Genetic analysis of poliovirus strains isolated from sewage in Poland
Abstract
The study describes genetic characterization of poliovirus (PV) strains isolated from sewage samples in Poland. The analyses were performed for the detection of any putative polio revertants and recombinants in three genomic regions by sequencing analysis. Thirty-six strains were analyzed. The analyzed strains were identified by neutralization assay as 7 strains of serotype P1, 10 strains of serotype P2, and 19 strains of serotype P3. Sewage isolates were sequenced in 5′UTR, VP1, and 3D genomic regions. All detected PVs were classified as vaccine strains on the basis of VP1 sequence. Mutational differences in the VP1 sequences of isolated viruses ranged from 0.0% to 0.4%, indicating a limited replication period. The genetic analysis of the 3D region showed that some strains have recombinant genomes. Nine strains were found as dipartite recombinants (seven strains—S3/S2, one strain—S2/S1, one strain—S3/S1), while one strain was found as tripartite recombinant (S3/S2/S1). No recombinants with non-PV enteroviruses were identified. None of wild-type PVs or vaccine-derived polioviruses (VDPVs) were detected. This study showed the absence of wild or VDPV circulation in the country and demonstrated the usefulness of environmental surveillance in addition to acute flaccid paralysis (AFP) surveillance in support of polio eradication initiatives. J. Med. Virol. 86:1243–1248, 2014. © 2013 Wiley Periodicals, Inc.
INTRODUCTION
Poliovirus (PV), the causative agent of poliomyelitis, belongs to the Enterovirus genus in the Picornaviridae family. PV is a positive, single-strand RNA virus, with genome of approximately 7.5 kbp in length, which consists of the following segments: 5′UTR, coding region, and 3′UTR. The translation product is a single polyprotein which is later enzymatically cleaved by proteases into structural (VP4, VP2, VP3, VP1) and non-structural (2A, 2B, 2C, 3A, 3B, 3C, 3D) proteins. RNA of PV is enclosed by a capsid, which is composed of 60 subunits formed from 4 proteins (VP4, VP2, VP3, and VP1). PVs have been classified into three serotypes (PV1, PV2, and PV3) based on their seroneutralization pattern [Mueller et al., 2005].
PVs are transmitted by the fecal–oral route; they multiply in the gastrointestinal tract and are excreted in large numbers in the feces of infected persons (both symptomatic and asymptomatic). The main source of PVs in the environment is human fecal matter. Viruses cannot replicate outside their host's tissues and therefore cannot multiply in the environment; however, they can survive in the environment. Sewage is a rich source for detection of PVs shed by infected people in the surrounding area. Sewage investigation by molecular and virological methods is applied to obtain information about the circulation of PVs in the community [Fong and Lipp, 2005]. The usefulness of community sewage testing to monitor the presence of PVs in the face of the circulation of wild-type PV in the community has been demonstrated, for example, in the Netherlands [Van der Avoort et al., 1995], Finland [Poyry et al., 1988], Israel [Manor et al., 1999], and Egypt [Blomqvist et al., 2012].
In 1988, the Global Poliomyelitis Eradication Initiative was launched. Acute flaccid paralysis (AFP) surveillance is a key strategy for monitoring the progress of polio eradication and is a sensitive instrument for detecting potential poliomyelitis cases and PV infection. In countries conducting the AFP surveillance, every case of AFP in patients under 15 years of age should be reported. Two stool specimens should be collected within 14 days after onset of paralysis and virus isolation should be performed afterward. The global non-polio AFP rate is constant and an effective polio surveillance system should detect and report approximately one AFP case per 100,000 inhabitants under 15 years of age. In Poland, the quality of AFP surveillance is low. A significant number of sub-national territories do not report any cases of AFP. Therefore environmental surveillance is a good opportunity for Poland to monitor PV strains circulating in population. Sewage surveillance system has been shown to be more sensitive than the reporting of clinical cases of serious illness in a community [Bosch et al., 2008; Sinclair et al., 2008].
The other eradication strategy recommended by the World Health Organization (WHO) is maintaining high coverage of vaccination, which in Poland is actually very high. The National Immunization Program in Poland is based on mandatory and free-of-charge vaccinations. Vaccination schedule includes three doses of inactivated polio vaccine (IPV) in children under 2 years and supplementary oral polio vaccine (OPV) at the age of 6 years. OPV consists of three attenuated Sabin strains (Sabin 1–3), which after oral application colonize the intestines, where they rapidly multiply. OPV strains can mutate during their replication in the intestine. PVs, as other enteroviruses, are characterized by high rates of mutation and recombination. The majority of polio strains isolated from stools after vaccination were found to be recombinant [Cuervo et al., 2001]. Recombination occurs between Sabin strains, but may also occur between Sabin and wild PV strains or even between polio and non-polio enteroviruses [Domingo et al., 2008]. Some mutations may result in the recovery of the capacity for higher neurovirulence and lead to vaccine-associated paralytic poliomyelitis (VAPP). Person-to-person transmission of neurovirulent vaccine-derived poliovirus (VDPV) in a population with poor coverage of vaccination may result in an outbreak of poliomyelitis caused by circulating vaccine-derived poliovirus (cVDPV) [Duintjer Tebbens et al., 2013]. Few outbreaks caused by cVDPV have been reported [Wringe et al., 2008; Minor, 2009; Burns et al., 2013].
The present study was conducted to obtain information about polio strains circulating in Poland and to confirm the absence of wild-type PVs. All 36 PV strains isolated from sewage were characterized by molecular methods. These analyses were performed for the detection of any putative polio revertants and recombinants in three genomic regions by sequence analysis.
MATERIALS AND METHODS
Viruses
Thirty-six isolates of PVs were isolated from raw sewage collected in 14 towns in Poland between January and December 2011. Total amount of 165 sewage samples was processed according to the protocol described earlier [Zurbriggen et al., 2008] and inoculated into L20B, RD (according to WHO recommendations [WHO, 2004]), and Caco-2 cells. Samples demonstrating viral cytopathic effect (CPE) were identified by neutralization assay using specific antisera (National Institute for Public Health and the Environment, the Netherlands), according to instructions.
RNA Extraction and RT-PCR
Viral RNA was extracted from 140 µl of the infected L20B cell culture using QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) following the manufacturer's instructions. VP1 and 3D regions were amplified by one-step RT-PCR. 5′UTR was amplified by one-step RT-PCR followed by a second amplification reaction with nested primers. All primers used at this stage were placed in Table I. RT-PCR amplification was performed: one cycle of reverse transcription at 50°C for 30 min; one cycle of denaturation at 95°C for 15 min; 35 cycles of denaturation at 94°C for 30 sec; annealing at 42°C for 30 sec; elongation at 72°C for 30 sec followed by one cycle of elongation at 72°C for 5 min. Reaction mixtures were then held at 4°C. Nested PCR amplification was performed: one cycle of denaturation at 94°C for 15 min; 35 cycles of denaturation at 94°C for 30 sec; annealing at 42°C for 30 sec; elongation at 72°C for 30 sec followed by one cycle of elongation at 72°C for 5 min. Reaction mixtures were then held at 4°C. PCR amplification was carried out using Biometra TProfessional 384. Amplified products were analyzed in 1.5% agarose gels, GelRed-stained, and examined under a UV DNA transilluminator.
| Primer | Sequence (5′ → 3′) | Location | Product length (bp) | Region | Refs. |
|---|---|---|---|---|---|
| 1 | CAAGCACTTCTGTTTCCCCGG | 168–191 | 441 | 5′UTR | Pusch et al. [2005] |
| 2 | ATTGTCACCATAAGCAGCCA | 609–581 | |||
| 5 | TACTTCGAGAARCCYAGTA | 248–267 | 318 | 5′UTR | Pusch et al. [2005] |
| 80 | AACACGGACACCCAAAGTA | 566–547 | |||
| 165 | GGTTTTGTGTCAGCITGYAAYGA | 2399–2421 | 1,105 | VP1 | Kilpatrick et al. [2011] |
| 166 | AAGAGGTCTCTRTTCCACAT | 3485–3504 | |||
| 37 | ACTAGCGTCAACTTCATGGG | 6990–7009 | 1,102 | 3D | In-house assay RKI |
| 115 | TCATCGGGATGCATGTTGGTGG | 5907–5928 |
Sequencing
The resulting DNA templates were processed in cycle sequencing reaction with a BigDye 3.1 according to the manufacturer's protocol and with primers: 5/80, 165/166, and 37/115 (Table I). The cycle sequencing program was 25 cycles of denaturation at 96°C for 30 sec; annealing at 54°C for 15 sec; and elongation at 60°C for 4 min. The product of the sequencing reaction was run in an automated genetic analyzer (Applied Biosystems, Foster City, CA, model 3500).
Sequence Analysis
The serotype was determined by comparing the sequences obtained for three regions with the sequences of the same region of Sabin reference strains using databases: BLAST (Basic Local Alignment Search Tool) and Enterovirus Genotyping Tool Version 0.1 (National Institute for Public Health and the Environment, the Netherlands) [Kroneman et al., 2011]. The sequences of isolated polio strains (three regions: 5′UTR, VP1, 3D) were aligned with the Sabin strains (AY184219, AY184220, and AY184221 for Sabin 1, Sabin 2, and Sabin 3, respectively), and molecular and phylogenetic analyses were performed using BioEdit v 7.1.3 software and Geneious 6.03.
RESULTS
The aim of this study was to determine the type of PVs circulating in the population of Poland. One hundred sixty-five sewage samples from 14 towns were collected, inoculated, isolated, identified, and characterized. In total, 36 PV strains were isolated. The reactivity of virus isolates with type-specific antisera revealed 7 strains of serotype P1, 10 strains of serotype P2, and 19 strains of serotype P3. A total of 36 were used in the genetic analysis. The nucleotide sequences of 5′UTR, VP1, and 3D were obtained for all of 36 PV strains with the exception of strain numbers 24 and 30. The analyzed regions comprised approximately 300 nucleotides in the 5′UTR, and approximately 900 nucleotides in the VP1 region and 3D region.
The strains shared 99.6–100% nucleotide identities in the VP1 region with parental Sabin strains of corresponding serotypes, indicating that PV strains had originated from OPV (>99% VP1 sequence identity). The number of nucleotide substitutions in VP1 coding region varied from 0 to 4, and all VP1 sequences are designed as Sabin strains according to WHO instructions (≤9 nucleotide differences for serotype 1, ≤5 nucleotide differences for serotype 2, and ≤9 nucleotide differences for serotype 3) (Table II). The low extent of sequence divergence suggests that the viruses have been replicated in humans shortly. Sequencing of the polio strains isolated from sewage showed that the VP1 sequence fully correlated with the serotype determined by the conventional neutralization test (Table II).
| No. of strain | Sampling site | Serotyping test result | Nucleotide differences in VP1 | Percentage of homology | Molecular typing result | ||
|---|---|---|---|---|---|---|---|
| 5′UTR | VP1 | 3Dpol | |||||
| 1 | Mińsk Maz. | PV2 | 1 | 99.1 | 99.9 | 100 | S2 |
| 2 | Warszawa | PV3 | 4 | 99.4 | 99.6 | 84.2 | S3/S2 |
| 3 | Opole | PV1 | 2 | 99.7 | 99.8 | 100 | S1 |
| 4 | Pilchowice | PV2 | 0 | 99.1 | 100 | 96.7 | S2/S1 |
| 5 | Piotrków Tryb. | PV3 | 0 | 99.4 | 100 | 100 | S3 |
| 6 | Bielsko Biała | PV2 | 2 | 99.1 | 99.8 | 100 | S2 |
| 7 | Jelenia Góra | PV1 | 1 | 99.7 | 99.9 | 99.8 | S1 |
| 8 | Mińsk Maz. | PV2 | 3 | 98.8 | 99.7 | 99.9 | S2 |
| 9 | Radom | PV3 | 0 | 99.4 | 100 | 100 | S3 |
| 10 | Piotrków Tryb. | PV3 | 2 | 99.4 | 99.8 | 82.5 | S3/S1 |
| 11 | Opole | PV1 | 4 | 99.7 | 99.6 | 99.8 | S1 |
| 12 | Opole | PV1 | 0 | 99.4 | 100 | 99.9 | S1 |
| 13 | Pilchowice | PV3 | 1 | 99.4 | 99.9 | 99.9 | S3 |
| 14 | Pilchowice | PV1 | 2 | 99.4 | 99.8 | 99.9 | S1 |
| 15 | Koszalin | PV3 | 1 | 99.4 | 99.9 | 100 | S3 |
| 16 | Radom | PV3 | 2 | 99.4 | 99.8 | 100 | S3 |
| 17 | Gdynia | PV3 | 1 | 99.4 | 99.9 | 83.8 | S3/S2 |
| 18 | Warszawa | PV3 | 1 | 99.4 | 99.9 | 83.8 | S3/S2 |
| 19 | Koszalin | PV3 | 1 | 99.4 | 99.9 | 87.0 | S3/S2/S3 |
| 20 | Warszawa | PV3 | 0 | 99.4 | 100 | 100 | S3 |
| 21 | Warszawa | PV3 | 1 | 99.4 | 99.9 | 84.20 | S3/S2 |
| 22 | Gdynia | PV1 | 2 | 99.7 | 99.8 | 100 | S1 |
| 23 | Gdynia | PV2 | 2 | 99.1 | 99.8 | 99.8 | S2 |
| 24 | Gdynia | PV3 | 1 | ND | 99.9 | 83.8 | S3/S2 |
| 25 | Chełm | PV3 | 1 | 99.4 | 99.9 | 100 | S3 |
| 26 | Chełm | PV2 | 1 | 99.1 | 99.9 | 100 | S2 |
| 27 | Pilchowice | PV3 | 2 | 99.4 | 99.8 | 83.2 | S3/S2 |
| 28 | Pilchowice | PV1 | 3 | 99.7 | 99.7 | 99.9 | S1 |
| 29 | Pilchowice | PV2 | 0 | 99.4 | 100 | 100 | S2 |
| 30 | Pilchowice | PV3 | 4 | 99.4 | 99.6 | ND | S3 |
| 31 | Pilchowice | PV2 | 1 | 99.1 | 99.9 | 100 | S2 |
| 32 | Opole | PV2 | 1 | 99.1 | 99.9 | 100 | S2 |
| 33 | Opole | PV3 | 1 | 98.4 | 99.9 | 99.9 | S3 |
| 34 | Warka | PV3 | 1 | 99.4 | 99.9 | 82.5 | S3/S2/S1 |
| 35 | Radom | PV3 | 1 | 99.4 | 99.9 | 100 | S3 |
| 36 | Białystok | PV2 | 0 | 99.1 | 100 | 99.9 | S2 |
The nucleotide sequences of 5′UTR region also correlated with the serotype determined by the neutralization test. The strains shared 98.8–99.7% nucleotide identities with parental Sabin strains of corresponding serotypes in this genomic region.
Analyses of 3D polymerase coding sequences showed that not all strains have the closest similarity to Sabin strains of corresponding serotypes in this genomic region, indicating that some strains have recombinant genomes. Intertypic recombination of Sabin strains is a common phenomenon in recipients of OPV. Nine strains were found as dipartite recombinants (seven strains—S3/S2, one strain—S2/S1, one strain—S3/S1), while one strain was found as a tripartite recombinant (S3/S2/S1).
The sequences obtained were first aligned with both Sabin strain sequences participating in the putative recombinant site. The two alignments were combined so as to determine the minimum common sequence flanked by two heterotypic nucleotides. This sequence represents the site of recombination between the two genomes. The determination of the minimum common sequence flanking between two heterotypic nucleotides revealed the recombination site of the two genomes. Such sites were found for isolates 4, 19, and 34, which were found recombinant in the 3D region at different nucleotide positions. Recombination sites of strains 4 and 34 (S2/S1) were located between nucleotides 6708 and 6715, and 6364 and 6371 (numbering according to Sabin 2), respectively. Recombination site of strain 19 (S2/S3) was located between nucleotide positions 6736 and 6741 (numbering according to Sabin 2), as shown in Figure 1.
DISCUSSION
The absence of wild PV circulation in Poland is monitored routinely through surveillance of AFP cases and by testing stool specimens in the National Polio Laboratory (WHO accredited). Since 2007, rapid decrease in the non-polio AFP rate has been observed; the rate reached 0.7 in 2011. Only two strains of polio (Sabin-like) were isolated under AFP surveillance during the last 5 years. A significant number of sub-national territories do not report any AFP cases. Therefore environmental surveillance is important in Poland to monitor PV strains circulating in population, bearing in mind that OPV vaccine is still used. Reports in which wild PV have been isolated from wastewater in the absence of AFP cases also encourage the introduction of environmental surveillance.
In this study, 36 polio strains isolated from sewage were characterized genetically in order to obtain information about PVs circulating in the population of Poland. The reactivity of virus isolates with type-specific antisera revealed 7 strains of serotype P1, 10 strains of serotype P2, and 19 strains of serotype P3. In particular, as it is shown in the results, as well as in previous studies, the most frequent isolated strain was Sabin 3 (52.8%). This serotype frequently causes of VAPP [Kew et al., 2005]. In the current study, all PVs detected were identified as Sabin strains on the basis of VP1 sequence. The genetic analysis of the 3D region showed that some strains have recombinant genomes. Recombination between viral RNA genomes is a well-known phenomenon for enteroviruses [Combelas et al., 2011]. Out of 36 PV strains, 10 (27.8%) were found to be recombinants. Nine strains were found as dipartite recombinants (seven strains—S3/S2, one strain—S2/S1, one strain—S3/S1), while one strain was found as tripartite recombinant (S3/S2/S1). The recombination site of three recombinants was located in the 3D genomic region. Recombination sites are located in genomic regions having a potential to form a secondary structure and most often outside of the capsid encoding region [Lukashev et al., 2005; Simmonds and Welch, 2006]. Recombination is most often detected in Sabin 2- and Sabin 3-derived isolates [Baicus et al., 2011]. However, sequences of Sabin type 1 origin are regularly found in S2/S1 and S3/S1 recombinant strains [Cuervo et al., 2001].
Screening of environmental isolates is a useful method for monitoring of PVs circulating in the population in countries which, like Poland, are still using OPV. Environmental surveillance has the potential of identifying PVs in the environment even in the absence of paralytic poliomyelitis cases, since highly divergent VDPVs were isolated in Finland, Israel, and Estonia in the absence of suspected poliomyelitis cases [Manor et al., 1999; Blomqvist et al., 2004; Shulman et al., 2006]. Environmental screening may prevent PV outbreak thanks to obtaining information about circulating viruses. Such surveillance could be also used as a guide to estimating methods for early warning [Lodder et al., 2012]. In addition environmental PV study is a very useful method for assessing the effectiveness of oral PV vaccination [Cochi et al., 1995].
CONCLUSIONS
In conclusion, the introduction of environmental surveillance of PV circulation is very important in countries which, like Poland, have been using OPV vaccine. In addition to AFP surveillance, environmental surveillance can be used to monitor the wild PV and VDPV circulation in populations in support of polio eradication initiatives.
