RESEARCH ARTICLE

Full Access

Hydrogen sulfide inhibits human T-cell leukemia virus type-1 (HTLV-1) protein expression via regulation of ATG4B

Correction(s) for this article

Huandi Liu

orcid.org/0000-0003-4242-2335

Henan Key Laboratory of Immunology and Targeted Drugs, School of Laboratory Medicine, Xinxiang Medical University, Xinxiang, China

Henan Collaborative Innovation Center of Molecular Diagnosis and Laboratory Medicine, Xinxiang Medical, University, Xinxiang, China

Search for more papers by this author

Jiaxiang Sun,

Jiaxiang Sun

Henan Key Laboratory of Immunology and Targeted Drugs, School of Laboratory Medicine, Xinxiang Medical University, Xinxiang, China

Henan Collaborative Innovation Center of Molecular Diagnosis and Laboratory Medicine, Xinxiang Medical, University, Xinxiang, China

Search for more papers by this author

Xuhong Cheng,

Xuhong Cheng

Department of Laboratory Medicine, The Seventh People's Hospital of Shanghai University of Traditional Chinese Medicine, Shanghai, China

Search for more papers by this author

Liangwei Duan,

Liangwei Duan

Henan Key Laboratory of Immunology and Targeted Drugs, School of Laboratory Medicine, Xinxiang Medical University, Xinxiang, China

Henan Collaborative Innovation Center of Molecular Diagnosis and Laboratory Medicine, Xinxiang Medical, University, Xinxiang, China

Search for more papers by this author

Shuaifeng Guo,

Shuaifeng Guo

Henan Collaborative Innovation Center of Molecular Diagnosis and Laboratory Medicine, Xinxiang Medical, University, Xinxiang, China

Search for more papers by this author

Zhongxin Zhang,

Zhongxin Zhang

Henan Collaborative Innovation Center of Molecular Diagnosis and Laboratory Medicine, Xinxiang Medical, University, Xinxiang, China

Search for more papers by this author

Jia Wan,

Jia Wan

Henan Collaborative Innovation Center of Molecular Diagnosis and Laboratory Medicine, Xinxiang Medical, University, Xinxiang, China

Search for more papers by this author

Chunduo Wang,

Chunduo Wang

Henan Collaborative Innovation Center of Molecular Diagnosis and Laboratory Medicine, Xinxiang Medical, University, Xinxiang, China

Search for more papers by this author

Xiaoying Zhi,

Xiaoying Zhi

Henan Collaborative Innovation Center of Molecular Diagnosis and Laboratory Medicine, Xinxiang Medical, University, Xinxiang, China

Search for more papers by this author

Linghui Yuan,

Linghui Yuan

Henan Collaborative Innovation Center of Molecular Diagnosis and Laboratory Medicine, Xinxiang Medical, University, Xinxiang, China

Search for more papers by this author

Hui Wang,

Corresponding Author

Hui Wang

[email protected]

Henan Key Laboratory of Immunology and Targeted Drugs, School of Laboratory Medicine, Xinxiang Medical University, Xinxiang, China

Henan Collaborative Innovation Center of Molecular Diagnosis and Laboratory Medicine, Xinxiang Medical, University, Xinxiang, China

Correspondence Hui Wang, Henan Key Laboratory of Immunology and Targeted Drugs, School of Laboratory Medicine, Xinxiang Medical University, Xinxiang, China.

Email: [email protected]

Search for more papers by this author

Huandi Liu,

Huandi Liu

orcid.org/0000-0003-4242-2335

Henan Key Laboratory of Immunology and Targeted Drugs, School of Laboratory Medicine, Xinxiang Medical University, Xinxiang, China

Henan Collaborative Innovation Center of Molecular Diagnosis and Laboratory Medicine, Xinxiang Medical, University, Xinxiang, China

Search for more papers by this author

Jiaxiang Sun,

Jiaxiang Sun

Henan Key Laboratory of Immunology and Targeted Drugs, School of Laboratory Medicine, Xinxiang Medical University, Xinxiang, China

Henan Collaborative Innovation Center of Molecular Diagnosis and Laboratory Medicine, Xinxiang Medical, University, Xinxiang, China

Search for more papers by this author

Xuhong Cheng,

Xuhong Cheng

Department of Laboratory Medicine, The Seventh People's Hospital of Shanghai University of Traditional Chinese Medicine, Shanghai, China

Search for more papers by this author

Liangwei Duan,

Liangwei Duan

Henan Key Laboratory of Immunology and Targeted Drugs, School of Laboratory Medicine, Xinxiang Medical University, Xinxiang, China

Henan Collaborative Innovation Center of Molecular Diagnosis and Laboratory Medicine, Xinxiang Medical, University, Xinxiang, China

Search for more papers by this author

Shuaifeng Guo,

Shuaifeng Guo

Henan Collaborative Innovation Center of Molecular Diagnosis and Laboratory Medicine, Xinxiang Medical, University, Xinxiang, China

Search for more papers by this author

Zhongxin Zhang,

Zhongxin Zhang

Henan Collaborative Innovation Center of Molecular Diagnosis and Laboratory Medicine, Xinxiang Medical, University, Xinxiang, China

Search for more papers by this author

Jia Wan,

Jia Wan

Henan Collaborative Innovation Center of Molecular Diagnosis and Laboratory Medicine, Xinxiang Medical, University, Xinxiang, China

Search for more papers by this author

Chunduo Wang,

Chunduo Wang

Henan Collaborative Innovation Center of Molecular Diagnosis and Laboratory Medicine, Xinxiang Medical, University, Xinxiang, China

Search for more papers by this author

Xiaoying Zhi,

Xiaoying Zhi

Henan Collaborative Innovation Center of Molecular Diagnosis and Laboratory Medicine, Xinxiang Medical, University, Xinxiang, China

Search for more papers by this author

Linghui Yuan,

Linghui Yuan

Henan Collaborative Innovation Center of Molecular Diagnosis and Laboratory Medicine, Xinxiang Medical, University, Xinxiang, China

Search for more papers by this author

Hui Wang,

Corresponding Author

Hui Wang

[email protected]

Henan Key Laboratory of Immunology and Targeted Drugs, School of Laboratory Medicine, Xinxiang Medical University, Xinxiang, China

Henan Collaborative Innovation Center of Molecular Diagnosis and Laboratory Medicine, Xinxiang Medical, University, Xinxiang, China

Correspondence Hui Wang, Henan Key Laboratory of Immunology and Targeted Drugs, School of Laboratory Medicine, Xinxiang Medical University, Xinxiang, China.

Email: [email protected]

Search for more papers by this author

First published: 26 September 2022

https://doi.org/10.1002/jmv.28176

Citations: 2

Share a link

Email
Wechat
Bluesky

Abstract

Hydrogen sulfide (H₂S) is a redox gasotransmitter. It has been shown that H₂S has a key role in host antiviral defense by inhibiting interleukin production and S-sulfhydrating Keap1 lead to Nrf2/ARE pathway activation. However, it is yet unclear whether H₂S can play an antiviral role by regulating autophagy. In this study, we found that exogenous H₂S decreased the expression of human T-cell leukemia virus type-1 (HTLV-1) protein and HTLV-1 induced autophagosomes accumulation. Transmission electron microscope assays indicated that autophagosomes accumulation decreased after H₂S administration. HTLV-1-transformed T-cell lines had a high level of CSE (H₂S endogenous enzyme) which could be induced in Hela by HTLV-1 infection. Immunoblot demonstrated that overexpression of CSE inhibited HTLV-1 protein expression and autophagy. And we got the opposite after CSE knockdown. Meanwhile, H₂S could not restrain the autophagy when ATG4B had a mutant at its site of 89. In a word, these results suggested that H₂S modulated HTLV-1 protein expression via ATG4B. Therefore, our findings suggested a new mechanism by which H₂S defended against virus infection.

Abbreviations

3-MA: 3-methyladenine
ARE: antioxidant response element
ATL: adult T-cell leukemia
CBS: cystathionine β-synthase
CO: carbon monoxide
CSE: cystathionine γ-lyase
H₂S: hydrogen sulfide
HTLV-1: human T-cell leukemia virus type-1
MST: 3-mercaptopyruvate sulfur transferase
NO: nitric oxide
RA: rapamycin

1 BACKGROUND

H₂S (hydrogen sulfide) is a colorless gas with lipid soluble. It has a smell of rotten eggs and has been supposed to be a kind of poisonous gas previously. Lately, it has been reported that H₂S could be produced in mammalian cells.^1-4 There are different concentration of H₂S in different part. For example, it is about 46 μmol L⁻¹ in rat serum and 100 μmol L⁻¹ in rat brain.^{5, 6} Endogenous H₂S is produced in the cells by three enzymes, cystathionine γ-lyase (CSE), cystathionine β-synthase (CBS), and 3-mercaptopyruvate sulfur transferase (MST).^7-9 CBS is the main enzyme in the central nervous system,^{6, 10, 11} CSE is the key enzyme in the cardiovascular system,^{12, 13} whereas MST is responsible for the production of H₂S in the kidney.^{14, 15} In addition, H₂S has a pivotal role in digestive system and respiratory system.^16-19 Consequently, H₂S is considered as the third gasotransmitter, such as carbon monoxide (CO) and nitric oxide (NO).^20-22

Sulfhydration is the main mechanism of H₂S in regulating protein activity.^{23, 24} In this modification, H₂S changes a Cys residue (–SH) of a target protein into −SSH.^{23, 24} For example, H₂S can restain Keap1 (Kelch-like ECH-associated protein-1) activity by sulfhydration of Cys 151, and then Nrf2 translocates into the nucleus and combine with antioxidant response element (ARE).^{25, 26} This results in the expression of antioxidant genes.

Autophagy is a degradation process that transmits cytoplasmic components to lysosomes via autophagosomes.^{27, 28} Lipidation of LC3 is important for early stage of autophagy membrane formation.^{29, 30} ATG4, a kind of cysteine protease, perform as executer to process LC3 lipidation and delipidation of lipidated LC3.^{31, 32} There are four ATG4 isoforms in mammal cells, such as ATG4A, ATG4B, ATG4C, and ATG4D.³³ ATG4B is the key isoform for cleaving LC3/GABARAP.³⁴ ATG4A has the ability of processing GABARAP. Compared with ATG4B, the activity of ATG4A is weak.³⁵ However, ATG4D and ATG4C have almost no activity in vitro.^{34, 36}

Adult T-cell leukemia (ATL), a hematologic malignant disease of adult, is directly related to the infection of human T-cell leukemia virus type 1 (HTLV-1).^37-39 It has a variety of symptoms like acute type, chronic type, or insidious type.^{40, 41} Chronic and insidious patients are often supported by symptomatic support treatment; Chemical and biological therapy are often used to cure acute lymphoma. However, the effect is unsatisfactory, and the median survival of the acute patients is about 2–6 months.^{40, 42-44}

Tax, HTLV-1 protein, can continuously activate autophagy and generate a lot of autophagosomes. And then, HTLV-1 is wrapped in the autophagosomes. HTLV-1 in autophagosomes not only can get away from intracellular immunity but also complete self-replication in autophagosomes.^{45, 46} The massive virus promoted the expression of Tax. Lots of Tax continue to activate autophagy and advance virus replication via positive feedback, resulting in the generation and development of ATL finally.⁴⁷

In this study, we demonstrated that CSE was induced by HTLV-1 infection and suppressed HTLV-1 protein expression. We showed that exogenous H₂S inhibited the accumulation of autophagosomes during HTLV-1 infection. Furthermore, CSE and exogenous H₂S were associated with ATG4B which is essential for autophagy early period. Collectively, our findings may shed some new lights on HTLV-1 therapy and contribute to our understanding of H₂S defenses against virus infection.

2 METHODS

2.1 Regents

The following antibodies were used for immunoblot analysis: anti-Gapdh (60004-1-Ig; Proteintech), anti-CBS (14782; Cell Signaling Technology), anti-CSE (19689; Cell Signaling Technology), anti-HTLV-1 p19 (ab9080; Abcam), anti-MST (ab224043; Abcam), anti-Tax (sc-57872; Santa Cruz Biotechnology), anti-ATG4B (15131-1-AP; Proteintech), anti-LC3A/B (18725-1-AP; Proteintech). The 3-MA (M9281), NaHS (151627), and RA (553211) were obtained from Sigma-Aldrich. SYBR Green quantitative PCR master mix were purchased from TOYOBO Ideas and Chemistry (QPK-201). MTT Cell Proliferation and Cytotoxicity Assay Kit was obtained from Beyotime Biotechnology.

2.2 ATG4B mutants' preparation

ATG4B plasmid was bought from Sino Biological (Cat. HG20407-ANG). GeneArt® Site-Directed Mutagenesis PLUS Kit was used to construct cysteine mutants. Gene-specific primer sequences were as follows:

C78A:

Forward: CACAGGCTGGGGCTGCATGCTGCGGGCTGGACAGATGATCTTTGCCCAAGCC

Reverse: GGCTTGGGCAAAGATCATCTGTCCAGCCCGCAGCATGCAGCCCCAGCCTGTG

C89A:

Forward: GATGATCTTTGCCCAAGCCCTGGTGGCCCGGCACCTAGGCCGAGATTGGAGG

Reverse: CCTCCAATCTCGGCCTAGGTGCCGGGCCACCAGGGCTTGGGCAAAGATCATC

C183A:

Forward: GTTGTGATGGAGGAAATCAGAAGGTTGCCAGGACCAGCGTTCCCTGTGCAGGC

Reverse: GCCTGCACAGGGAACGCTGGTCCTGGCAACCTTCTGATTTCCTCCATCACAAC

C189A:

Forward: GAAGGTTGTGCAGGACCAGCGTTCCCGCTGCAGGCGCCACTGCGTTTCCTGCAG

Reverse: CTGCAGGAAACGCAGTGGCGCCTGCAGCGGGAACGCTGGTCCTGCACAACCTTC

C203A:

Forward: GTTTCCTGCAGATTCCGACCGGCACGCCAACGGATTCCCTGCCGGAGCTGAG

Reverse: CTCAGCTCCGGCAGGGAATCCGTTGGCGTGCCGGTCGGAATCTGCAGGAAAC

C246A:

Forward: GGCCTACGTGGAGACGCTGAAGCACGCCTTCATGATGCCCCAGTCCCTGGGC

Reverse: GCCCAGGGACTGGGGCATCATGAAGGCGTGCTTCAGCGTCTCCACGTAGGCC

C292A:

Forward: GCCAGCCGTGGAGCCCACTGATGGCGCCTTCATCCCGGACGAGAGCTTCCAC

Reverse: GTGGAAGCTCTCGTCCGGGATGAAGGCGCCATCAGTGGGCTCCACGGCTGGC

C301A:

Forward: CTTCATCCCGGACGAGAGCTTCCACGCCCAGCACCCGCCGTGCCGCATGAGC

Reverse: GCTCATGCGGCACGGCGGGTGCTGGGCGTGGAAGCTCTCGTCCGGGATGAAG

C323A:

Forward: CCCGTCCATCGCTGTGGGGTTTTTCGCTAAGACTGAAGATGACTTCAATGATTG

Reverse: CAATCATTGAAGTCATCTTCAGTCTTAGCGAAAAACCCCACAGCGATGGACGGG

C333A:

Forward: GACTGAAGATGACTTCAATGATTGGGCCCAGCAAGTCAAAAAGCTGTCTCTG

Reverse: CAGAGACAGCTTTTTGACTTGCTGGGCCCAATCATTGAAGTCATCTTCAGTC

C361A:

Forward: GGAGCTGCAGCCTTCACATCTGGCCGCCCCCGACGTCCTGAACCTGTCCCTAG

Reverse: CTAGGGACAGGTTCAGGACGTCGGGGGCGGCCAGATGTGAAGGCTGCAGCTCC

2.3 Cell culture and transfection

Hela cells were cultured in Dulbecco's modified Eagle's medium with high glucose. MT2, MT4, C8166, and Jurkat cells were grown in RPMI-1640. All cells were provided with 10% fetal bovine serum (FBS) (Gibco), 4 mM l-glutamine under humidified conditions with 5% CO₂ at 37°C. Transfection of Hela cells was performed with Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.

2.4 Western blot

Immunoblot analysis was performed. Hela cells were transfected with various combinations of plasmids or small interfering RNA (siRNA). At 24−36 h after the transfection, the cell lysates were prepared in RIPA lysis buffer plus a protease inhibitor “cocktail” (Roche). MT2, MT4, C8166, and Jurkat cells were simulated by NaHS (100 µmol/L) for 2 or 3 days. The cell lysates were incubated with indicated antibodies and analyzed by immunoblot.

2.5 Real-time polymerase chain reaction (PCR)

Total RNA was extracted from the cultured cells with TRIzol reagent (Invitrogen) as described by the manufacturer. All gene transcripts were quantified by real-time PCR with the ABI 7500 Fast real-time PCR system (Applied Biosystems). The results were analyzed using the ${2}^{ \mbox{-} \unicode{x02206}\unicode{x02206}{C}_{{\rm{t}}}}$ method. The primers used for real-time PCR were as follows:

Tax,

Forward: 5′-CGGATACCCAGTCTACGTGT-3′,

Reverse: 5′-GAGCCGATAACGCGTCCATCG-3′;

GAPDH,

Forward: 5′-GCCAAAAGGGTCATCATCTC-3′,

Reverse: 5′-GTAGAGGCAGGGATGATGTTC-3′.

2.6 Transmission electron microscope

After indicated stimulation, MT2 cells were fixed with the transmission electron microscopy (TEM) fixative. And then let the precipitation resuspended in the fixative and fixed at 4°C for preservation and transportation. The operation was performed according to the instructions. The cuprum grids are observed under TEM (HITACHI: HT7800/HT7700) and take images.

2.7 RNA interference

The siRNA, CSE-silencer, was obtained from Genepharma. The sequences used were as follows: K1, forward, 5′-GCCGAGAGCUUGGGAGGAUTT-3′, reverse, 5′-AUCCUCCCAAGCUCUCGGCTT-3′; K2, forward, 5′-GCAGCCACUGUAACUAUUATT-3′, reverse, 5′-UAAUAGUUACAGUGGCUGCTT-3′. The negative control was purchased from Genepharma (catalog no. A06001).

2.8 Coculture

Hela cells were cultured for 24 h. MT2 cells were seeded and cocultured with Hela cells at a ratio of 1:100 (1 × 10⁴ HTLV-1 donor cells: 1 × 10⁶ uninfected recipient cells ratio) and allowed to incubate for an additional 24 h before harvesting for downstream assays.

2.9 Statistical analysis

The data are presented as the mean ± standard error from at least three independent experiments. All p-values were calculated using two-tailed Student's t tests (Graphpad) and were considered statistically no significant when p > 0.05.

3 RESULTS

3.1 H₂S treatment suppressed HTLV1 replication, reduced autophagy level, and had no effect on cells' viability

The increase of autophagy is a common manifestation of viral infection. HTLV-1 induces autophagy and completes their replication in autophagosomes. H₂S, an endogenous gas signal molecule, can inhibit autophagy.^48-50 That's the reason we explore the effect of H₂S on HTLV-1 infection. HTLV-1 positive cells, MT2, MT4, and C8166, have high level of autophagy. LC3 has two isoforms, LC3A (upper line) and LC3B (below line). LC3B is a marker of autophagy.⁵¹ The expression of LC3B in MT2 reduced after H₂S administration for 48 h (Figure 1A), and virus protein Tax and p19 also decreased. We saw the same results in MT4 (Figure 1B) and C8166 (Figure 1C). To determine whether H₂S had an effect on cell activity, MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay was performed. We found that H₂S had no effect on cell viability after NaHS administration for 2 days, and the cells viability increased after H₂S administration for 3 days (Figure 1D–F). Meanwhile, the level of Tax gene expression was inhibited by H₂S significantly (Figure 1G–I). Consistently, the accumulation of autophagosomes was decreased in H₂S-treated cells compared to the cells without H₂S administration (Figure 1J–L). These results suggested that H₂S inhibited the expression of HTLV-1 proteins, reduced the level of autophagy. And the effect of H₂S was not associated with the decrease of cell viability.

Details are in the caption following the image — **Figure 1**
Open in figure viewer PowerPoint

H2S depressed HTLV-1 replication and restrained the autophagy. MT2 cells (A), MT4 (B), and C8166 cells (C) were stimulated by NaHS. After 2 days, the cell lysates were used to detect Tax, p19, LC3B, and GAPDH as indicated. (D–F) MT2, MT4, and C8166 cells were stimulated by NaHS. After 2 or 3 days, MTT Cell Proliferation and Cytotoxicity Assay Kit was used on the basis of manufacturer's instructions. (G–I) MT2, MT4, and C8166 cells were stimulated by NaHS. After 2 or 3 days, the cells were lysated for real-time PCR assay, and the Tax mRNA was detected. (J–L) MT2, MT4, and C8166 cells were stimulated by NaHS. After 2 days, the cells were fixed with the TEM fixative. Autophagysomes were indicated by the arrows. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; HTLV-1, human T-cell leukemia virus type-1; mRNA, messenger RNA; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; PCR, polymerase chain reaction; TEM, transmission electron microscopy.

3.2 The inhibition of virus replication by H₂S was related with autophagy

We determined the role of H₂S in MT2 cells in the presence of RA (rapamycin) or 3-MA (3-methyladenine), which were believed to activate or block the autophagy. We found that RA could reduce the effect of H₂S, and 3-MA could enhance the effect of H₂S (Figure 2A). Similar results were observed in MT4 and C8166 (Figure 2B,C). It meant that H₂S depressed the expression HTLV-1 related protein via autophagy.

3.3 H₂S interacted with ATG4B

To characterize the mechanism by which H₂S regulated autophagosome accumulation, we tested whether H₂S was able to interact with ATG4B involved in canonical autophagy. ATG4B is a conservative cysteine proteinase among species,⁵² which activity dependents on the cysteine located in the active center.⁵³ ATG4B has 12 cysteines according to NCBI database (Figure 3). It has been reported that ATG4B has no activity if the cysteine at site 74 is mutated.^{54, 55} Meanwhile, H₂S signals is by modification of cysteine residues on target proteins in a process designated as sulfhydration or persulfidation. Therefore, we constructed 11 mutants which had one cysteine mutated separately except the site 74.

The plasmid of ATG4B and its cysteine mutants were transfected in Hela cells. To confirm the effect of these mutants on ATG4B activity, Hela cells were treated by RA or 3-MA and then subjected to immunoblot analysis. The results showed that RA and 3-MA could active or depress autophagy when ATG4B had these cysteine mutated (Figure 4A,B). It suggested that these cysteine were not essential for ATG4B activity. However, H₂S had lose its effect on autophagy when the cysteine at site 89 was mutated (Figure 4C). These data indicated that cysteine 89 of ATG4B was the target of H₂S in the regulation of autophagy.

3.4 CSE expression increased in early period of HTLV-1 infection

Then we tried to explore the functions of H₂S endogenous enzyme during HTLV-1 infection. Jurkat and MT2 cells were lysated, and H₂S endogenous enzymes were investigated. Immunoblot assays demonstrated that the expression of H₂S endogenous enzymes were higher in MT2 than Jurkat (Figure 5A). We wondered whether H₂S endogenous enzymes would increase in the early period of HTLV-1 infection. Hela cells were cocultured with MT2 cells and the expression levels of Tax was investigated. PCR assays demonstrated that Tax could be detected in Hela cells after cocultured for 24 h (Figure 5B). Then we detected H₂S endogenous enzymes in the early period of HTLV-1 infection. We found that the expression of CSE reached a maximum on the 48 h and the level of autophagy decreased after coculture (Figure 5C). However, the expression of CBS and MST decreased after coculture for 48 h (Figure 5C). These results suggested that CSE played a key role in early period of HTLV-1 infection. To confirm that the decrease of autophagy was associated with CSE and HTLV-1. Hela cells were cultured without FBS. Immunoblot assays found that the increase of CSE could not reduce the level of autophagy without HTLV-1 infection (Figure 5D). And then, we detected the effect of exogenous H₂S on Hela cells. The result showed that exogenous H₂S had no effect on the expression of endogenous enzymes (Figure 5E). In summary, the expression of CSE decreased the level of autophagy of HTLV-1 positive cells.

3.5 CSE could inhibit HTLV-1 replication via ATG4B

Next, we wanted to make sure whether CSE had the same effect like exogenous H₂S. Hela cells with overexpressing or low expressing of CSE were cocultured with MT2 cells and the expression levels of HTLV-1 proteins and autophagy were investigated. Immunoblot assays demonstrated that the expression of CSE was associated with lower levels of HTLV-1 proteins and autophagy (Figure 6A,B). Meanwhile, we investigated whether RA and 3-MA could impact the effect of CSE. We found that RA could reduce the effect of CSE, and 3-MA could enhanced the effect of CSE (Figure 6C,D). To confirm that ATG4B was associated with the effect of CSE. Hela cells, overexpressing of CSE and ATG4B mutant, were cocultured with MT2 cells. Immunoblot assays showed that the level of HTLV-1 protein was restored partly (Figure 6E). Taken together, these data suggested that the expression of CSE decreased HTLV-1 protein via the cysteine 89 of ATG4B.

4 DISCUSSION

As a gasotransmitter, H₂S plays an important role in the physiological and pathological process of the organism.^16-19 Nowadays, the mechanism of H₂S in the process of virus infection is unclear. It has been reported that H₂S could play an antiviral role through its antioxidant and anti-inflammatory effects, such as COVID-9, HSV, HIV, and paramyxovirus.^56-61 Our study found that both endogenous and exogenous H₂S could inhibit autophagy caused by HTLV-1 and reduced the expression of viral proteins via autophagy-related protein ATG4B.

Our results showed that HTLV-1-positive T-cell lines had a strong expression of CSE and CSE expression could be induced in Hela after HTLV-1 infection. Further studies indicated that the overexpression of CSE inhibited HTLV-1 protein expression and CSE knockdown was associated with higher levels of HTLV-1 protein expression. There was significant relevance between autophagy level and the expression of CSE. These results drove us to find the possible mechanism to explain the role of CSE in autophagy.

There is a complex relationships between autophagy and pathogenic microorganisms.⁶² Paradoxically, autophagosomes are benefit for HTLV-1 to complete its replication.^45-47 We used LC3B as the marker of autophagy and examined the effect of CSE on HTLV-1-induced autophagy. Our findings confirmed the hypothesis by three steps. First, H₂S inhibited the autophagosomes accumulation in MT2 cells. Second, CSE inhibited the autophagosomes accumulation induced by HTLV-1 infection in Hela. Third, when RA was used to activate the early stage of autophagy, we found that CSE overexpression lost the abilities to inhibit autophagosomes accumulation and HTLV-1 viral protein expression increased. These results suggested that the regulatory role of CSE in autophagosomes accumulation was important to its effect on HTLV-1 protein expression.

How could H₂S regulate autophagosomes accumulation? It has been reported that ATG4B has an important role in LC3B and autophagosomes formation.³⁴ As a cysteine enzyme, ATG4B is a good target for H₂S regulation. Our findings indicated that H₂S interacted with ATG4B. Using a serious of ATG4B cysteine mutants, we found ATG4B cysteine 89 was essential for the effect of H₂S. However, ATG4B will almost lost the ability when it has a mutant at the site of cysteine 74.⁶³ Therefore, we could not confirm whether the cysteine 74 was associated with H₂S function.

It is reported that the function of ATG4B can be changed via posttranslational modification. For example, its activity is enhanced when the serine at 383 site was phosphorylated⁶⁴; After phosphorylation of serine at 34 and 316 sites or S-nitrosation of cysteine at 189 and 292 sites, the opposite results will appear^65-67; In addition, when the level of reactive oxygen species increase, a disulfide bond will be formed between cysteines at site 292 and 361 resulting the level of autophagy increases.⁶⁸ Our study suggested that H₂S could sulfurize cysteine at site 89 and inhibit autophagy. However, we had no direct evidence to confirm the sulfhydration of ATG4B because of technical limitations.

5 CONCLUSION

Together, our study demonstrated that H₂S modulated autophagosomes accumulation by regulating ATG4B, thereby affected the expression of HTLV-1 proteins. Our research may expand our understanding of H₂S on virus infection and suggest a new role of ATGs sulfhydration in autophagy.

AUTHOR CONTRIBUTIONS

Huandi Liu and Hui Wang conceived the idea for the project. Jiaxiang Sun, Shuaifeng Guo, Xuhong Cheng, Zhongxin Zhang, Jia Wan, Chunduo Wang, Xiaoying Zhi, Linghui Yuan did the experiments. Huandi Liu designed experiments, analyzed the results, and wrote the paper.

ACKNOWLEDGMENTS

Dr. Liangwei Duan designed the primers of ATG4B mutants. MT4 and C8166 were gifts from Professor Xiaofei Zhu. We are grateful to Dr. Liangwei Duan and Professor Xiaofei Zhu very much. This study was supported by grants from Key scientific research projects in Universities of Henan Province (20A320011), the National Natural Science Foundation of China (32000612) and 111 Project (D20036).

CONFLICT OF INTEREST

The authors declare no conflict of interest.

Open Research

DATA AVAILABILITY STATEMENT

The data underlying the graphs have been presented in the main figures. The materials relating to figures are available from Huandi Liu upon reasonable request.

REFERENCES

1Wang R. Two's company, three's a crowd: can H₂S be the third endogenous gaseous transmitter? FASEB J. 2002; 16(13): 1792-1798.
10.1096/fj.02-0211hyp
CAS PubMed Web of Science® Google Scholar
2Li L, Moore PK. Putative biological roles of hydrogen sulfide in health and disease: a breath of not so fresh air? Trends Pharmacol Sci. 2008; 29(2): 84-90.
10.1016/j.tips.2007.11.003
CAS PubMed Web of Science® Google Scholar
3Szabo C. Hydrogen sulphide and its therapeutic potential. Nat Rev Drug Discov. 2007; 6(11): 917-935.
10.1038/nrd2425
CAS PubMed Web of Science® Google Scholar
4Fiorucci S, Distrutti E, Cirino G, Wallace JL. The emerging roles of hydrogen sulfide in the gastrointestinal tract and liver. Gastroenterology. 2006; 131(1): 259-271.
10.1053/j.gastro.2006.02.033
CAS PubMed Web of Science® Google Scholar
5Zhao W, Zhang J, Lu Y, Wang R. The vasorelaxant effect of H(2)S as a novel endogenous gaseous K(ATP) channel opener. EMBO J. 2001; 20(21): 6008-6016.
10.1093/emboj/20.21.6008
CAS PubMed Web of Science® Google Scholar
6Abe K, Kimura H. The possible role of hydrogen sulfide as an endogenous neuromodulator. J Neurosci. 1996; 16(3): 1066-1071.
10.1523/JNEUROSCI.16-03-01066.1996
CAS PubMed Web of Science® Google Scholar
7Singh S, Padovani D, Leslie RA, Chiku T, Banerjee R. Relative contributions of cystathionine beta-synthase and gamma-cystathionase to H₂S biogenesis via alternative trans-sulfuration reactions. J Biol Chem. 2009; 284(33): 22457-22466.
10.1074/jbc.M109.010868
CAS PubMed Web of Science® Google Scholar
8Chiku T, Padovani D, Zhu W, Singh S, Vitvitsky V, Banerjee R. H₂S biogenesis by human cystathionine gamma-lyase leads to the novel sulfur metabolites lanthionine and homolanthionine and is responsive to the grade of hyperhomocysteinemia. J Biol Chem. 2009; 284(17): 11601-11612.
10.1074/jbc.M808026200
CAS PubMed Web of Science® Google Scholar
9Beltowski J. Synthesis, metabolism, and signaling mechanisms of hydrogen sulfide: an overview. Methods Mol Biol. 2019; 2007: 1-8.
10.1007/978-1-4939-9528-8_1
CAS PubMed Google Scholar
10Bao L, Vlcek C, Paces V, Kraus JP. Identification and tissue distribution of human cystathionine beta-synthase mRNA isoforms. Arch Biochem Biophys. 1998; 350(1): 95-103.
10.1006/abbi.1997.0486
CAS PubMed Web of Science® Google Scholar
11Zuhra K, Augsburger F, Majtan T, Szabo C. Cystathionine-beta-synthase: molecular regulation and pharmacological inhibition. Biomolecules. 2020; 10(5): 697.
10.3390/biom10050697
CAS PubMed Web of Science® Google Scholar
12Ishii I, Akahoshi N, Yu XN, et al. Murine cystathionine gamma-lyase: complete cDNA and genomic sequences, promoter activity, tissue distribution and developmental expression. Biochem J. 2004; 381(Pt 1): 113-123.
10.1042/BJ20040243
CAS PubMed Web of Science® Google Scholar
13Jurkowska H, Kaczor-Kaminska M, Bronowicka-Adamska P, Wrobel M. [Cystathionine gamma-lyase]. Postepy Hig Med Dosw (Online). 2014; 68: 1-9.
10.5604/17322693.1085372
PubMed Google Scholar
14Shibuya N, Mikami Y, Kimura Y, Nagahara N, Kimura H. Vascular endothelium expresses 3-mercaptopyruvate sulfurtransferase and produces hydrogen sulfide. J Biochem. 2009; 146(5): 623-626.
10.1093/jb/mvp111
CAS PubMed Web of Science® Google Scholar
15Shibuya N, Koike S, Tanaka M, et al. A novel pathway for the production of hydrogen sulfide from d-cysteine in mammalian cells. Nat Commun. 2013; 4: 1366.
10.1038/ncomms2371
CAS PubMed Web of Science® Google Scholar
16Marutani E, Morita M, Hirai S, et al. Sulfide catabolism ameliorates hypoxic brain injury. Nat Commun. 2021; 12(1): 3108.
10.1038/s41467-021-23363-x
CAS PubMed Web of Science® Google Scholar
17Fuschillo S, Palomba L, Capparelli R, Motta A, Maniscalco M. Nitric oxide and hydrogen sulfide: a nice pair in the respiratory system. Curr Med Chem. 2020; 27(42): 7136-7148.
10.2174/0929867327666200310120550
CAS PubMed Web of Science® Google Scholar
18Zhao S, Song T, Gu Y, et al. Hydrogen sulfide alleviates liver injury through the S-sulfhydrated-Kelch-like ECH-associated protein 1/nuclear erythroid 2-related factor 2/low-density lipoprotein receptor-related protein 1 pathway. Hepatology. 2021; 73(1): 282-302.
10.1002/hep.31247
CAS PubMed Web of Science® Google Scholar
19McCook O, Denoix N, Radermacher P, Waller C, Merz T. H₂S and oxytocin systems in early life stress and cardiovascular disease. J Clin Med. 2021; 10(16): 3484.
10.3390/jcm10163484
CAS PubMed Web of Science® Google Scholar
20Szabo C. Gasotransmitters in cancer: from pathophysiology to experimental therapy. Nat Rev Drug Discov. 2016; 15(3): 185-203.
10.1038/nrd.2015.1
CAS PubMed Web of Science® Google Scholar
21Wang R. Physiological implications of hydrogen sulfide: a whiff exploration that blossomed. Physiol Rev. 2012; 92(2): 791-896.
10.1152/physrev.00017.2011
CAS PubMed Web of Science® Google Scholar
22Hartle MD, Pluth MD. A practical guide to working with H₂S at the interface of chemistry and biology. Chem Soc Rev. 2016; 45(22): 6108-6117.
10.1039/C6CS00212A
CAS PubMed Web of Science® Google Scholar
23Paul BD, Snyder SH. H₂S: a novel gasotransmitter that signals by sulfhydration. Trends Biochem Sci. 2015; 40(11): 687-700.
10.1016/j.tibs.2015.08.007
CAS PubMed Web of Science® Google Scholar
24Mustafa AK, Gadalla MM, Sen N, et al. H₂S signals through protein S-sulfhydration. Sci Signal. 2009; 2(96): ra72.
10.1126/scisignal.2000464
PubMed Web of Science® Google Scholar
25Hourihan JM, Kenna JG, Hayes JD. The gasotransmitter hydrogen sulfide induces nrf2-target genes by inactivating the keap1 ubiquitin ligase substrate adaptor through formation of a disulfide bond between cys-226 and cys-613. Antioxid Redox Signal. 2013; 19(5): 465-481.
10.1089/ars.2012.4944
CAS PubMed Web of Science® Google Scholar
26Yang G, Zhao K, Ju Y, et al. Hydrogen sulfide protects against cellular senescence via S-sulfhydration of Keap1 and activation of Nrf2. Antioxid Redox Signal. 2013; 18(15): 1906-1919.
10.1089/ars.2012.4645
CAS PubMed Web of Science® Google Scholar
27Matoba K, Noda NN. Structural catalog of core Atg proteins opens new era of autophagy research. J Biochem. 2021; 169(5): 517-525.
10.1093/jb/mvab017
CAS PubMed Web of Science® Google Scholar
28Nakatogawa H. Mechanisms governing autophagosome biogenesis. Nat Rev Mol Cell Biol. 2020; 21(8): 439-458.
10.1038/s41580-020-0241-0
CAS PubMed Web of Science® Google Scholar
29Mizushima N, Yoshimori T, Ohsumi Y. The role of Atg proteins in autophagosome formation. Annu Rev Cell Dev Biol. 2011; 27: 107-132.
10.1146/annurev-cellbio-092910-154005
CAS PubMed Web of Science® Google Scholar
30Klionsky DJ, Schulman BA. Dynamic regulation of macroautophagy by distinctive ubiquitin-like proteins. Nat Struct Mol Biol. 2014; 21(4): 336-345.
10.1038/nsmb.2787
CAS PubMed Web of Science® Google Scholar
31Agrotis A, Pengo N, Burden JJ, Ketteler R. Redundancy of human ATG4 protease isoforms in autophagy and LC3/GABARAP processing revealed in cells. Autophagy. 2019; 15(6): 976-997.
10.1080/15548627.2019.1569925
CAS PubMed Web of Science® Google Scholar
32Ketteler R, Tooze SA. ATG4: more than a protease? Trends Cell Biol. 2021; 31(7): 515-516.
10.1016/j.tcb.2021.04.003
CAS PubMed Web of Science® Google Scholar
33Marino G, Uria JA, Puente XS, Quesada V, Bordallo J, Lopez-Otin C. Human autophagins, a family of cysteine proteinases potentially implicated in cell degradation by autophagy. J Biol Chem. 2003; 278(6): 3671-3678.
10.1074/jbc.M208247200
CAS PubMed Web of Science® Google Scholar
34Li M, Hou Y, Wang J, Chen X, Shao ZM, Yin XM. Kinetics comparisons of mammalian Atg4 homologues indicate selective preferences toward diverse Atg8 substrates. J Biol Chem. 2011; 286(9): 7327-7338.
10.1074/jbc.M110.199059
CAS PubMed Web of Science® Google Scholar
35Scherz-Shouval R, Sagiv Y, Shorer H, Elazar Z. The COOH terminus of GATE-16, an intra-Golgi transport modulator, is cleaved by the human cysteine protease HsApg4A. J Biol Chem. 2003; 278(16): 14053-14058.
10.1074/jbc.M212108200
CAS PubMed Web of Science® Google Scholar
36Betin VM, Lane JD. Caspase cleavage of Atg4D stimulates GABARAP-L1 processing and triggers mitochondrial targeting and apoptosis. J Cell Sci. 2009; 122(Pt 14): 2554-2566.
10.1242/jcs.046250
CAS PubMed Web of Science® Google Scholar
37Gallo RC. The discovery of the first human retrovirus: HTLV-1 and HTLV-2. Retrovirology. 2005; 2: 17.
10.1186/1742-4690-2-17
CAS PubMed Web of Science® Google Scholar
38Yoshida M. Discovery of HTLV-1, the first human retrovirus, its unique regulatory mechanisms, and insights into pathogenesis. Oncogene. 2005; 24(39): 5931-5937.
10.1038/sj.onc.1208981
CAS PubMed Web of Science® Google Scholar
39Gessain A, Cassar O. Epidemiological aspects and world distribution of HTLV-1 infection. Front Microbiol. 2012; 3: 388.
10.3389/fmicb.2012.00388
PubMed Web of Science® Google Scholar
40Goncalves DU, Proietti FA, Ribas JG, et al. Epidemiology, treatment, and prevention of human T-cell leukemia virus type 1-associated diseases. Clin Microbiol Rev. 2010; 23(3): 577-589.
10.1128/CMR.00063-09
CAS PubMed Web of Science® Google Scholar
41Tagaya Y, Matsuoka M, Gallo R. 40 years of the human T-cell leukemia virus: past, present, and future. F1000Res. 2019; 8: F1000.
10.12688/f1000research.17479.1
PubMed Google Scholar
42Futsch N, Mahieux R, Dutartre H. HTLV-1, the other pathogenic yet neglected human retrovirus: from transmission to therapeutic treatment. Viruses. 2017; 10(1): 1.
10.3390/v10010001
PubMed Google Scholar
43Shimoyama M. Diagnostic criteria and classification of clinical subtypes of adult T-cell leukaemia-lymphoma. A report from the lymphoma study group (1984-87). Br J Haematol. 1991; 79(3): 428-437.
10.1111/j.1365-2141.1991.tb08051.x
CAS PubMed Web of Science® Google Scholar
44Tsukasaki K, Hermine O, Bazarbachi A, et al. Definition, prognostic factors, treatment, and response criteria of adult T-cell leukemia-lymphoma: a proposal from an international consensus meeting. J Clin Oncol. 2009; 27(3): 453-459.
10.1200/JCO.2008.18.2428
PubMed Web of Science® Google Scholar
45Ren T, Takahashi Y, Liu X, et al. HTLV-1 Tax deregulates autophagy by recruiting autophagic molecules into lipid raft microdomains. Oncogene. 2015; 34(3): 334-345.
10.1038/onc.2013.552
CAS PubMed Web of Science® Google Scholar
46Tang SW, Chen CY, Klase Z, Zane L, Jeang KT. The cellular autophagy pathway modulates human T-cell leukemia virus type 1 replication. J Virol. 2013; 87(3): 1699-1707.
10.1128/JVI.02147-12
CAS PubMed Web of Science® Google Scholar
47Ducasa N, Grasso D, Benencio P, et al. Autophagy in human T-Cell leukemia virus type 1 (HTLV-1) induced leukemia. Front Oncol. 2021; 11:641269.
10.3389/fonc.2021.641269
CAS PubMed Web of Science® Google Scholar
48Wu D, Wang H, Teng T, Duan S, Ji A, Li Y. Hydrogen sulfide and autophagy: a double-edged sword. Pharmacol Res. 2018; 131: 120-127.
10.1016/j.phrs.2018.03.002
CAS PubMed Web of Science® Google Scholar
49Wang J, Wu D, Wang H. Hydrogen sulfide plays an important protective role by influencing autophagy in diseases. Physiol Res. 2019; 68(3): 335-345.
CAS PubMed Web of Science® Google Scholar
50Yue L, Hu Y, Fu H, Qi L, Sun H. Hydrogen sulfide regulates autophagy in nucleus pulposus cells under hypoxia. JOR Spine. 2021; 4(4):e1181.
10.1002/jsp2.1181
PubMed Web of Science® Google Scholar
51Schaaf MB, Keulers TG, Vooijs MA, Rouschop KM. LC3/GABARAP family proteins: autophagy-(un)related functions. FASEB J. 2016; 30(12): 3961-3978.
10.1096/fj.201600698R
CAS PubMed Web of Science® Google Scholar
52Robert X, Gouet P. Deciphering key features in protein structures with the new ENDscript server. Nucleic Acids Res. 2014; 42(Web Server issue): W320-W324.
10.1093/nar/gku316
CAS PubMed Web of Science® Google Scholar
53Till A, Subramani S. A balancing act for autophagin. J Clin Invest. 2010; 120(7): 2273-2276.
10.1172/JCI43238
CAS PubMed Web of Science® Google Scholar
54Sugawara K, Suzuki NN, Fujioka Y, Mizushima N, Ohsumi Y, Inagaki F. Structural basis for the specificity and catalysis of human Atg4B responsible for mammalian autophagy. J Biol Chem. 2005; 280(48): 40058-40065.
10.1074/jbc.M509158200
CAS PubMed Web of Science® Google Scholar
55Kumanomidou T, Mizushima T, Komatsu M, et al. The crystal structure of human Atg4b, a processing and de-conjugating enzyme for autophagosome-forming modifiers. J Mol Biol. 2006; 355(4): 612-618.
10.1016/j.jmb.2005.11.018
CAS PubMed Web of Science® Google Scholar
56Bazhanov N, Escaffre O, Freiberg AN, Garofalo RP, Casola A. Broad-range antiviral activity of hydrogen sulfide against highly pathogenic RNA viruses. Sci Rep. 2017; 7:41029.
10.1038/srep41029
CAS PubMed Web of Science® Google Scholar
57Bazhanov N, Ivanciuc T, Wu H, et al. Thiol-activated hydrogen sulfide donors antiviral and anti-inflammatory activity in respiratory syncytial virus infection. Viruses. 2018; 10(5): 249.
10.3390/v10050249
PubMed Google Scholar
58Pal VK, Bandyopadhyay P, Singh A. Hydrogen sulfide in physiology and pathogenesis of bacteria and viruses. IUBMB Life. 2018; 70(5): 393-410.
10.1002/iub.1740
CAS PubMed Web of Science® Google Scholar
59Citi V, Martelli A, Brancaleone V, et al. Anti-inflammatory and antiviral roles of hydrogen sulfide: rationale for considering H₂S donors in COVID-19 therapy. Br J Pharmacol. 2020; 177(21): 4931-4941.
10.1111/bph.15230
CAS PubMed Web of Science® Google Scholar
60Evgen'ev MB, Frenkel A. Possible application of H₂S-producing compounds in therapy of coronavirus (COVID-19) infection and pneumonia. Cell Stress Chaperones. 2020; 25(5): 713-715.
10.1007/s12192-020-01120-1
PubMed Web of Science® Google Scholar
61Yang G. H₂S as a potential defense against COVID-19? Am J Physiol Cell Physiol. 2020; 319(2): C244-C249.
10.1152/ajpcell.00187.2020
CAS PubMed Web of Science® Google Scholar
62Zheng Q, Duan L, Zhang Y, Li J, Zhang S, Wang H. A dynamically evolving war between autophagy and pathogenic microorganisms. J Zhejiang Univ Sci B. 2022; 23(1): 19-41.
10.1631/jzus.B2100285
PubMed Web of Science® Google Scholar
63Betin VM, Singleton BK, Parsons SF, Anstee DJ, Lane JD. Autophagy facilitates organelle clearance during differentiation of human erythroblasts: evidence for a role for ATG4 paralogs during autophagosome maturation. Autophagy. 2013; 9(6): 881-893.
10.4161/auto.24172
CAS PubMed Web of Science® Google Scholar
64Huang T, Kim CK, Alvarez AA, et al. MST4 phosphorylation of ATG4B regulates autophagic activity, tumorigenicity, and radioresistance in glioblastoma. Cancer Cell. 2017; 32(6): 840-855.
10.1016/j.ccell.2017.11.005
CAS PubMed Web of Science® Google Scholar
65Pengo N, Agrotis A, Prak K, Jones J, Ketteler R. A reversible phospho-switch mediated by ULK1 regulates the activity of autophagy protease ATG4B. Nat Commun. 2017; 8(1): 294.
10.1038/s41467-017-00303-2
CAS PubMed Web of Science® Google Scholar
66Ni Z, He J, Wu Y, et al. AKT-mediated phosphorylation of ATG4B impairs mitochondrial activity and enhances the Warburg effect in hepatocellular carcinoma cells. Autophagy. 2018; 14(4): 685-701.
10.1080/15548627.2017.1407887
CAS PubMed Web of Science® Google Scholar
67Li Y, Zhang Y, Wang L, et al. Autophagy impairment mediated by S-nitrosation of ATG4B leads to neurotoxicity in response to hyperglycemia. Autophagy. 2017; 13(7): 1145-1160.
10.1080/15548627.2017.1320467
CAS PubMed Web of Science® Google Scholar
68Zheng X, Yang Z, Gu Q, et al. The protease activity of human ATG4B is regulated by reversible oxidative modification. Autophagy. 2020; 16(10): 1838-1850.
10.1080/15548627.2019.1709763
CAS PubMed Web of Science® Google Scholar

Citing Literature

Volume95, Issue1

January 2023

e28176

Hydrogen sulfide inhibits human T-cell leukemia virus type-1 (HTLV-1) protein expression via regulation of ATG4B

Correction(s) for this article

Corrigendum