). Lipid, as an essential nutrient, contributes to improving growth performance and immunity of aquatic animals (Lin & Shiau, 2003; Mai et al., 1995; Xie et al., 2019). High-lipid content diets have been increasingly used in aquaculture because of its protein-sparing effects (Jannathulla et al., 2019; Yigit et al., 2002), which not only reduced nitrogen waste but also decreased feed cost. Nevertheless, a high levels of dietary lipid resulted in anomalous lipid deposition and metabolic disturbance in body, which is frequently accompanied by decreased immunity in fish and shrimp (Jia et al., 2020; Li et al., 2020; Yuan et al., 2016). Hence, understanding how high-lipid level influences the immunity and possible signalling is vital for healthy culture of aquatic animals.

Immunity of aquatic animals is tightly related to inflammation (Guardiola et al., 2014; Uribe et al., 2011). Toll-like receptors (TLRs) were proved to play important roles in the regulation of inflammation (Rebl et al., 2010). According to a previous studies in fish (Rauta et al., 2014; Shan et al., 2018), TLRs triggered cell signalling cascades through myeloid differentiation primary response protein MyD88 (MyD88)-interleukin 1 receptor-associated kinase-4 (IRAK4) complex, induced the subsequent nuclear localization of nuclear factor κB (NF-κB) and activator protein 1 (AP-1) and finally induced the expression of pro-inflammatory cytokines such as tumour necrosis factor (TNF-α) and interleukin 1 (IL-1). Perilipin-2 is a lipid droplet associated protein, which featured in the regulation of metabolism (Imai et al., 2012). In recent years, it was found that Perilipin-2 also played important roles in the regulation of inflammation in mammals (McManaman et al., 2013; Norman et al., 2018). Hence, Perilipin-2 has drawn more attention because of its potential role in inflammation of aquatic animals.

Apoptosis and anti-oxidation also influence the immunity of aquatic animals (García-Valtanen et al., 2017; Guo et al., 2017; Hoole et al., 2003). It has been reported that c-Jun N-terminal kinases (JNK) could induce the phosphorylation of B-cell lymphoma-2 (Bcl-2) and B-cell lymphoma protein-2-associated X protein (Bax) and then stimulate the release cytochrome C from the mitochondrial inner membrane (Guo, Chen, et al., 2020). This series of celling signalling cascade finally leads to the activation of the executor apoptosis-related cysteine peptidase (caspases), such as caspase-3 and caspase-7 (Dhanasekaran & Reddy, 2008, 2017), which induce apoptosis. Besides, a previous study has demonstrated the important roles of NF-E2-related factor 2 (Nrf2) in anti-oxidative process (Sayin et al., 2017). After degradation of the binding protein Kelch-like ECH-associated protein 1 (Keap1), Nrf2 will accumulate, translocate to the nucleus and induce transcription of anti-oxidative enzymes (Stewart et al., 2011; Sykiotis & Bohmann, 2008).

A previous study indicated that high dietary lipid level decreased the growth performance and increased the lipid deposition in abalone Haliotis discus hannai (Guo, Huang, et al., 2020). However, the influences of high-lipid level on disease resistance, inflammation, apoptosis and anti-oxidation, and the underlying regulation mechanisms in abalone are still unclear. The present study aims at investigating the effects of high dietary lipid level on the inflammation, apoptosis and oxidative damages in abalone. It provides basal data to improve the theory of lipid nutrition and immunity, and guidance for healthy culture of abalone.

2 MATERIALS AND METHODS

All animal care and handling procedures in present study were approved by the Animal Care Committee of Ocean University of China.

2.1 Experimental diets

Ingredients and proximate compositions as well as the fatty acid compositions of the experimental diets are shown in Tables S1 and S2 (Guo, Huang, et al., 2020). Eight experimental diets with graded lipid levels (15.73, 23.41, 31.72, 38.25, 46.35, 55.63, 61.70 and 67.19 g/kg) were used. All ingredients were mixed using an electronic mixer and then made into 9 cm² flakes through a tablet compressing machine. After dried, the flakes were stored in the sealed bag at −20℃ until use.

2.2 Feeding trial

Abalones were purchased from a fishery company in Fuzhou, China. Prior to the feeding trial, abalones were acclimatized to the experimental environment in the natural sea area in Pingtan County, Fuzhou, China, for two weeks. Then, a total of 1440 abalones (initial body weight: 10.98 ± 0.05 g) were randomly assigned to 24 sea cages (three replicates per treatment and sixty abalones per replicate). Each diet was randomly fed to triplicated cages once every two days. Uneaten diets and faeces were removed before the next feeding. During the 100-day feeding trial (from October 2018 to January 2019), the water temperature was 23.39 ± 4.85℃, the pH value was 8.04 ± 0.14, and the dissolved oxygen was 6.76 ± 0.93 mg/L.

2.3 Sample collection

At the end of the feeding trial, all abalones were not fed for 72 h. After that, abalones were removed from cags and anaesthetized by 5% ethyl alcohol thereafter. Cut open the foot muscle of abalone along the middle from the anterior, and then cut the cephalic arterial sinus. After that, serum was collected and immediately frozen in liquid nitrogen. Then, the hepatopancreas of abalone was collected, washed with cold saline (0.86% NaCl) and finally frozen in liquid nitrogen.

2.4 Challenge test

After the feeding trial, due to the site condition limitation, 4 groups of abalone representing lower (15.73 g/kg), middle (31.72 and 38.25 g/kg) and higher (67.19 g/kg) dietary lipid levels, respectively, were used for a challenge test with Vibrio parahaemolyticus infection in a static aquaculture system. The V. parahaemolyticus was provided by the Laboratory of Aquatic Animal Diseases and Immunology of Ocean University of China. Twelve abalones were randomly collected from each cage and used as one replicate (each treatment had three replicates). And then, abalones were intramuscularly injected with 100 μl V. parahaemolyticus [(concentration of 1.0 × 10⁸ colony-forming units (CFU)/ml]. The injected bacterial concentration was a lethal dose 50 (LD₅₀) according to the pretest. The challenge test lasted for 6 days. During the challenge test, the abalone were not fed and mortalities were recorded twice daily at 8:00 and 18:00.

2.5 Serum parameters

The activities of lysozyme (LZ), acid phosphatase (ACP), superoxide dismutase (SOD) and catalase (CAT), and concentrations of malondialdehyde (MDA) and glutathione (GSH) in 6 serum samples per treatment were determined using the commercial assay kit (Nanjing Jiancheng Bioengineering Institute, China).

2.6 Real-time polymerase chain reaction (PCR) analysis

Total 6 RNA samples per treatment were isolated from the hepatopancreas using RNAiso Plus Kit (9109, Takara Biotech), and the RNA was dissolved in DEPC treated water. Then, the quality of RNA was assessed using agarose gel electrophoresis. Single-stranded cDNA was prepared from total RNA by reverse transcription using a PrimeScript RT reagent Kit (RR047A; Takara Biotech). PCR specific primers are listed in Table 1. Real-time PCR assays were carried out in a quantitative thermal cycler (Quant Studio 5, Applied Biosystems). The final reaction mixture contained 15 μl containing 7.5 μl 2× SYBR Green Realtime PCR Master Mix (Q711-02, Vazyme Biotech), 0.3 μl each of primers (10 μmol/L) and 1 μl of cDNA mix. β-actin was used as an endogenous reference to normalize the template amount. Real-time PCR temperature profile was 95℃ for 30 s followed by 40 cycles of 10 s at 95℃ and 30 s at 58℃. To confirm the specificity and purity of all PCR products, melt curve analysis was carried out after amplification: 95℃ for 15 s, 60℃ for 1 min and 95℃ for 1 s. Results of gene expression were analysed using the 2^−ΔΔCT method according to Livak and Schmittgen (2001). Normalized gene expression for the 1.57% lipid diet group was set at 1.

TABLE 1. Real-time PCR primer sequences

Target gene	Primer sequence forward (5′→3′)	Primer sequence reverse (5′→3′)	Accession number
β-defensin	CGTCACCTGCGACCTGCTG	CAGAATCACCGAAGGAGTTGCC	FJ864724.1
mytimacin 6	ACAATGTTCCTCGCTATCGTCGT	TCATCCAGCAGTCAGAAGCATCC	MF066909.1
tnfα	TGGACTCAATGGAACGACAGG	GCCCTTCTCATACCGCATCC	EU863217.1
arginase 1	CGTACTACATAGCTGAGGAGGTG	CCATAGAAACGGGACATGACTT	MT919298
ap-1	TGTGTCGTCTGCTTCACGTT	TGTGGCTCCTCTTTCAACCG	GU186850.1
nf-κb	TGCTGGTTGTATGTGGGAGGAC	GAGGTCTCGTTGTCGGATGGTC	GQ903763.1
iκbα	GGAGGGACAGAGGGAGGATT	GACCCGTCCACCATGTCATT	JX235971.1
ikkα	ACATGTCCAGACGCCCAA	CCAAGACCAACAAGCACAC	MT919293
irak4	TGCAACTGCCAGATTAGCACCT	TGACGTGCCGATCACAACCA	KU351646.1
myd88	TTGCCCTACACAATGCGAGT	CCTCCGGTCAATGATACGTTC	KU351389.1
tlr2	CCTGGAGCAAATCATTCCCA	ATTGCCAAGATCTAAGCTTCGT	MT919299
tlr4	GGACGCCGACATCAGACACAT	CAGCCACTTCAGAGACGACAGAG	MT919300
prilipin-2	ACCGACAAAGTCTTATGGCAC	TCCATGCCAGGTTCACCA	MT919297
caspase-3	AAATTCTTGAAACCGCAGACAC	ACCAACAAGTGCGATACAGT	FJ864720.1
caspase-7	TGAAGAAATACAGCACGACCA	TACTACGGCCATCAATCTGGG	MT919294
bcl-2	TGGTCGCTTTGTTTACTTTCGG	AGGGTTCTCGTTTCGCTTCTC	MT482025
bax	CGGAGCACATTTCTCAACGTA	AAGTAAAAGAGGGCAACCAC	MT501464
cuznsod	CTTCAACCCCTTTCGGCAAG	ACCAGCATGTCTGTTTTCGT	DQ530214.1
mnsod	ATTTCACTCCAGCCATCCCT	ACCATTTGGGCTAAGCACCT	DQ821491
cat	GGAACCCTTTCGACCTCACC	ATCTGTTTCCACGTCAGCAA	DQ821496.1
gpx	TTTCGACCGTCCAACTTGCT	CAAAGTTCCAGTACACGTCCC	GU254066.1
gst	CAAAGTTCCAGTACACGTCCC	TCCGTTGTTGTCGCCTCC	DQ530212.1
nrf2	CGACAGCAGCAGCAGCAATG	GGTGAGGACATCTGGAGGCATC	MT919295
keap1	CGACCATGTCCACTAACCGTATTG	TAGCAGTCCATAGCGATAACACCAG	MT919296
β-actin	GGCCTCTCTGTCAACCTTCC	CGGACTCATCGTACTCCTGC	AY380809.1

Abbreviations: ap-1, transcription factor AP-1; bax, B-cell lymphoma protein-2-associated X protein; bcl-2, B-cell lymphoma-2; caspase, apoptosis-related cysteine peptidase; cat, catalase; cuznsod, Cu/Zn superoxide dismutase; gpx, glutathione peroxidase; gst, glutathione-S-transferase; irak4, interleukin 1 receptor-associated kinase-4; iκbα, inhibitor of κBα; keap1, Kelch-like ECH-associated protein 1; mnsod, Mn superoxide dismutase; myd88, myeloid differentiation primary response protein MyD88; nf-κb, nuclear factor κB; nrf2, NF-E2-related factor 2; tlr, toll-like receptor; tnfα, tumour necrosis factor.

2.7 Western blot analysis

Protein homogenates sample (3 hepatopancreas per treatment) preparation, antibodies and western blotting were processed as refer to previous studies (Guo, Huang, et al., 2020). A Thermo Fisher assay kit (78833; Thermo Fisher Scientific) was used for the extraction of nuclear protein. Protein concentrations were determined by a Bradford assay kit (P0006, Beyotime Biotechnology). Protein samples (30 µg per lane) were separated by SDS-PAGE and transferred to a PVDF membrane for western analysis. Then, the PVDF membrane was blocked for 50 min using 5% non-fat dry milk–TBST at room temperature and then incubated with primary antibody in 1% non-fat dry milk–TBST overnight at 4℃. GAPDH (AB-P-R001, 1:500, Goodhere Biotechnology) was used as a control protein for IL-1β (WL00891, 1:500, Wanleibio), TNFα (WL01581, 1:500, Wanleibio), MyD88 (WL02494, 1:500, Wanleibio), perilipin-2 (15295-1-AP, 1:500, Proteintech), caspase-3 (WL02117, 1:500, Wanleibio), JNK (WL01295, 1:500, Wanleibio) and Keap1 (WL03285, 1:1500, Wanleibio), while nuclear Lamin B1 (WL01775, 1:500, Wanleibio) was used as a control protein for Nuclear NF-κBp65 (#8242, 1:1000, Cell Signaling Technology) and Nuclear AP-1 (#9165, 1:1000, Cell Signaling Technology). After being washed, the PVDF membrane was incubated for 1 h with goat anti-rabbit horseradish peroxidase-conjugated secondary antibody (sc-2004, 1:5000, Santa Cruz Biotechnology) in 1% non-fat dry milk–TBST. The immune complexes were visualized using ECL reagents (P0018FM, Beyotime Biotechnology). The western bands were quantified using NIH Image 1.63 software. Different treatments were expressed relative to the level of control group. This experiment was repeated at least three times, and similar results were obtained each time.

2.8 Statistical analysis

Statistical analysis was performed using SPSS 25.0 (SPSS) and Microsoft Excel 2010. The results are represented with the means ± SD. Normality and homoscedasticity assumptions were confirmed before statistical analysis. All evaluated variables were subjected to an ANOVA to determine whether dietary lipid levels significantly (p < .05) affected the observed responses. When significant differences (p < .05) were found, means were compared using Tukey's test.

3 RESULTS

3.1 Cumulative mortality after Vibrio parahaemolyticus infection

As shown in Figure 1, on the sixth day after infection, the cumulative mortality of abalone in the treatment with 67.19 g/kg of dietary lipid was significantly higher than that in the group with 38.25 g/kg of dietary lipid (p < .05). There were no significant differences in the cumulative mortalities among the treatments with 15.73, 31.72 and 38.25 g/kg of dietary lipid.

Details are in the caption following the image — **FIGURE 1**
Open in figure viewer PowerPoint

Effects of dietary lipid levels on cumulative mortality of abalone *Haliotis discus hannai* Ino. All values were presented as the mean ± SE (each treatment had three replicates and each replicate had 12 abalones). Means with different superscript letters were significantly different (p < .05) as determined by Tukey's test

3.2 Serum biochemical index

As shown in Table 2, LZ and ACP activities increased with dietary lipid level up to 46.35 g/kg and then decreased. MDA concentrations in the treatments with 61.70 and 67.19 g/kg of dietary lipid were significantly higher than other groups (p < .05), and the highest MDA concentration was observed in the treatment with 61.70 g/kg of dietary lipid (p < .05). Activities of SOD in the treatments with 55.63, 61.70 and 67.19 g/kg of dietary lipid were significantly lower than other groups (p < .05), and the lowest activity was observed in the group with 67.19 g/kg of dietary lipid (p < .05). Activity of CAT and concentration of GSH increased with dietary lipid level up to 31.72 g/kg and then decreased.

TABLE 2. Effects of different dietary lipid levels on serum index of abalone Haliotis discus hannai Ino

	15.73	23.41	31.72	38.25	46.35	55.63	61.70	67.19
	Dietary lipid levels (g/kg)
LZ (U/ml)	250.56 ± 11.12^ab	262.44 ± 11.92^ab	266.73 ± 13.75^b	259.32 ± 22.73^ab	268.51 ± 22.32^b	256.66 ± 4.74^ab	238.95 ± 6.43^a	236.44 ± 8.49^a
ACP (U/ml)	3.48 ± 0.23^b	3.67 ± 0.21^b	3.95 ± 0.34^bc	3.86 ± 0.13^bc	4.74 ± 0.30^d	4.30 ± 0.37^cd	3.15 ± 0.16^b	2.59 ± 0.19^a
MDA (nmol/ml)	0.48 ± 0.04^a	0.48 ± 0.03^a	0.45 ± 0.01^a	0.46 ± 0.03^a	0.46 ± 0.03^a	0.44 ± 0.02^a	1.87 ± 0.13^c	1.74 ± 0.07^b
SOD (U/ml)	141.09 ± 10.75^b	140.53 ± 10.30^bc	140.50 ± 11.13^bc	141.44 ± 3.63^b	141.12 ± 6.94^b	121.58 ± 10.82^a	122.49 ± 6.40^a	123.95 ± 10.86^ab
CAT (U/ml)	5.63 ± 0.28^c	5.61 ± 0.43^c	6.68 ± 0.18^d	6.58 ± 0.18^d	3.95 ± 0.16^b	3.81 ± 0.25^b	3.23 ± 0.18^a	3.34 ± 0.22^a
GSH (μmol/L)	50.69 ± 4.29^bc	47.88 ± 3.37^b	58.39 ± 4.79^d	54.99 ± 2.45^cd	45.12 ± 1.87^b	35.58 ± 2.33^a	30.84 ± 1.95^a	32.46 ± 1.80^a

Note

Means in the same row sharing with different superscript letters were significantly different (p < .05) as determined by Tukey's test.
Abbreviations: ACP, acid phosphatase; GSH, glutathione; LZ, lysozyme; MDA, malondialdehyde.

3.3 Antibacterial peptides and inflammation related parameters

As shown in Figure 2, there was no significant change of β-defensin mRNA level with dietary lipid level increasing from 15.73 to 55.63 g/kg, but it was down-regulated with the further increase of dietary lipid level. The mRNA level of mytimacin 6 was up-regulated with dietary lipid level up to 38.25 g/kg and then down-regulated. Compared with the treatment of 38.25 g/kg dietary lipid, 67.19 g/kg dietary lipid level significantly down-regulated the mRNA levels of β-defensin and mytimacin 6 (p < .05). As shown in Figure 3, there were no significant change of tnfα, nf-κb, irak4, myd88, tlr2, tlr4 and perilipin-2 mRNA levels with dietary lipid up to a certain level and then up-regulated. Compared with the treatment of 38.25 g/kg dietary lipid, 67.19 g/kg dietary lipid level significantly up-regulated the mRNA levels of tnfα, nf-κb, irak4, myd88, tlr2, tlr4 and perilipin-2 (p < .05), while their mRNA levels in the treatment of 15.73 g/kg dietary lipid were not significantly different with 38.25 g/kg dietary lipid. The mRNA levels of arginase and inhibitor of κBα (iκbα) were up-regulated with dietary lipid level up to 38.25 g/kg, and then down-regulated gradually. With dietary lipid increasing from 15.73 to 38.25 g/kg, the mRNA level of ap-1 was down-regulated and then up-regulated with the continuous increase of dietary lipid level. Compared with the treatments of 15.73 and 38.25 g/kg dietary lipid, the mRNA level of ap-1 in the group of 67.19 g/kg dietary lipid was significantly up-regulated (p < .05). However, the mRNA level of ikkα was independent of dietary lipid level. As shown in Figure 4, with the increase of dietary lipid level, protein of IL-1β, TNFα, MyD88, Perilipin-2, NF-κB and AP-1 was gradually up-regulated. Compared with the treatments of 15.73 and 38.25 g/kg dietary lipid, the protein level of IL-1β, TNFα, MyD88, Perilipin-2, NF-κB and AP-1 was significantly up-regulated by the treatment of 67.19 g/kg dietary lipid (p < .05).

3.4 Apoptosis-related parameters

As shown in Figure 5, there was no significant change of caspase-3, caspase-7 and bax mRNA levels with dietary lipid up to a certain level and then up-regulated. The highest mRNA levels of caspase-3, caspase-7 and bax were observed in the treatment of 67.19 g/kg dietary lipid (p < .05), and the lowest mRNA level of caspase-3, caspase-7 and bax was observed in the groups of 31.72, 46.35 and 31.72 g/kg dietary lipid (p < .05). The mRNA level of bcl-2 in the treatments of 61.70 and 67.19 g/kg dietary lipid was significantly lower than other treatments (p < .05). As shown in Figure 6, the protein level of caspase-3 was gradually up-regulated with the elevation of dietary lipid level. And compared with the treatments of 15.73 and 38.25 g/kg dietary lipid, 67.19 g/kg dietary lipid level significantly up-regulated the protein level of caspase-3 (p < .05). The protein level of JNK in the treatments of 55.63, 61.70 and 67.19 g/kg dietary lipid was significantly higher than other treatments (p < .05).

3.5 Anti-oxidation related parameters

As shown in Figure 7, with dietary lipid level up to 46.35, 46.35, 31.72, 38.25, 38.25 and 46.35 g/kg, the mRNA levels of copper/zinc superoxide dismutase (cuznsod), manganese superoxide dismutase (mnsod), cat, glutathione peroxidase (gpx), glutathione-S-transferase (gst) and nrf2 were gradually up-regulated and down-regulated thereafter. With dietary lipid level increasing from 15.73 to 38.25 g/kg, the mRNA level of keap1 showed no significant change, and with the further increase of dietary lipid level, the mRNA level of keap1 was up-regulated. The highest mRNA level of keap1 was observed in the treatment of 67.19 g/kg dietary lipid (p < .05), and the lowest mRNA level was observed in the treatment of 23.41 g/kg dietary lipid (p < .05). As shown in Figure 8, the protein level of Keap1 was gradually up-regulated with the increase of dietary lipid level. The highest protein level of Keap1 was observed in the treatment of 55.63 g/kg dietary lipid (p < .05), and the lowest protein level was observed in the group of 31.72 g/kg dietary lipid (p < .05).

4 DISCUSSION

Generally, normal immunity is required for increasing the growth performance of aquatic animals (Van Nguyen et al., 2019). Our previous study demonstrated that compared with the optimal dietary lipid level (38.25 g/kg), the higher dietary lipid level (67.19 g/kg) decreased the weight gain and daily increment in shell length of abalone (Guo, Huang, et al., 2020). A similar result was found in the previous study (Lee et al., 2016), in which diet with high-lipid level decreased the weight gain of abalone Haliotis discus (Reeve, 1846). In addition, immunity could be reflected by disease resistance of fish and shrimp (Magnadottir, 2010; Miao et al., 2017). It was demonstrated that V. parahaemolyticus causes outbreaks of vibriosis associated with warm water, leading to decreased immunity of abalone (Cai et al., 2006; Lu et al., 2017; Travers et al., 2008). In the present study, compared with optimal dietary lipid level (38.25 g/kg), high dietary lipid level (67.19 g/kg) increased cumulative mortality of abalone after V. parahaemolyticus infection. All the above-mentioned data indicated that a high level of dietary lipid decreased the immunity of abalone.

Abalone lacks an adaptive immune response (Xue et al., 2008), and this makes the innate immune responses more important in defending against bacterial infection. LZ and ACP are also important components of innate immune responses (Ivanina et al., 2014; Uribe et al., 2011). Besides, antibacterial peptides, such as β-defensin and mytimacin 6, are all important components of innate immune responses which is essential in defending against bacteria, fungi and enveloped viruses (Hoar et al., 1997; Suzuki & Iida, 1992; Wang, Zhang, et al., 2015). In the present study, compared with the 38.25 g/kg of dietary lipid level, the higher dietary lipid level (67.19 g/kg) decreased the activities of LZ and ACP in serum and down-regulated the mRNA levels of β-defensin and mytimacin 6 in the hepatopancreas of abalone. Similar results were found in the serum of Nile tilapia Oreochromis niloticus (Lim et al., 2009) and serum of Chinese mitten crab Eriocheir sinensis (Wang, Chen, et al., 2015). These data indicate that high-lipid level impaired immunity by suppressing the innate immune responses of abalone.

A previous study has pointed out the important roles of inflammation in immunity of fish (Wu et al., 2016). IL-1β and TNFα are pro-inflammatory cytokines, and up-regulation of their gene expression is frequently related to triggered inflammation in fish (Zuo et al., 2013). In addition, NF-κB is a transcription factor, which could transfer into the nuclear localization accompanied by the degradation of IκBα through IKK complex, and the nuclear localization of NF-κB could up-regulate pro-inflammatory cytokine (such as IL-1β) expression in mammals (Liu et al., 2017). Besides, arginase was proven to play important roles in the anti-inflammatory process, which could be down-regulated by transcription factor AP-1 in mammals (Hannemann et al., 2017; Monticelli et al., 2016). In the present study, compared with 38.25 g/kg of dietary lipid level, the higher dietary lipid level (67.19 g/kg) up-regulated the mRNA levels of tnfα, nf-κb and ap-1, and the protein level of IL-1β, TNFα, nuclear NF-κBp65 and nuclear AP-1. Meanwhile, it down-regulated the mRNA levels of arginase and iκbα in hepatopancreas of abalone. It has been reported that a high-fat diet (103 g/kg) up-regulated the mRNA levels of TNFα and NF-κB and down-regulated the mRNA level of IκBα in brain of blunt snout bream Megalobrama amblycephala (Dai et al., 2018). Wang et al. (2016) reported that high dietary lipid level (180 g/kg) up-regulated the protein level of nuclear NF-κB and AP-1 in the liver of large yellow croaker Larmichthys crocea. These data indicate that compared with the 38.25 g/kg of dietary lipid level, the higher dietary lipid level (67.19 g/kg) induced inflammation in hepatopancreas of abalone, which might be related to NF-κB and AP-1 signalling. However, the higher dietary lipid level (67.19 g/kg) had no significant influence on the mRNA level of IKKα. The possible reason might be related to the different functions of the three catalytic subunits of the IKK complex (i.e. IKKα, IKKβ and IKKγ). IKKβ could activate the canonical pathway through NF-κBp65, whereas IKKα could activate the non-canonical pathway NF-κBp52 in humans (Bollrath & Greten, 2009). In the present study, it is hypothesized that high dietary lipid level (67.19 g/kg) activated the canonical pathway rather than the non-canonical pathway. Further investigation is needed.

In addition, TLRs which expressed in antigen presenting cells serve as key pattern recognition receptors with central roles in induction of inflammatory cytokines (Kawai & Akira, 2007). The activation of TLRs could recruit MyD88 and IRAK4 and then activate TAK1 pathway, and finally induce the nuclear translocation of NF-κB and AP-1 (Kawai & Akira, 2007; Korneev et al., 2017). Moreover, Perilipin-2, a ubiquitously expressed CLD-associated protein that regulates neutral lipid storage and metabolism in eukaryotic cells, has drawn attention because of its important roles in the regulation of inflammation. In a study of mice, the deletion of Perilipin-2 down-regulated the hepatic mRNA levels of TLR2 and TLR4 (Orlicky et al., 2019). Compared with the 38.25 g/kg of dietary lipid level, in the present study, the higher dietary lipid level (67.19 g/kg) up-regulated the mRNA levels of irak4, myd88, tlr2, tlr4 and perilipin-2, and the protein level of MyD88 and Perilipin-2 in the hepatopancreas of abalone. Similar results were found in a previous study. Jia et al. (2020) demonstrated that high-fat (210 g/kg) diet up-regulated the mRNA levels of TLR2 and MyD88 in liver of tilapia after 90 days of feeding. Arias-Jayo et al. (2018) pointed out that a high-fat diet up-regulated the mRNA levels of MyD88, TLR2 and TLR4 in intestine of zebrafish Danio rerio. The study of Libby et al. (2016) indicated that high-lipid level (210 g/kg) up-regulated hepatic gene expression of Perilipin-2 in mice. In addition, a high level of n-6 polyunsaturated fatty acids (PUFAs) in the present diet might be also related to the aggravated inflammation. It has been reported that in liver of large yellow croaker, a high level of n-6 PUFAs (375.2 g/kg) up-regulated the mRNA levels of TNFα, IL-1β and MyD88. All the data above indicated that compared with 38.25 g/kg of dietary lipid level, high dietary lipid level induced inflammation in hepatopancreas of abalone, which might be related to Perilipin-2/(TLR2 or TLR4)/MyD88/IRAK4/(NF-κB or AP-1) signalling.

Apoptosis and anti-oxidation are also crucial for the immune of aquatic animals (García-Valtanen et al., 2017; Guo et al., 2017; Hoole et al., 2003). In regard to apoptosis, caspase-3 and caspase-7 are executioners, and their up-regulation aggravates apoptosis (Cohen, 1997; Vince et al., 2018). It has been reported that expression of caspase-3 and caspase-7 could be down-regulated by anti-apoptotic protein Bcl-2 and up-regulated by pro-apoptotic protein Bax in human (Fan et al., 2005). Besides, in PC-12 cells, JNK activation could down-regulate the expression of Bcl-2 and up-regulate the expression of Bax (Lu, Miao, et al., 2017). Compared with the 38.25 g/kg of dietary lipid level, in the present study, the higher dietary lipid level (67.19 g/kg) up-regulated the mRNA levels of caspase-3, caspase-7, bax and the protein level of caspase-3 and JNK and down-regulated the mRNA levels of bcl-2 in the hepatopancreas of abalone. Similar results were found that high-fat (103 g/kg) diets up-regulated the mRNA levels of caspase-3 and Bax in blunt snout bream (Dai et al., 2019). Jia et al. (2020) reported that high-fat (210 g/kg) diet up-regulated the mRNA level of JNK in the liver of tilapia. These data indicate that the impaired immunity of abalone could be caused by aggravated apoptosis, which related to JNK/(Bcl-2 and Bax)/caspase signalling.

In fish, increased lipid deposition could increase the degree of lipid peroxidation and increased MDA concentrations are commonly considered an indicator of lipid peroxidation caused by oxidative stress (Garcia et al., 2020; Xie et al., 2021). The anti-oxidative enzymes (AOEs) play important roles in protecting fish from stress (Mu et al., 2020). CuZnSOD, MnSOD, CAT, GPx and GST are all important anti-oxidative enzymes (Klein et al., 2017; Zhang et al., 2019). In addition, Keap1/Nrf2 signalling is vital in the regulation of anti-oxidative enzymes. After the dissociation of Nrf2 from Keap1, Nrf2 translocated into the nucleus and induce the transcription of AOEs (Hashimoto, 2018). Results of the present study showed that compared with the 38.25 g/kg of dietary lipid level, the higher dietary lipid level (67.19 g/kg) increased the concentration of MDA and decreased the activities of SOD and CAT, and concentration of GSH in serum of abalone. Besides, the higher dietary lipid level (67.19 g/kg) down-regulated the mRNA levels of cuznsod, mnsod, cat, gpx, gst and nrf2 and up-regulated the mRNA and protein levels of Keap1 in hepatopancreas of abalone. Zhang et al. (2013) reported that high dietary lipid level (140 g/kg) decreased activity of GPx in hepatopancreas of Pacific white shrimp Litopenaeus vannamei. Ni et al. (2016) confirmed that excessive level of dietary lipid (80.1 g/kg) down-regulated the mRNA levels of CuZnSOD, MnSOD, GPx and Nrf2 and up-regulated the mRNA levels of Keap1 in head kidney and spleen of grass carp. Besides, a high level of n-3 PUFAs in the present diet might be also related to the decreased anti-oxidative capacity of abalone. In the study of white shrimp L. vannamei, a high level of n-3 PUFAs (34.4 g/kg) decreased activities of phenoloxidase and SOD in gill (Yang et al., 2019). These data indicate that impaired immunity of abalone could be caused by decreased anti-oxidative capacity, which related to Keap1/Nrf2/AOEs signalling.

5 CONCLUSIONS

Results from the present study showed that high dietary lipid level (67.19 g/kg) impaired the immunity and increased the cumulative mortality of abalone H. discus hannai (initial weight: 10.98 ± 0.05 g) after a challenge test with V. parahaemolyticus. The aggravated inflammation and apoptosis, and decreased anti-oxidative capacity induced by the high dietary lipid level were regulated by the signalling pathways including the Perilipin-2/TLRs/MyD88/IRAK4/(NF-κB or AP-1), JNK/Bcl-2/Bax and Keap1/Nrf2 (Figure 9).

ACKNOWLEDGEMENT

This study was financially supported by the National Key R & D Program of China (2018YFD0900400) and the China Agriculture Research System of MOF and MARA.

CONFLICT OF INTEREST

The authors declare that there are no conflicts of interest.

Open Research

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Supporting Information

REFERENCES

Arias-Jayo, N., Abecia, L., Alonso-Sáez, L., Ramirez-Garcia, A., Rodriguez, A., & Pardo, M. A. (2018). High-fat diet consumption induces microbiota dysbiosis and intestinal inflammation in zebrafish. Microbial Ecology, 76, 1089–1101. https://doi.org/10.1007/s00248-018-1198-9
10.1007/s00248-018-1198-9
CAS PubMed Web of Science® Google Scholar
Bollrath, J., & Greten, F. R. (2009). IKK/NF-κB and STAT3 pathways: Central signalling hubs in inflammation-mediated tumour promotion and metastasis. Embo Reports, 10, 1314–1319. https://doi.org/10.1038/embor.2009.243
10.1038/embor.2009.243
CAS PubMed Web of Science® Google Scholar
Cai, J., Han, Y., & Wang, Z. (2006). Isolation of Vibrio parahaemolyticus from abalone (Haliotis diversicolor supertexta L.) postlarvae associated with mass mortalities. Aquaculture, 257, 161–166. https://doi.org/10.1016/j.aquaculture.2006.03.007
10.1016/j.aquaculture.2006.03.007
Web of Science® Google Scholar
Castillo-Vargasmachuca, S., Ponce-Palafox, J. T., García-Ulloa, M., Arredondo-Figueroa, J. L., Ruiz-Luna, A., Chávez, E., & Tacon, A. (2012). Effect of stocking density on growth performance and yield of subadult Pacific Red Snapper cultured in floating sea cages. North American Journal of Aquaculture, 74, 413–418. https://doi.org/10.1080/15222055.2012.676002
10.1080/15222055.2012.676002
Web of Science® Google Scholar
Cohen, G. M. (1997). Caspases: the executioners of apoptosis. Biochemical Journal, 326, 1–16. https://doi.org/10.1042/bj3260001
10.1042/bj3260001
CAS PubMed Web of Science® Google Scholar
Dai, Y.-J., Cao, X.-F., Zhang, D.-D., Li, X.-F., Liu, W.-B., & Jiang, G.-Z. (2019). Chronic inflammation is a key to inducing liver injury in blunt snout bream (Megalobrama amblycephala) fed with high-fat diet. Developmental & Comparative Immunology, 97, 28–37. https://doi.org/10.1016/j.dci.2019.03.009
10.1016/j.dci.2019.03.009
CAS PubMed Web of Science® Google Scholar
Dai, Y.-J., Jiang, G.-Z., Yuan, X.-Y., & Liu, W.-B. (2018). High-fat-diet-induced inflammation depresses the appetite of blunt snout bream (Megalobrama amblycephala) through the transcriptional regulation of leptin/mammalian target of rapamycin. British Journal of Nutrition, 120, 1422–1431.
10.1017/S000711451800288X
CAS PubMed Web of Science® Google Scholar
Dhanasekaran, D. N., & Reddy, E. P. (2008). JNK signaling in apoptosis. Oncogene, 27, 6245–6251. https://doi.org/10.1038/onc.2008.301
10.1038/onc.2008.301
CAS PubMed Web of Science® Google Scholar
Dhanasekaran, D. N., & Reddy, E. P. (2017). JNK-signaling: a multiplexing hub in programmed cell death. Genes & Cancer, 8, 682. https://doi.org/10.18632/genesandcancer.155
10.18632/genesandcancer.155
CAS PubMed Google Scholar
Fan, T.-J., Han, L.-H., Cong, R.-S., & Liang, J. (2005). Caspase family proteases and apoptosis. Acta Biochimica Et Biophysica Sinica, 37, 719–727. https://doi.org/10.1111/j.1745-7270.2005.00108.x
10.1111/j.1745?7270.2005.00108.x
CAS PubMed Web of Science® Google Scholar
Garcia, D., Lima, D., da Silva, D. G. H., & de Almeida, E. A. (2020). Decreased malondialdehyde levels in fish (Astyanax altiparanae) exposed to diesel: Evidence of metabolism by aldehyde dehydrogenase in the liver and excretion in water. Ecotoxicology and Environmental Safety, 190, 110107. https://doi.org/10.1016/j.ecoenv.2019.110107
10.1016/j.ecoenv.2019.110107
CAS PubMed Web of Science® Google Scholar
García-Valtanen, P., Martínez-López, A., López-Muñoz, A., Bello-Perez, M., Medina-Gali, R. M., Ortega-Villaizán, M. D. M., Varela, M., Figueras, A., Mulero, V., & Novoa, B. (2017). Zebra fish lacking adaptive immunity acquire an antiviral alert state characterized by upregulated gene expression of apoptosis, multigene families, and interferon-related genes. Frontiers in Immunology, 8, 121.
PubMed Web of Science® Google Scholar
Guardiola, F. A., Cuesta, A., Abellán, E., Meseguer, J., & Esteban, M. A. (2014). Comparative analysis of the humoral immunity of skin mucus from several marine teleost fish. Fish & Shellfish Immunology, 40, 24–31. https://doi.org/10.1016/j.fsi.2014.06.018
10.1016/j.fsi.2014.06.018
CAS PubMed Web of Science® Google Scholar
Guo, M., Chen, K., Lv, Z., Shao, Y., Zhang, W., Zhao, X., & Li, C. (2020). Bcl-2 mediates coelomocytes apoptosis by suppressing cytochrome c release in Vibrio splendidus challenged Apostichopus japonicus. Developmental & Comparative Immunology, 103, 103533. https://doi.org/10.1016/j.dci.2019.103533
10.1016/j.dci.2019.103533
CAS PubMed Web of Science® Google Scholar
Guo, Y., Huang, D., Chen, F., Ma, S., Zhou, W., Zhang, W., & Mai, K. J. A. (2020). Lipid deposition in abalone Haliotis discus hannai affected by dietary lipid levels through AMPKα2/PPARα and JNK/mTOR/SREBP-1c pathway. Aquaculture, 532, 736040. https://doi.org/10.1016/j.aquaculture.2020.736040
10.1016/j.aquaculture.2020.736040
Web of Science® Google Scholar
Guo, Y.-L., Jiang, W.-D., Wu, P., Liu, Y., Zhou, X.-Q., Kuang, S.-Y., Tang, L., Tang, W.-N., Zhang, Y.-A., & Feng, L. (2017). The decreased growth performance and impaired immune function and structural integrity by dietary iron deficiency or excess are associated with TOR, NF-κB, p38MAPK, Nrf2 and MLCK signaling in head kidney, spleen and skin of grass carp (Ctenopharyngodon idella). Fish & Shellfish Immunology, 65, 145–168. https://doi.org/10.1016/j.fsi.2017.04.009
10.1016/j.fsi.2017.04.009
CAS PubMed Web of Science® Google Scholar
Hannemann, N., Jordan, J., Paul, S., Reid, S., Baenkler, H.-W., Sonnewald, S., Bäuerle, T., Vera, J., Schett, G., & Bozec, A. (2017). The AP-1 transcription factor c-Jun promotes arthritis by regulating cyclooxygenase-2 and arginase-1 expression in macrophages. The Journal of Immunology, 198, 3605–3614. https://doi.org/10.4049/jimmunol.1601330
10.4049/jimmunol.1601330
CAS PubMed Web of Science® Google Scholar
Hashimoto, K. (2018). Essential role of Keap1-Nrf2 signaling in mood disorders: Overview and future perspective. Frontiers in Pharmacology, 9, 1182. https://doi.org/10.3389/fphar.2018.01182
10.3389/fphar.2018.01182
CAS PubMed Web of Science® Google Scholar
Hoar, W. S., Randall, D. J., Iwama, G., & Nakanishi, T. (1997). The fish immune system: Organism, pathogen, and environment. Academic Press.
Google Scholar
Hoole, D., Lewis, J., Schuwerack, P., Chakravarthy, C., Shrive, A., Greenhough, T., & Cartwright, J. (2003). Inflammatory interactions in fish exposed to pollutants and parasites: A role for apoptosis and C reactive protein. Parasitology, 126, S71. https://doi.org/10.1017/S0031182003003779
10.1017/S0031182003003779
CAS PubMed Web of Science® Google Scholar
Imai, Y., Boyle, S., Varela, G. M., Caron, E., Yin, X., Dhir, R., Dhir, R., Graham, M. J., & Ahima, R. S. (2012). Effects of perilipin 2 antisense oligonucleotide treatment on hepatic lipid metabolism and gene expression. Physiological Genomics, 44, 1125–1131. https://doi.org/10.1152/physiolgenomics.00045.2012
10.1152/physiolgenomics.00045.2012
CAS PubMed Web of Science® Google Scholar
Ivanina, A. V., Hawkins, C., & Sokolova, I. M. (2014). Immunomodulation by the interactive effects of cadmium and hypercapnia in marine bivalves Crassostrea virginica and Mercenaria mercenaria. Fish & Shellfish Immunology, 37, 299–312. https://doi.org/10.1016/j.fsi.2014.02.016
10.1016/j.fsi.2014.02.016
CAS PubMed Web of Science® Google Scholar
Jannathulla, R., Chitra, V., Vasanthakumar, D., Nagavel, A., Ambasankar, K., Muralidhar, M., & Dayal, J. S. (2019). Effect of dietary lipid/essential fatty acid level on Pacific whiteleg shrimp, Litopenaeus vannamei (Boone, 1931) reared at three different water salinities–Emphasis on growth, hemolymph indices and body composition. Aquaculture, 513, 734405. https://doi.org/10.1016/j.aquaculture.2019.734405
10.1016/j.aquaculture.2019.734405
CAS Web of Science® Google Scholar
Jia, R., Cao, L.-P., Du, J.-L., He, Q., Gu, Z.-Y., Jeney, G., Xu, P., & Yin, G.-J. (2020). Effects of high-fat diet on antioxidative status, apoptosis and inflammation in liver of tilapia (Oreochromis niloticus) via Nrf2, TLRs and JNK pathways. Fish & Shellfish Immunology, 104, 391–401. https://doi.org/10.1016/j.fsi.2020.06.025
10.1016/j.fsi.2020.06.025
CAS PubMed Web of Science® Google Scholar
Kawai, T., & Akira, S. (2007). TLR signaling. Seminars in Immunology, 19(1), 24–32. https://doi.org/10.1016/j.smim.2006.12.004
10.1016/j.smim.2006.12.004
CAS PubMed Web of Science® Google Scholar
Klein, R. D., Borges, V. D., Rosa, C. E., Colares, E. P., Robaldo, R. B., Martinez, P. E., & Bianchini, A. (2017). Effects of increasing temperature on antioxidant defense system and oxidative stress parameters in the Antarctic fish Notothenia coriiceps and Notothenia rossii. Journal of Thermal Biology, 68, 110–118. https://doi.org/10.1016/j.jtherbio.2017.02.016
10.1016/j.jtherbio.2017.02.016
CAS PubMed Web of Science® Google Scholar
Korneev, K. V., Atretkhany, K.-S.-N., Drutskaya, M. S., Grivennikov, S. I., Kuprash, D. V., & Nedospasov, S. A. (2017). TLR-signaling and proinflammatory cytokines as drivers of tumorigenesis. Cytokine, 89, 127–135. https://doi.org/10.1016/j.cyto.2016.01.021
10.1016/j.cyto.2016.01.021
CAS PubMed Web of Science® Google Scholar
Lee, K. W., Kim, H. S., Yun, A., Choi, D. G., Jang, B. I., Kim, H. J., Cho, S. H., Joo, Y.-I., Kim, B.-H., & Min, B.-H. (2016). Effect of the formulated diets on performance and resistance of juvenile abalone [Haliotis discus (Reeve, 1846)] subjected to various stress conditions. Journal of Shellfish Research, 35, 481–491.
10.2983/035.035.0221
Web of Science® Google Scholar
Li, L., Wang, W., Yusuf, A., Zhu, Y., Zhou, Y., Ji, P., & Huang, X. (2020). Effects of dietary lipid levels on the growth, fatty acid profile and fecundity in the oriental river prawn, Macrobrachium nipponense. Aquaculture Research, 51, 1893–1902.
10.1111/are.14539
CAS Web of Science® Google Scholar
Libby, A. E., Bales, E., Orlicky, D. J., & McManaman, J. L. (2016). Perilipin-2 deletion impairs hepatic lipid accumulation by interfering with sterol regulatory element-binding protein (SREBP) activation and altering the hepatic lipidome. Journal of Biological Chemistry, 291, 24231–24246. https://doi.org/10.1074/jbc.M116.759795
10.1074/jbc.M116.759795
CAS PubMed Web of Science® Google Scholar
Lim, C., Yildirim-Aksoy, M., Li, M. H., Welker, T. L., & Klesius, P. H. (2009). Influence of dietary levels of lipid and vitamin E on growth and resistance of Nile tilapia to Streptococcus iniae challenge. Aquaculture, 298, 76–82. https://doi.org/10.1016/j.aquaculture.2009.09.025
10.1016/j.aquaculture.2009.09.025
CAS Web of Science® Google Scholar
Lin, Y.-H., & Shiau, S.-Y. (2003). Dietary lipid requirement of grouper, Epinephelus malabaricus, and effects on immune responses. Aquaculture, 225, 243–250. https://doi.org/10.1016/S0044-8486(03)00293-X
10.1016/S0044-8486(03)00293-X
CAS Web of Science® Google Scholar
Liu, T., Zhang, L., Joo, D., & Sun, S.-C. (2017). NF-κB signaling in inflammation. Signal Transduction and Targeted Therapy, 2, 1–9. https://doi.org/10.1038/sigtrans.2017.23
10.1038/sigtrans.2017.23
CAS Web of Science® Google Scholar
Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif.), 25, 402–408.
10.1006/meth.2001.1262
CAS PubMed Web of Science® Google Scholar
Lu, J., Shi, Y., Cai, S., & Feng, J. (2017). Metabolic responses of Haliotis diversicolor to Vibrio parahaemolyticus infection. Fish & Shellfish Immunology, 60, 265–274. https://doi.org/10.1016/j.fsi.2016.11.051
10.1016/j.fsi.2016.11.051
CAS PubMed Web of Science® Google Scholar
Lu, Z., Miao, Y., Muhammad, I., Tian, E., Hu, W., Wang, J., Wang, B., Li, R., & Li, J. (2017). Colistin-induced autophagy and apoptosis involves the JNK-Bcl2-Bax signaling pathway and JNK-p53-ROS positive feedback loop in PC-12 cells. Chemico-Biological Interactions, 277, 62–73. https://doi.org/10.1016/j.cbi.2017.08.011
10.1016/j.cbi.2017.08.011
CAS PubMed Web of Science® Google Scholar
Magnadottir, B. (2010). Immunological control of fish diseases. Marine Biotechnology, 12, 361–379. https://doi.org/10.1007/s10126-010-9279-x
10.1007/s10126-010-9279-x
CAS PubMed Web of Science® Google Scholar
Mai, K., Mercer, J. P., & Donlon, J. (1995). Comparative studies on the nutrition of two species of abalone, Haliotis tuberculata L. and Haliotis discus hannai Ino. III. Response of abalone to various levels of dietary lipid. Aquaculture, 134, 65–80. https://doi.org/10.1016/0044-8486(95)00043-2
10.1016/0044-8486(95)00043-2
CAS Web of Science® Google Scholar
McManaman, J. L., Bales, E. S., Orlicky, D. J., Jackman, M., MacLean, P. S., Cain, S., Crunk, A. E., Mansur, A., Graham, C. E., Bowman, T. A., & Greenberg, A. S. (2013). Perilipin-2-null mice are protected against diet-induced obesity, adipose inflammation, and fatty liver disease. Journal of Lipid Research, 54, 1346–1359. https://doi.org/10.1194/jlr.M035063
10.1194/jlr.M035063
CAS PubMed Web of Science® Google Scholar
Miao, S., Zhu, J., Zhao, C., Sun, L., Zhang, X., & Chen, G. (2017). Effects of C/N ratio control combined with probiotics on the immune response, disease resistance, intestinal microbiota and morphology of giant freshwater prawn (Macrobrachium rosenbergii). Aquaculture, 476, 125–133. https://doi.org/10.1016/j.aquaculture.2017.04.027
10.1016/j.aquaculture.2017.04.027
CAS Web of Science® Google Scholar
Monticelli, L. A., Buck, M. D., Flamar, A.-L., Saenz, S. A., Tait Wojno, E. D., Yudanin, N. A., Osborne, L. C., Hepworth, M. R., Tran, S. V., Rodewald, H.-R., Shah, H., Cross, J. R., Diamond, J. M., Cantu, E., Christie, J. D., Pearce, E. L., & Artis, D. (2016). Arginase 1 is an innate lymphoid-cell-intrinsic metabolic checkpoint controlling type 2 inflammation. Nature Immunology, 17, 656–665. https://doi.org/10.1038/ni.3421
10.1038/ni.3421
CAS PubMed Web of Science® Google Scholar
Mu, H., Wei, C., Xu, W., Gao, W., Zhang, W., & Mai, K. (2020). Effects of replacement of dietary fish oil by rapeseed oil on growth performance, anti-oxidative capacity and inflammatory response in large yellow croaker Larimichthys crocea. Aquaculture Reports, 16, 100251. https://doi.org/10.1016/j.aqrep.2019.100251
10.1016/j.aqrep.2019.100251
Web of Science® Google Scholar
Ni, P.-J., Jiang, W.-D., Wu, P., Liu, Y., Kuang, S.-Y., Tang, L., Tang, W.-N., Zhang, Y.-A., Zhou, X.-Q., & Feng, L. (2016). Dietary low or excess levels of lipids reduced growth performance, and impaired immune function and structure of head kidney, spleen and skin in young grass carp (Ctenopharyngodon idella) under the infection of Aeromonas hydrophila. Fish & Shellfish Immunology, 55, 28–47. https://doi.org/10.1016/j.fsi.2016.03.163
10.1016/j.fsi.2016.03.163
CAS PubMed Web of Science® Google Scholar
Norman, J. E., Aung, H. H., Wilson, D. W., & Rutledge, J. C. (2018). Inhibition of perilipin 2 expression reduces pro-inflammatory gene expression and increases lipid droplet size. Food & Function, 9, 6245–6256. https://doi.org/10.1039/C8FO01420E
10.1039/C8FO01420E
CAS PubMed Web of Science® Google Scholar
Orlicky, D. J., Libby, A. E., Bales, E. S., McMahan, R. H., Monks, J., La Rosa, F. G., & McManaman, J. L. (2019). Perilipin-2 promotes obesity and progressive fatty liver disease in mice through mechanistically distinct hepatocyte and extra-hepatocyte actions. The Journal of Physiology, 597, 1565–1584. https://doi.org/10.1113/JP277140
10.1113/JP277140
CAS PubMed Web of Science® Google Scholar
Rauta, P. R., Samanta, M., Dash, H. R., Nayak, B., & Das, S. (2014). Toll-like receptors (TLRs) in aquatic animals: Signaling pathways, expressions and immune responses. Immunology Letters, 158, 14–24. https://doi.org/10.1016/j.imlet.2013.11.013
10.1016/j.imlet.2013.11.013
CAS PubMed Web of Science® Google Scholar
Rebl, A., Goldammer, T., & Seyfert, H.-M. (2010). Toll-like receptor signaling in bony fish. Veterinary Immunology and Immunopathology, 134, 139–150. https://doi.org/10.1016/j.vetimm.2009.09.021
10.1016/j.vetimm.2009.09.021
CAS PubMed Web of Science® Google Scholar
Sayin, V. I., LeBoeuf, S. E., Singh, S. X., Davidson, S. M., Biancur, D., Guzelhan, B. S., Alvarez, S. W., Wu, W. L., Karakousi, T. R., Zavitsanou, A. M., Ubriaco, J., Muir, A., Karagiannis, D., Morris, P. J., Thomas, C. J., Possemato, R., Vander Heiden, M. G., & Papagiannakopoulos, T. (2017). Activation of the NRF2 antioxidant program generates an imbalance in central carbon metabolism in cancer. Elife, 6, e28083. https://doi.org/10.7554/eLife.28083
10.7554/eLife.28083
PubMed Web of Science® Google Scholar
Shan, S., Liu, R., Jiang, L., Zhu, Y., Li, H., Xing, W., & Yang, G. (2018). Carp toll-like receptor 8 (Tlr8): an intracellular Tlr that recruits TIRAP as adaptor and activates AP-1 pathway in immune response. Fish & Shellfish Immunology, 82, 41–49. https://doi.org/10.1016/j.fsi.2018.08.001
10.1016/j.fsi.2018.08.001
CAS PubMed Web of Science® Google Scholar
Stewart, J., Hengstler, J., & Bolt, H. (2011). Control of oxidative stress by the Keap1-Nrf2 pathway. Springer.
10.1007/s00204-011-0694-1
Google Scholar
Suzuki, Y., & Iida, T. (1992). Fish granulocytes in the process of inflammation. Annual Review of Fish Diseases, 2, 149–160. https://doi.org/10.1016/0959-8030(92)90061-2
10.1016/0959?8030(92)90061?2
Google Scholar
Sykiotis, G. P., & Bohmann, D. (2008). Keap1/Nrf2 signaling regulates oxidative stress tolerance and lifespan in Drosophila. Developmental Cell, 14, 76–85. https://doi.org/10.1016/j.devcel.2007.12.002
10.1016/j.devcel.2007.12.002
CAS PubMed Web of Science® Google Scholar
Travers, M.-A., Le Goïc, N., Huchette, S., Koken, M., & Paillard, C. (2008). Summer immune depression associated with increased susceptibility of the European abalone, Haliotis tuberculata to Vibrio harveyi infection. Fish & Shellfish Immunology, 25, 800–808. https://doi.org/10.1016/j.fsi.2008.08.003
10.1016/j.fsi.2008.08.003
CAS PubMed Web of Science® Google Scholar
Uribe, C., Folch, H., Enriquez, R., & Moran, G. (2011). Innate and adaptive immunity in teleost fish: A review. Veterinarni Medicina, 56, 486–503.
10.17221/3294-VETMED
CAS Web of Science® Google Scholar
Van Nguyen, N., Onoda, S., Van Khanh, T., Hai, P. D., Trung, N. T., Hoang, L., & Koshio, S. J. A. (2019). Evaluation of dietary heat-killed Lactobacillus plantarum strain L-137 supplementation on growth performance, immunity and stress resistance of Nile tilapia (Oreochromis niloticus). Aquaculture, 498, 371–379. https://doi.org/10.1016/j.aquaculture.2018.08.081
10.1016/j.aquaculture.2018.08.081
CAS Web of Science® Google Scholar
Vince, J. E., De Nardo, D., Gao, W., Vince, A. J., Hall, C., McArthur, K., Simpson, D., Vijayaraj, S., Lindqvist, L. M., Bouillet, P., Rizzacasa, M. A., Man, S. M., Silke, J., Masters, S. L., Lessene, G., Huang, D. C. S., Gray, D. H. D., Kile, B. T., Shao, F., & Lawlor, K. E. (2018). The mitochondrial apoptotic effectors BAX/BAK activate caspase-3 and-7 to trigger NLRP3 inflammasome and caspase-8 driven IL-1β activation. Cell Reports, 25(2339–2353), e2334. https://doi.org/10.1016/j.celrep.2018.10.103
10.1016/j.celrep.2018.10.103
Google Scholar
Wang, L., Chen, L., Qin, J., Li, E., Yu, N., Du, Z., Kong, Y., & Qi, J. (2015). Effect of dietary lipids and vitamin E on growth performance, body composition, anti-oxidative ability and resistance to Aeromonas hydrophila challenge of juvenile C hinese mitten crab Eriocheir sinensis. Aquaculture Research, 46, 2544–2558.
10.1111/are.12416
CAS Web of Science® Google Scholar
Wang, Q., Zhang, L., Yang, D., Yu, Q., Li, F., Cong, M., Ji, C., Wu, H., & Zhao, J. (2015). Molecular diversity and evolution of defensins in the manila clam Ruditapes philippinarum. Fish & Shellfish Immunology, 47, 302–312.
10.1016/j.fsi.2015.09.008
PubMed Web of Science® Google Scholar
Wang, T., Yan, J., Xu, W., Ai, Q., & Mai, K. (2016). Characterization of Cyclooxygenase-2 and its induction pathways in response to high lipid diet-induced inflammation in Larmichthys crocea. Scientific Reports, 6, 19921. https://doi.org/10.1038/srep19921
10.1038/srep19921
CAS PubMed Web of Science® Google Scholar
Wu, N., Song, Y.-L., Wang, B., Zhang, X.-Y., Zhang, X.-J., Wang, Y.-L., Cheng, Y.-Y., Chen, D.-D., Xia, X.-Q., Lu, Y.-S., & Zhang, Y.-A. (2016). Fish gut-liver immunity during homeostasis or inflammation revealed by integrative transcriptome and proteome studies. Scientific Reports, 6, 36048. https://doi.org/10.1038/srep36048
10.1038/srep36048
CAS PubMed Web of Science® Google Scholar
Xie, S., Lin, Y., Wu, T., Tian, L., Liang, J., & Tan, B. (2021). Dietary lipid levels affected growth performance, lipid accumulation, inflammatory response and apoptosis of Japanese seabass (Lateolabrax japonicus). Aquaculture Nutrition, 27(3), 807–816.
10.1111/anu.13225
CAS Web of Science® Google Scholar
Xie, S., Wei, D., Fang, W., Wan, M., Guo, T., Liu, Y., Yin, P., Tian, L., & Niu, J. (2019). Optimal dietary lipid requirement of postlarval white shrimp, Litopenaeus vannamei in relation to growth performance, stress tolerance and immune response. Aquaculture Nutrition, 25, 1231–1240.
10.1111/anu.12937
CAS Web of Science® Google Scholar
Xue, J., Xu, Y., Jin, L., Liu, G., Sun, Y., Li, S., & Zhang, J. (2008). Effects of traditional Chinese medicine on immune responses in abalone, Haliotis discus hannai Ino. Fish & Shellfish Immunology, 24, 752–758. https://doi.org/10.1016/j.fsi.2008.02.005
10.1016/j.fsi.2008.02.005
PubMed Web of Science® Google Scholar
Yang, Q., Zhang, W., Tan, B., Wang, F., Chi, S., Dong, X., Zhang, H., Liu, H., & Zhang, S. (2019). Effects of dietary n-3HUFA on juvenile white shrimp, Litopenaeus vannamei: Growth, feed utilization, antioxidant enzymes activities and fatty acid compositions. Aquaculture Research, 50, 882–894.
10.1111/are.13963
CAS Web of Science® Google Scholar
Yigit, M., Yardim, Ö., & Koshio, S. (2002). The protein sparing effects of high lipid levels in diets for rainbow trout (Oncorhynchus mykiss, W. 1792) with special reference to reduction of total nitrogen excretion.
Google Scholar
Yuan, X., Liang, X.-F., Liu, L., Fang, J., Li, J., Li, A., Cai, W., Xue, M., Wang, J., & Wang, Q. (2016). Fat deposition pattern and mechanism in response to dietary lipid levels in grass carp, Ctenopharyngodon idellus. Fish Physiology and Biochemistry, 42, 1557–1569. https://doi.org/10.1007/s10695-016-0240-4
10.1007/s10695?016?0240?4
CAS PubMed Web of Science® Google Scholar
Zhang, H.-C., Ma, K.-X., Yang, Y.-J., Shi, C.-Y., Chen, G.-W., & Liu, D.-Z. (2019). CuZnSOD and MnSOD from freshwater planarian Dugesia japonica: cDNA cloning, mRNA expression and enzyme activity in response to environmental pollutants. Aquatic Toxicology, 208, 12–19. https://doi.org/10.1016/j.aquatox.2018.12.013
10.1016/j.aquatox.2018.12.013
CAS PubMed Web of Science® Google Scholar
Zhang, S., Li, J., Wu, X., Zhong, W., Xian, J., Liao, S., Miao, Y., & Wang, A. (2013). Effects of different dietary lipid level on the growth, survival and immune-relating genes expression in Pacific white shrimp, Litopenaeus vannamei. Fish & Shellfish Immunology, 34, 1131–1138. https://doi.org/10.1016/j.fsi.2013.01.016
10.1016/j.fsi.2013.01.016
CAS PubMed Web of Science® Google Scholar
Zuo, R., Ai, Q., Mai, K., & Xu, W. (2013). Effects of conjugated linoleic acid on growth, non-specific immunity, antioxidant capacity, lipid deposition and related gene expression in juvenile large yellow croaker (Larmichthys crocea) fed soyabean oil-based diets. British Journal of Nutrition, 110, 1220–1232.
10.1017/S0007114513000378
CAS PubMed Web of Science® Google Scholar

Citing Literature

All articles

High dietary lipid level decreases the immunity and disease resistance of abalone Haliotis discus hannai and affects the perilipin-2/TLR4, JNK and Keap1/Nrf2 pathways

Abstract

1 INTRODUCTION