Multi-Organ Transplant Program, London Health Sciences Centre, C8-106, 339 Windermere Road, London, Ontario, N6A 5A5, Canada, Fax: +1-519-663-3295Search for more papers by this author

Kathy M. He,

Kathy M. He

Multi-Organ Transplant Program, London Health Sciences Centre, London, Canada

Search for more papers by this author

Yuexia Ma,

Yuexia Ma

Multi-Organ Transplant Program, London Health Sciences Centre, London, Canada

Search for more papers by this author

Shuang Wang,

Shuang Wang

Multi-Organ Transplant Program, London Health Sciences Centre, London, Canada

Department of Medicine, University of Western Ontario, London, Canada

Search for more papers by this author

Wei-Ping Min,

Wei-Ping Min

Multi-Organ Transplant Program, London Health Sciences Centre, London, Canada

Department of Surgery, University of Western Ontario, London, Canada

Lawson Health Research Institute, London, Canada.

Search for more papers by this author

Robert Zhong,

Robert Zhong

Multi-Organ Transplant Program, London Health Sciences Centre, London, Canada

Department of Surgery, University of Western Ontario, London, Canada

Lawson Health Research Institute, London, Canada.

Search for more papers by this author

Anthony Jevnikar,

Anthony Jevnikar

Multi-Organ Transplant Program, London Health Sciences Centre, London, Canada

Department of Medicine, University of Western Ontario, London, Canada

Lawson Health Research Institute, London, Canada.

Search for more papers by this author

Zhu-Xu Zhang,

Corresponding Author

Zhu-Xu Zhang

[email protected]

Multi-Organ Transplant Program, London Health Sciences Centre, London, Canada

Department of Medicine, University of Western Ontario, London, Canada

Lawson Health Research Institute, London, Canada.

Multi-Organ Transplant Program, London Health Sciences Centre, C8-106, 339 Windermere Road, London, Ontario, N6A 5A5, Canada, Fax: +1-519-663-3295Search for more papers by this author

First published: 29 November 2007

https://doi.org/10.1002/eji.200737408

Citations: 27

Share a link

Email
Wechat
Bluesky

Abstract

Bone marrow (BM) transplantation is an efficient approach to develop donor-specific tolerance and prevent chronic rejection. Allogeneic BM transplantation is limited by donor T cell-mediated graft-versus-host disease, requirement of cytoreduction and high numbers of BM cells. In addition of these drawbacks, recent studies demonstrate that not only T cells, but also NK cells can mediate BM rejection, and long-term mixed chimerism depends on NK cell tolerance. Thus, NK cell is another potential barrier against engraftment of BM and an important target in efforts to induce transplant tolerance. We have previously identified a novel type of Treg with the phenotype TCRαβ⁺CD3⁺CD4^–CD8^– (double-negative, DN). We and others have demonstrated that DN-Treg can effectively suppress anti-donor T cell responses. In this study, we found that donor-derived DN-Treg can suppress NK cell-mediated allogeneic BM graft rejection in both parent-to-F1 and fully MHC-mismatched BM transplantation models. Perforin and FasL in DN-Treg play important roles in the suppression of NK cells. Furthermore, adoptive transfer of DN-Treg can promote a stable mixed chimerism and donor-specific tolerance without inducing graft-versus-host disease. These results demonstrate a potential approach to control innate immune responses and promote allogeneic BM engraftment.

Abbreviations:

B6:: C57BL/6
DN:: TCRαβ⁺CD3⁺CD4^–CD8^– (double-negative)
GVHD:: graft-vs.-host disease
GZM:: granzyme
PFN:: perforin
TCD:: T cell-depleted

Introduction

Establishing donor-specific transplant tolerance is beneficial for several reasons: it can prevent chronic rejection and avoid side effects related to long-term immunosuppressive drug treatment. It also can help patients to preserve their own natural immunity against infections and tumors. Achieving mixed chimerism via BM transplantation is an efficient approach that directs the immune system to regard the donor as ‘self’. By generating specific immunologic tolerance to donor transplants, chronic rejection as well as the need for ongoing immunosuppression can be avoided 1–3.

Rejection of MHC-mismatched allografts is largely mediated by a recipient's CD4⁺ and CD8⁺ T cells. Recent studies, however, have demonstrated that NK cells are another potential barrier in allograft rejection and tolerance 4–7. Furthermore, studies have shown that NK cells can mediate BM rejection 8, 9. This notion has been well addressed in the hybrid resistance model, in which parental BM cells, not solid organs, are vigorously rejected by an F1 hybrid 10, 11. This rejection is mediated solely by a recipient's NK cells, not by T cells, NKT cells or B cells 12–14. Recent studies have also shown that NK cells can mediate allogeneic BM graft rejection in costimulatory blockade-treated recipients 15 and that long-term mixed chimerism depends on NK cell tolerance 15–18. Thus, the NK cell is another barrier against engraftment of BM and an important target in efforts to induce successful transplant tolerance.

Besides the problem of graft rejection mediated by recipient immunity, donor BM transplantation is limited by frequent graft-vs.-host disease (GVHD), which is mainly caused by donor T cells. However, depleting donor T cells results in poor engraftment of donor BM. Hence, it will be intriguing to search for a comprehensive approach that can control recipient immunoresponses and simultaneously prevent GVHD following BM transplantation.

Treg play an important role in the regulation of immune responses to self and to allogeneic antigens as demonstrated in a number of in vivo models of autoimmunity, infection, inflammatory disease and transplantation 19. CD4⁺ Treg have the ability to suppress conventional CD4⁺ and CD8⁺ T cells as well as to help regulate the functions of APC. Furthermore, studies have demonstrated that CD4⁺CD25⁺ Treg can inhibit anti-donor BM NK cell responses and promote mixed chimerism 20, 21.

In recent studies, we found that TCRαβ⁺CD3⁺CD4^–CD8^– (double-negative, DN) T cells possess immune-regulatory functions and play an important role in the development of tolerance post-transplantation 22–25. We have demonstrated that mouse DN-Treg specifically can eliminate activated syngeneic anti-donor CD4⁺ T cells, CD8⁺ T cells, and B cells 22, 23, 25, 26. Furthermore, adoptive transfer of DN-Treg leads to significant prolongation of donor-specific skin and heart allografts in a single MHC-mismatched murine model 22, 23, 27.

In support of our findings, a recent study demonstrated that CD4⁺ T cells, converted to DN-Treg, were highly potent in suppressing alloimmunity both in vitro and in vivo in an antigen-specific manner 28. Others have reported that DN-Treg can down-regulate CD8⁺ T cell-mediated immune responses in autoimmune and infectious disease models 29, 30. Interestingly, DN-Treg, derived from human peripheral blood, possess similar immune-regulatory functions as those we demonstrated 31. Collectively, these findings indicate that DN-Treg are able to down-regulate immune responses, both to self and to foreign antigens.

In this study, we have found that donor-derived DN-Treg could suppress NK cell-mediated allogeneic BM graft rejection and did not induce GVHD. Adoptive transfer of DN-Treg promoted mixed chimerism and induced allogeneic graft tolerance in a fully MHC-mismatched transplantation model. These results demonstrate a potential approach that would use DN-Treg to control innate immune responses and promote allogeneic BM engraftment.

Results

DN-Treg suppress NK cell-mediated BM rejection

First, we determined the potential of DN-Treg to suppress NK cells in vivo using the hybrid resistance model. In this model, only NK cells in F1 mice could vigorously mediate the rejection of parental BM cells 10, 11. We used a C57BL/6 green fluorescent protein-transgeneic (B6-GFP, H-2b)-to-CB6F1 (B6 × BALB/c, H-2b/d, F1 generation) combination in our experiment. DN-Treg were purified from B6 mice spleen and lymph nodes, then activated by anti-CD3 antibody in presence of IL-2 (50 IU/mL) overnight before being used for adoptive transfer. CB6F1 mice were given sub-lethal irradiation (6.5 Gy) before receiving B6-GFP T cell-depleted (TCD) BM and DN-Treg. Seven days later, recipient spleen cells were collected for CFU assay.

As shown in Fig. 1, CB6F1 mice that received B6 BM and DN-Treg co-transplantation exhibited a much greater number of CFU in comparison to those that had received only donor BM transplantation (n=3), both in terms of frequency per well (Fig. 1A) and total colony numbers in spleen (Fig. 1B). All CFU cells were collected and analyzed using flow cytometry; about 90% of cells were GFP⁺ (Fig. 1C), confirming the donor origin of CFU cells. To confirm the dominant role of NK cell-mediated BM rejection in this model, NK cells were depleted by anti-Asialo GM1 treatment (50 μL/mouse i.p., 3, 0 and 2 days before and after BM transplantation), and these mice were found to have high numbers of CFU formations after BM transplantation alone (Fig. 1A, B). These results indicate that donor DN-Treg can suppress NK-mediated rejection of parent-to-F1 BM transplantation.

Details are in the caption following the image — **Figure 1**
Open in figure viewer PowerPoint

DN-Treg promote development of donor hematopoietic progenitor cells, as indicated by CFU, in parent-to-F1 BM transplantation. Recipient CB6F1 (H-2b × d) mice were sub-lethally irradiated (6.5 Gy), then given different doses of donor BM cells and DN-Treg. DN-Treg were purified from B6 mice and activated by anti-CD3 antibody and IL-2 (50 IU/mL) for 24–48 h. B6-GFP BM cells (10⁷) were depleted of T cells by anti-CD90 MACS beads. NK cells were depleted using anti-Asialo GM1 antibody (50 μL/mouse) on days –3, –1, 0 and 2 before and after BM transplantation. Seven days after transplantation, spleen cells from recipient mice were collected and cultured for 5 days in triplicate wells, allowing for the detection of early hematopoietic progenitor cells of donor origin. Any colony consisting of over 50 cells was counted and the number of colonies was averaged from triplicate wells. (A) Averages of CFU per well (5×10⁵) from three mice. (B) Averages of total CFU per spleen from three mice. (C) CFU cells were collected and analyzed on a flow cytometer to detect donor-derived GFP⁺ cells. The data represent a CFU assay from one mouse.

Perforin plays a critical roles in DN-Treg-mediated NK cell suppression

Previous studies from our laboratory and other groups have demonstrated that alloreactive DN-Treg suppress CD8⁺ T cells by means of Fas-FasL interactions 22, 23, 29. Interestingly, in our recent study, xenoantigen-activated DN-Treg were found to target syngeneic B and T cells by a perforin/granzyme (PFN/GZM)-dependent mechanism, both in vivo and in vitro 26. It has never been studied whether DN-Treg-mediated NK suppression is Fas-FasL- or PFN/GZM-dependent, or whether it involves other mechanisms. In general, cytotoxic T cells kill target cells mainly through Fas-FasL interaction or PFN/GZM-dependent mechanism. Therefore, we initiated this study using FasL-mutant (gld) and PFN-deficient (PFN^–/–) mice.

DN-Treg were purified from gld and PFN^–/– mice and activated for 24 h with anti-CD3 in the presence of IL-2 (50 IU/mL) before i.v. injection into sub-lethally-irradiated (6.5 Gy) CB6F1 mice that had received TCD B6 BM cells on the same day. After 7 days, spleens from the recipients were collected for CFU assay.

As shown in Fig. 2A, both CFU frequency and total number in the spleens of PFN^–/– DN-Treg-treated mice were significantly decreased (p<0.01, Student's t-test). In contrast, gld DN-Treg-treated mice presented similar results as wild-type B6 DN-Treg-treated mice in CFU assays (p>0.1, Student's t-test, Fig. 2A). However, although reduced, a significant level of donor CFU remains in PFN^–/– DN-Treg-treated mice. Hence, our data suggest that DN-Treg-mediated NK cell suppression may occur through a PFN/FasL-dependent pathway.

To further study DN-Treg-mediated NK cell suppression, we performed an in vitro cytotoxic assay. Activated DN-Treg from B6, gld and PFN^–/– mice were mixed with IL-2-activated BALB/c NK cells (5:1). As shown in Fig. 2B, B6 DN-Treg and gld DN-Treg exhibited a stronger capacity than PFN^–/– DN-Treg to kill NK cells (p>0.05 B6 DN-Treg vs. gld DN-Treg, p<0.01 B6 DN-Treg vs. PFN^–/– DN-Treg, Student's t-test). Hence, DN-Treg could use PFN to target NK cells in vitro.

We were interested in studying whether DN-Treg, CD4⁺ and CD8⁺ T cells possess a similar function after adoptive transfer with donor BM cells. It was surprising that DN-Treg showed a much stronger capacity to suppress NK cell-mediated donor BM rejection than CD8⁺ T cells (p<0.05, Student's t-test), but similar to CD4⁺ T cells (p>0.05) in a dose-dependent manner (Fig. 2C). We further analyzed the cytotoxic-related gene expression in both cells by real-time PCR. As shown in Fig. 2D, DN-Treg express higher levels of GZM and FasL than CD8⁺ T cells. Hence, these data suggest that high levels of GZM or FasL expressions might ensure that DN-Treg can effectively attack NK cells. It is unknown whether CD4⁺ and CD8⁺ T cells use a similar mechanism or different mechanisms to suppress NK cells in this study.

DN-Treg inhibit NK cell-mediated fully MHC-mismatched BM rejection without induction of GVHD

The above experiments demonstrate that DN-Treg can suppress NK cell-mediated BM rejection in the parent-to-F1 model. Next, we extended our study to fully MHC-mismatched allogeneic hematopoietic BM transplantation. Different doses of TCD BM cells were purified from B6-GFP mice (H-2b), then i.v. injected into sub-lethally irradiated (6.5 Gy) BALB/c mice (H-2d). The recipient mice, divided into several groups, received either donor BM cells alone or donor BM cells with DN-Treg (1×10⁶ or 2×10⁶). After 7 days, spleens from the recipients were collected for CFU assay to determine the reconstitution of donor hematopoietic progenitors in the recipients.

Both the frequency and the total number of CFU were greatly increased in recipients that had received co-transplantation of BM and DN-Treg vs. those that had received BM transplantation alone (Fig. 3A). Treatment using CD4 (YTS191.1) and CD8 (YTS169.4) depletion antibodies did not further enhance CFU numbers (Fig. 3A). The control group that received NK cell depletion antibody (anti-Asialo GM1) was found to have high numbers of CFU formations after BM transplantation alone, indicating the role of NK cells in donor BM rejection (Fig. 3A). Interestingly, although significantly reduced (p<0.05, Student's t-test), B6 DN-Treg helped C3H BM cells to survive in BALB/c recipients (Fig. 3A), suggesting that adoptive transfer of B6 DN-Treg can help third-party BM engraftment. CFU cells collected from one mouse for flow cytometry to detect donor-derived GFP⁺ cells indicate that about 87% of CFU cells were GFP⁺ (Fig. 3B). Collectively, these results suggest that adoptive transfer of DN-Treg can promote early engraftment of fully MHC-mismatched allogeneic BM transplantation.

Next, we determined whether CD4⁺ and CD8⁺ T cells have a similar effect as DN-Treg in promoting early mixed chimerism. Anti-CD3/CD28-activated B6 CD4⁺ or CD8⁺ T cells were co-transfused with donor BM cells. Both donor CD4⁺ and CD8⁺ T cells showed a similar effect as DN-Treg in CFU assay (Fig. 3C).

Our previous studies and those of others have demonstrated that adoptive transfer of donor DN-Treg can attenuate GVHD induced by donor CD8⁺ T cells in sub-lethally irradiated SCID mice, and anti-host DN-Treg can inhibit CD8⁺ T cell-mediated autoimmunity 29, 32, 33, thus indicating that donor DN-Treg do not play a role in inducing GVHD. To determine whether adoptive transfer of DN-Treg played a role in GVHD in the current model, we transferred B6 DN-Treg (10⁷) with B6 BM cells (2×10⁶) into conditioned (6.5 Gy) BALB/c mice.

As shown in Fig. 3D–F, all mice (n=4) that received up to 10⁷ DN-Treg survived beyond 60 days without a decrease in body weight or signs of GVHD. Pathology analysis showed that hepatocytes, liver cell cords, and portal and venous structures were normal with no evidence of GVHD. In contrast, control mice that received activated CD4⁺ T cells (2×10⁶) developed severe GVHD with weight loss and mortality. Infiltrating mononuclear cells, proliferation in bile ducts, and abnormal portal and venous structure, a typical lesion of chronic GVHD, was evident. Although the mice that received CD8⁺ T cells (2×10⁶) had extended survival, pathology indicated that these mice developed GVHD, as tissue damage was found in the liver (Fig. 3F).

Co-transplantation of BM cells and DN-Treg induces stable mixed chimerism and allograft tolerance

Our above data indicate that donor DN-Treg inhibit rejection during the early stage of BM transplantation. We were interested in assessing whether mixed chimerism and tolerance could be induced in these mice.

TCD B6-GFP BM cells (2×10⁶) were co-transplanted with B6 DN-Treg (2×10⁶) into sub-lethally irradiated (6.5 Gy) BALB/c mice. Control mice received only BM cells (2×10⁶). Peripheral blood of treated mice was monitored on different days to detect donor-derived (H-2k^b+ or GFP⁺) lymphocytes. Donor-derived lymphocytes (H-2k^b+) in the recipient periphery could be detected from 30 to 180 days. The range of donor cells was 3–88% (n=12, Fig. 4A), whereas no significant donor-derived lymphocytes were detected in recipients treated only with donor BM cells (n=6, Fig. 4A). Four chimera mice were sacrificed on day 100 to assess lymphoid and myeloid lineages by detecting donor-derived GFP⁺ cells. On an average 50% of BM cells and 36% of spleen cells were GFP⁺ (Fig. 4B). Donor-derived CD3⁺, CD19⁺ and CD11b⁺ (myeloid lineage) cells in these spleens are correlated with the chimera (Fig. 4C).

Next, we studied whether mixed chimerism would lead to acceptance of the donor graft. Heart grafts from BM donor strain B6 mice were transplanted into chimeric BALB/c mice and control mice. The control mice were treated with sub-lethal irradiation only, or BM plus sub-lethal irradiation, or DN-Treg plus irradiation, then kept for 40–60 days before receiving their graft. Heart grafts survived longer than 180 days in chimeric mice, but were rejected in control mice (Fig. 5A).

To determine whether chimeric mice corroborate donor-specific tolerance, second grafts (skin grafts) from BM donor strain B6 and third-party control C3H (H-2k) mice were transplanted onto chimeric BALB/c mice 60–100 days after BM transplantation. Graft survival results are concluded in Fig. 5B. Skin grafts from control mice were rejected shortly after grafting (all mean survival time <20 days). Skin grafts from donor B6 mice were not rejected, surviving over 100 days in chimeric mice without any sign of rejection (Fig. 5B). In contrast, skin grafts from the third-party control C3H mice were rejected after grafting (mean survival time = 16 days, n=8), suggesting that antigen-specific tolerance was established in the animals with mixed chimerism. Heart grafts from chimeric mice that survived for 160–180 days were collected and analyzed using H&E staining. As shown in Fig. 5C, heart grafts in control mice showed signs of rejection as early as 7 days after transplantation, whereas there was no sign of tissue damage in chimeric mice from day 7 until day 180.

Discussion

Success of BM transplantation relies on effective inhibition of recipient immune responses and prevention of GVHD. In this study, we have demonstrated that DN-Treg can inhibit NK cell-mediated donor BM graft rejection in sub-lethally irradiated parent-to-F1 and fully MHC-mismatched transplant models. Furthermore, we have found that DN-Treg-mediated NK cell suppression occurs through a PFN/FasL-dependent mechanism, both in vivo and in vitro. Importantly, donor DN-Treg could promote mixed chimerism without inducing GVHD. These results suggest a potential approach to control innate immune responses, which occur after BM transplantation, with the use of DN-Treg.

Although recipient T cells play a major role in rejection of allogeneic grafts, NK cell-mediated allograft rejection has been well discussed 4–7. Furthermore, NK-mediated BM rejection typically occurs at an earlier stage 12. The role of NK cells in BM graft rejection was well addressed in the hybrid resistance model, in which both irradiated F1 hybrid and T/B cell-deficient RAG^–/– F1 mice rejected parental BM cells by NK cells 10–14. Conversely, NK cell-deficient F1 mice accepted parental BM grafts. Hence, parent-to-F1 hybrid resistance provides a reliable model for us to study the possibility of NK cell suppression by DN-Treg in vivo. Our data demonstrate that adoptive transfer of donor DN-Treg can inhibit NK cell-mediated parental BM rejection and promote survival of early donor-derived progenitors (Fig. 1). Furthermore, a similar effect of DN-Treg was found in a fully MHC-mismatched model (B6 to BALB/c, Fig. 3A). Interestingly, B6 DN-Treg do not only help B6 BM, but also third-party C3H BM survival in BALB/c recipients (Fig. 3A). This result also suggested that DN-Treg could be used in a broad range for treatment.

Previous studies have demonstrated that early mixed chimerism may not always persist over the long term, particularly with regimens that involve a combination of immunosuppressive techniques 34, 35. Hence, tolerance in mixed chimerism must be more carefully assessed in the setting of transplantation, owing to the possibility that chimerism may be dissociated with tolerance 36–38. The results of DN-Treg-mediated NK cell suppression was intriguing, prompting us to further study whether adoptive transfer of DN-Treg could promote engraftment of allogeneic BM cells. We detected donor-derived lymphocytes (H-2k^b+ or GFP⁺) in recipients after 180 days (Fig. 4A). Furthermore, donor-derived CD3⁺ cells, CD19⁺ cells and CD11b⁺ cells were identified in chimeric mice after 100 days (Fig. 4C). This result correlated with the CFU results obtained 7 days after BM transplantation (Fig. 3A). Furthermore, the chimeric mice accepted donor heart and skin grafts but rejected third-party C3H skin grafts (Fig. 5A, B). Hence, suppression of NK cells by adoptive transfer of DN-Treg provides a long-term benefit by achieving stable mixed chimerism and donor-specific tolerance.

Following the first reports that described its use in a murine model 39, 40, mixed chimerism was developed successfully in porcine and non-human primate models using immunosuppressive regimens 41–48. More recently, mixed chimerism has produced clinical benefit in a number of transplant patients 49–54. The risk of GVHD, which is associated with donor T cells, is a major obstacle in BM transplantation. Depletion of donor T cells before BM transplantation reduces the risk of GVHD, but it also limits the success of mixed chimerism. Several studies have tried to solve this dilemma. It has been shown that CD4⁺ Treg from the donor or recipient can control GVHD after BM transplantation 21, 55–58. In previous studies, we have found that donor DN-Treg could suppress donor CD8⁺ T cells, which caused GVHD in a single MHC-mismatched model 32. Others also reported that anti-host DN-Treg could suppress the function of CD8⁺ T cells and prevent autoimmune diseases 29.

In this study, we found that, although adoptive transfer of donor CD4⁺ or CD8⁺ T cells has benefits for donor BM survival (Fig. 3C), either CD4⁺ or CD8⁺ T cells induce GVHD (Fig. 3D–F). The mice that received CD4⁺ or CD8⁺ T cells developed body weight loss, mortality and liver damage. In contrast, adoptive transfer of up to 10⁷ donor DN-Treg did not induce GVHD in a fully MHC-mismatched model (Fig. 3D–F). Hence, donor DN-Treg may provide an alternative tool to promote allogeneic engraftment in clinical BM transplantation.

Treg have the ability to suppress conventional CD4⁺ and CD8⁺ T cells as well as to help regulate APC function. The suppressive function of CD4⁺ Treg has previously been shown to be mediated by IL-10, CTLA-4 and/or membrane-bound TGF-β 59. In addition, recent studies have suggested that chemokine metabolism 60, indirect tryptophan metabolism 61, FasL 62 and GZM 63 could also be involved in the function of Treg. In CD4⁺ Treg-mediated syngenic NK cell suppression, TGF-β provides a major suppressive mechanism 20, 64, 65. Similarly, the mechanism of DN-Treg-mediated immune suppression differs in different models. Alloreactive DN-Treg suppress CD8⁺ T cells through Fas-FasL interactions 22, 23, 29. However, DN-Treg can also suppress CD4⁺ T cells through a Fas-independent mechanism involving the inhibition of IL-2 production in CD4⁺ T cells 66.

Interestingly, our recent study showed that xenoantigen-activated DN-Treg were found to target syngeneic B and T cells by a PFN/GZM-dependent mechanism, both in vivo and in vitro 26. The different mechanism by which DN-Treg attack target cells might result from the activation pattern of DN-Treg by different antigen or from the molecular engagement of DN-Treg with target cells. DN-Treg are quite different from conventional T cells, lacking detectable levels of CD4, CD8, CD28, ICOS, 4-1BB, OX40 and CD40L 22.

In the current study, we have found that, although less efficient, PFN^–/– DN-Treg were still effective in helping donor progenitors to survive in recipients compared to DN-Treg from wild-type B6 or FasL-mutant gld mice (Fig. 2A). Consistent with the CFU results (Fig. 2A), in vitro killing assay demonstrated that B6 and gld DN-Treg can mediate direct killing of BALB/c NK cells (Fig. 2B), whereas PFN^–/– DN-Treg had a reduced killing capacity to NK cells (Fig. 2B), implying that PFN may have a major role in DN-Treg-mediated NK cell suppression, although a Fas-FasL contribution can not be excluded (Fig. 2A, B). It remains unknown whether DN-Treg directly eliminate NK cells or indirectly change other factors involved in NK cell activity and function in vivo.

Classically, PFN is thought to form pores on target cell plasma membrane, which allows diffusion of cytolytic molecules (GZM A and GZM B) into target cells. Furthermore, PFN helps release of GZM in target cells and subsequently induces target cell death. We have found that DN-Treg express high levels of GZM A and GZM B (Fig. 2C), which might explain why DN-Treg more efficiently suppress NK cell function compared with CD8⁺ T cells in the CFU assay (Fig. 2A). However, in this study, it is still unknown whether CD4⁺ and CD8⁺ T cells utilize a similar mechanism or different mechanisms to suppress NK cells in vitro and in vivo.

In summary, our study has demonstrated an effective way to control anti-donor NK cell function after allogeneic BM transplantation using adoptive transfer of donor-derived DN-Treg. This may provide an alternative method that promotes BM engraftment in clinical transplantation.

Materials and methods

Animals

B6 (H-2b), BALB/c (H-2d), B6 PFN^–/–, FasL-deficient B6Tnfsf^gld (gld), and B6 GFP mice were purchased from Jackson Laboratories (Bar Harbor, ME) and Charles River Laboratories (Wilmington, MA). The animals were maintained in the animal facility at the University of Western Ontario using approved protocols and procedures.

Antibodies

DN-Treg were characterized with fluorescent-conjugated monoclonal antibodies that specifically recognize TCRαβ, CD3, CD4, CD8, CD25, CD28, NK1.1, DX5 (CD49b) and TCRγδ (eBioscience, San Diego, CA). To detect donor-derived lymphocytes, anti-mouse H-2k^b/Db (clone 28-8-6) and H-2k^d/Dd were used (BD Biosciences, Missassauga, Canada). Data were acquired and analyzed on a Cytomics FC500 flow cytometer (Beckman Coulter, Missassauga, Canada). CD4 depletion antibody (YTS191.1) and CD8 depletion antibody (YTS169.4) were developed from ATCC cell lines. NK cell depletion antibody, anti-Asialo GM1, was purchased from Cedarlane (Burlington, Canada).

Isolation of DN-Treg, CD4⁺ T cells and CD8⁺ T cells

CD4⁺ T cells and CD8⁺ T cells were purified by MACS beads directly from spleen cells. To purify DN-Treg, spleen and lymph node cells, obtained from B6 or gld or PFN^–/– mice, were treated with anti-DX5, anti-CD4 and anti-CD8 MACS beads (Miltenyi Biotec, Auburn, CA) to deplete CD4⁺, CD8⁺ and NKT cells. The remaining cells were added to anti-CD90 (Thy-1)-coated MACS beads (Miltenyi Biotec) to purify CD4^–D8^– T cells. The purity of naive DN-Treg was monitored by flow cytometry and TCRγδ⁻CD3⁺CD4^–CD8^–NK1.1^– cells were >92% pure. Purified B6 DN-Treg were stimulated with anti-CD3 (2 μg/mL) in RPMI 1640 supplemented with 10% FCS, penicillin (100 U/mL), streptomycin (100 μg/mL), glutamin (2 mM), sodium pyruvate (1 mM), HEPES (10 mM), β-mercaptoethanol (0.5 mM), and 50 IU/mL IL-2. Twenty-four hours later, the activated DN-Treg were i.v. transferred into recipient mice with BM cells.

BM transplantation

BM cells were obtained by flushing the femurs and tibia of sex-matched B6 mice with cold (4°C) PBS containing 1% FBS. T cells were depleted by anti-CD90 (Thy-1)-MACS beads (Miltenyi Biotec). The absence of T cells was confirmed prior to the transfer of BM cells, by staining with anti-CD3, anti-CD4, anti-CD8 and flow cytometry analysis. TCD BM cells were i.v. injected into sub-lethally irradiated (6.5 Gy, 70 cGy/min, Cobalt-60) CB6F1 (H-2b × d) or BALB/c mice. The recipient mice were housed in a pathogen-free barrier. Some B6 donor BM cells were co-transplanted with different doses of DN-Treg. The control group received either CD4⁺ or CD8⁺ T cells, or BM cells alone.

CFU assay

Recipient spleen cells were collected 7 days after transplantation to detect early progenitor cells in a CFU assay, which has been used to detect donor-derived progenitor cells in early stages of immune reconstitution 20, 21, 67. Briefly, the spleen cells were re-suspended at 2×10⁵–5×10⁵/mL in colony-forming Iscove's medium (MethoCult; StemCell Technologies, Vancouver, Canada) in the presence of 30% FCS, 0.86% methylcellulose, 5 ng/mL IL-3, 10 ng/mL GM-CSF and antibiotics for 5 days. Any colony consisting of over 50 cells was counted and the number of colonies was averaged from triplicate wells. Then all CFU cells were collected and washed to detect donor-derived GFP fluorescence using flow cytometry.

Real-time PCR

B6 DN-Treg and CD8⁺ T cells were activated by either BALB/c APC or anti-CD3 for 3–4 days in the presence of IL-2 (50 IU/mL). Total RNA was extracted with a spin column according to the manufacturer's protocol (QIAGEN, Mississauga, Canada). cDNA pools were synthesized with the StrataScript First Strand Synthesis System according to the manufacturer's protocol (Stratagene, La Jolla, CA). Primers were designed using Primer Express, primer designing software from Applied Biosystems (Streetsville, Canada): GZM A: TGTGCTGGCGCTTTGATTG and GAACTTAGATCTCTTTCCCA; GZM B: CGATCAAGGATCAGCAGCC and CTGGGTCTTCTCCTGTTCT; PFN: GAAGACCTATCAGGACCAGTACAACTT and CAAGG TGGAGTGGAGGTTTTTG; FasL: GAAGGAACTGGCAGAACTCCG and CCCTGTTAATG GGCCACACT; β-actin: CCAGCCTTCCTTCCTGGGTA and CTAGAAGCATTTGCGGTGCA. The gene sequences were obtained from the www.ncbi.nlm.nih.gov database.

Real-time quantitative PCR was performed on standardized quantities of cDNA using the Brilliant SYBR Green QPCR Master Mix kit, and amplified DNA products were generated and detected using the M×4000 system (Stratagene). Each PCR amplification condition was set up in triplicate. As endogenous control β-actin amplification was used. The normalized delta threshold cycle value and relative expression levels (2^ddCt) were calculated according to the manufacturer's protocol.

Heart and skin transplantation

Intra-abdominal heterotopic B6 (H-2b)-to-BALB/c (H-2d) cardiac transplants were performed in our microsurgery laboratory, in accordance with an approved protocol. Briefly, donor hearts were procured through a butterfly thoracic incision. All major vessels were ligated, except the pulmonary artery and aorta, which was sharply transected. The ascending aorta and pulmonary artery were anastomosed end-to-side to the recipient, by way of the infrarenal abdominal aorta and inferior vena cava. Pulsation of the heart graft was monitored daily. Cessation of beating was defined as the end point of rejection.

To determine donor-specific tolerance, each group of mice received a second graft (skin graft) from donor strain. In brief, a full-thickness (1×1 cm size) donor skin graft was transplanted on the lateral thoracic wall, and the graft was secured with a bandage. Skin grafts were monitored daily after removal of the bandage on day 8. Complete necrosis of the skin graft was defined as rejection. Skin grafts were followed for >100 days. Survival of skin grafts from third-party (C3H) mice was monitored for antigen specificity of the mixed chimerism. Antigen-specific tolerance refers to a mouse that accepts a skin graft from the BM donor B6 strain, but rejects the skin graft from the third-party C3H strain.

GVHD and pathology

Clinical signs of GVHD, including weight loss, diarrhea, ruffled fur and hunched posture, were monitored daily. More than 20% body weight loss or death was considered as termination of GVHD. Tissue samples from major GVHD lesion sites (liver, skin, and intestine) were harvested, stained with H&E, and evaluated by light microscopy for GVHD.

Cytotoxicity assay

The purified DN-Treg from B6, gld and PFN^–/– mice were activated by plate-coated anti-CD3 (1 μg/mL) with IL-2 (50 IU/mL) for 3–7 days before being used as effectors. BALB/c NK cells were purified by CD49b⁺ selection on MACS beads column (Miltenyi Biotec), and were stimulated by IL-2 (1000 IU/mL) for 4–7 days. Any contaminated T cells and macrophages were further depleted by antibody-bonded MACS beads (Miltenyi Biotec) after flow cytometry analysis. We applied the JAM assay to measure DNA fragment and death of target cells 68–70. Activated NK cells were labeled with 10 μCi/mL of [³H]thymidine at 37°C overnight, washed and then used as targets. After co-culture of NK cells with the DN-Treg effector cells at 37°C for 5 h, the cells were harvested and counted in a β-scintillation counter (PerkinElmer). Specific cell lysis was calculated using the following equation: % specific killing = (S–E)/S×100, where E (experimental) is cpm of retained DNA in the presence of effector cells, and S (spontaneous) is cpm of retained DNA in the absence of effector cells.

Statistical analysis

The obtained data were compared using Student's t-test. p values less than 0.05 were considered a significant difference.

Acknowledgements

The authors would like to thank Mrs. Xuyan Huang and Dr. Francis Feng for assistance with cell injection and Ms. Cate Abbott for editing assistance. This study was supported by the Heart and Stroke Foundation of Canada to Z.-X. Zhang, and Fund of Multi-Organ Transplant Program, London Health Sciences Centre, London, Ontario, Canada to Z.-X. Zhang.

WILEY-VCH
WILEY-VCH
WILEY-VCH
WILEY-VCH
WILEY-VCH

Appendix

Conflict of interest: The authors declare no financial or commercial conflicts of interest.

References

1 Sykes, M., Mixed chimerism and transplant tolerance. Immunity 2001. 14: 417–424.
10.1016/S1074-7613(01)00122-4
CAS PubMed Web of Science® Google Scholar
2 Tomita, Y., Khan, A. and Sykes, M., Role of intrathymic clonal deletion and peripheral anergy in transplantation tolerance induced by bone marrow transplantation in mice conditioned with a nonmyeloablative regimen. J. Immunol. 1994. 153: 1087–1098.
CAS PubMed Web of Science® Google Scholar
3 Manilay, J. O., Pearson, D. A., Sergio, J. J., Swenson, K. G. and Sykes, M., Intrathymic deletion of alloreactive T cells in mixed bone marrow chimeras prepared with a nonmyeloablative conditioning regimen. Transplantation 1998. 66: 96–102.
10.1097/00007890-199807150-00015
CAS PubMed Web of Science® Google Scholar
4 Kitchens, W. H., Uehara, S., Chase, C. M., Colvin, R. B., Russell, P. S. and Madsen, J. C., The changing role of natural killer cells in solid organ rejection and tolerance. Transplantation 2006. 81: 811–817.
10.1097/01.tp.0000202844.33794.0e
PubMed Web of Science® Google Scholar
5 Uehara, S., Chase, C. M., Kitchens, W. H., Rose, H. S., Colvin, R. B., Russell, P. S. and Madsen, J. C., NK cells can trigger allograft vasculopathy: The role of hybrid resistance in solid organ allografts. J. Immunol. 2005. 175: 3424–3430.
10.4049/jimmunol.175.5.3424
CAS PubMed Web of Science® Google Scholar
6 Le Moine, A. and Goldman, M., Non-classical pathways of cell-mediated allograft rejection: New challenges for tolerance induction? Am. J. Transplant. 2003. 3: 101–106.
10.1034/j.1600-6143.2002.00026.x
CAS PubMed Web of Science® Google Scholar
7 Vilches, C. and Parham, P., Do NK-cell receptors and alloreactivity affect solid organ transplantation? Transpl. Immunol. 2006. 17: 27–30.
10.1016/j.trim.2006.09.022
CAS PubMed Web of Science® Google Scholar
8 Murphy, W. J., Koh, C. Y., Raziuddin, A., Bennett, M. and Longo, D. L., Immunobiology of natural killer cells and bone marrow transplantation: Merging of basic and preclinical studies. Immunol. Rev. 2001. 181: 279–289.
10.1034/j.1600-065X.2001.1810124.x
CAS PubMed Web of Science® Google Scholar
9 Murphy, W. J. and Longo, D. L., The potential role of NK cells in the separation of graft-versus-tumor effects from graft-versus-host disease after allogeneic bone marrow transplantation. Immunol. Rev. 1997. 157: 167–176.
10.1111/j.1600-065X.1997.tb00981.x
CAS PubMed Web of Science® Google Scholar
10 Cudkowicz, G. and Bennett, M., Peculiar immunobiology of bone marrow allografts. II. Rejection of parental grafts by resistant F 1 hybrid mice. J. Exp. Med. 1971. 134: 1513–1528.
10.1084/jem.134.6.1513
PubMed Web of Science® Google Scholar
11 Ljunggren, H. G. and Karre, K., In search of the ‘missing self': MHC molecules and NK cell recognition. Immunol. Today 1990. 11: 237–244.
10.1016/0167-5699(90)90097-S
CAS PubMed Web of Science® Google Scholar
12 Murphy, W. J., Kumar, V. and Bennett, M., Rejection of bone marrow allografts by mice with severe combined immune deficiency (SCID). Evidence that natural killer cells can mediate the specificity of marrow graft rejection. J. Exp. Med. 1987. 165: 1212–1217.
10.1084/jem.165.4.1212
PubMed Web of Science® Google Scholar
13 Yokoyama, W. M. and Seaman, W. E., The Ly-49 and NKR-P1 gene families encoding lectin-like receptors on natural killer cells: The NK gene complex. Annu. Rev. Immunol. 1993. 11: 613–635.
10.1146/annurev.iy.11.040193.003145
CAS PubMed Web of Science® Google Scholar
14 Suzue, K., Reinherz, E. L. and Koyasu, S., Critical role of NK but not NKT cells in acute rejection of parental bone marrow cells in F1 hybrid mice. Eur. J. Immunol. 2001. 31: 3147–3152.
10.1002/1521-4141(200111)31:11<3147::AID-IMMU3147>3.0.CO;2-F
CAS PubMed Web of Science® Google Scholar
15 Kean, L. S., Hamby, K., Koehn, B., Lee, E., Coley, S., Stempora, L., Adams, A. B. et al., NK cells mediate costimulation blockade-resistant rejection of allogeneic stem cells during nonmyeloablative transplantation. Am. J. Transplant. 2006. 6: 292–304.
10.1111/j.1600-6143.2005.01172.x
CAS PubMed Web of Science® Google Scholar
16 Westerhuis, G., Maas, W. G., Willemze, R., Toes, R. E. and Fibbe, W. E., Long-term mixed chimerism after immunologic conditioning and MHC-mismatched stem-cell transplantation is dependent on NK-cell tolerance. Blood 2005. 106: 2215–2220.
10.1182/blood-2005-04-1391
CAS PubMed Web of Science® Google Scholar
17 Cho, S. G., Shuto, Y., Soda, Y., Nakazaki, Y., Izawa, K., Uchimaru, K., Takahashi, S. et al., Anti-NK cell treatment induces stable mixed chimerism in MHC-mismatched, T cell-depleted, nonmyeloablative bone marrow transplantation. Exp. Hematol. 2004. 32: 1246–1254.
10.1016/j.exphem.2004.08.008
CAS PubMed Web of Science® Google Scholar
18 Zhao, Y., Ohdan, H., Manilay, J. O. and Sykes, M., NK cell tolerance in mixed allogeneic chimeras. J. Immunol. 2003. 170: 5398–5405.
10.4049/jimmunol.170.11.5398
CAS PubMed Web of Science® Google Scholar
19 Sakaguchi, S., Naturally arising Foxp3-expressing CD25⁺CD4⁺ regulatory T cells in immunological tolerance to self and non-self. Nat. Immunol. 2005. 6: 345–352.
10.1038/ni1178
CAS PubMed Web of Science® Google Scholar
20 Barao, I., Hanash, A. M., Hallett, W., Welniak, L. A., Sun, K., Redelman, D., Blazar, B. R. et al., Suppression of natural killer cell-mediated bone marrow cell rejection by CD4⁺CD25⁺ regulatory T cells. Proc. Natl. Acad. Sci. USA 2006. 103: 5460–5465.
10.1073/pnas.0509249103
CAS PubMed Web of Science® Google Scholar
21 Hanash, A. M. and Levy, R. B., Donor CD4⁺CD25⁺ T cells promote engraftment and tolerance following MHC-mismatched hematopoietic cell transplantation. Blood 2005. 105: 1828–1836.
10.1182/blood-2004-08-3213
CAS PubMed Web of Science® Google Scholar
22 Zhang, Z. X., Yang, L., Young, K. J., DuTemple, B. and Zhang, L., Identification of a previously unknown antigen-specific regulatory T cell and its mechanism of suppression. Nat. Med. 2000. 6: 782–789.
10.1038/77513
CAS PubMed Web of Science® Google Scholar
23 Ford, M. S., Young, K. J., Zhang, Z., Ohashi, P. S. and Zhang, L., The immune regulatory function of lymphoproliferative double negative T cells in vitro and in vivo. J. Exp. Med. 2002. 196: 261–267.
10.1084/jem.20020029
CAS PubMed Web of Science® Google Scholar
24 Young, K. J., Yang, L., Phillips, M. J. and Zhang, L., Donor-lymphocyte infusion induces transplantation tolerance by activating systemic and graft-infiltrating double-negative regulatory T cells. Blood 2002. 100: 3408–3414.
10.1182/blood-2002-01-0235
CAS PubMed Web of Science® Google Scholar
25 Zhang, Z. X., Stanford, W. L. and Zhang, L., Ly-6A is critical for the function of double negative regulatory T cells. Eur. J. Immunol. 2002. 32: 1584–1592.
10.1002/1521-4141(200206)32:6<1584::AID-IMMU1584>3.0.CO;2-2
CAS PubMed Web of Science® Google Scholar
26 Zhang, Z. X., Ma, Y. X., Wang, H., Arp, J., Jaing, J., Huang, X., Madrenas, J. and Zhong, R., Double negative T cells lyse autologous lymphocytes using a perforin/granzyme-dependent, Fas-FasL-independent pathway. J. Immunol. 2006. 177: 6920–6929.
10.4049/jimmunol.177.10.6920
CAS PubMed Web of Science® Google Scholar
27 Chen, W., Ford, M. S., Young, K. J. and Zhang, L., Infusion of in vitro-generated DN T regulatory cells induces permanent cardiac allograft survival in mice. Transplant. Proc. 2003. 35: 2479–2480.
10.1016/j.transproceed.2003.08.030
CAS PubMed Web of Science® Google Scholar
28 Zhang, D., Yang, W., Degauque, N., Tian, Y., Mikita, A. and Zheng, X. X., New differentiation pathway for double-negative regulatory T-cells that regulates the magnitude of immune responses. Blood 2007. 109: 4071–4079.
10.1182/blood-2006-10-050625
CAS PubMed Web of Science® Google Scholar
29 Priatel, J. J., Utting, O. and Teh, H. S., TCR/self-antigen interactions drive double-negative T cell peripheral expansion and differentiation into suppressor cells. J. Immunol. 2001. 167: 6188–6194.
10.4049/jimmunol.167.11.6188
CAS PubMed Web of Science® Google Scholar
30 Johansson, M. and Lycke, N., A unique population of extrathymically derived alpha beta TCR⁺CD4^–CD8^– T cells with regulatory functions dominates the mouse female genital tract. J. Immunol. 2003. 170: 1659–1666.
10.4049/jimmunol.170.4.1659
CAS PubMed Web of Science® Google Scholar
31 Fischer, K., Voelkl, S., Heymann, J., Przybylski, G. K., Mondal, K., Laumer, M., Kunz-Schughart, L. et al., Isolation and characterization of human antigen-specific TCRαβ⁺ CD4^–CD8^– double negative regulatory T cells. Blood 2005. 105: 2828–2838.
10.1182/blood-2004-07-2583
CAS PubMed Web of Science® Google Scholar
32 Young, K. J., DuTemple, B., Zhang, Z., Levy, G. and Zhang, L., CD4(–)CD8(–) regulatory T cells implicated in preventing graft-versus-host and promoting graft-versus-leukemia responses. Transplant. Proc. 2001. 33: 1762–1763.
10.1016/S0041-1345(00)02670-1
CAS PubMed Web of Science® Google Scholar
33 Young, K. J., DuTemple, B., Phillips, M. J. and Zhang, L., Inhibition of graft-versus-host disease by double-negative regulatory T cells. J. Immunol. 2003. 171: 134–141.
10.4049/jimmunol.171.1.134
CAS PubMed Web of Science® Google Scholar
34 Xu, H., Chilton, P. M., Huang, Y., Schanie, C. L. and Ildstad, S. T., Production of donor T cells is critical for induction of donor-specific tolerance and maintenance of chimerism. J. Immunol. 2004. 172: 1463–1471.
10.4049/jimmunol.172.3.1463
CAS PubMed Web of Science® Google Scholar
35 Kanamoto, A. and Maki, T., Chimeric donor cells play an active role in both induction and maintenance phases of transplantation tolerance induced by mixed chimerism. J. Immunol. 2004. 172: 1444–1448.
10.4049/jimmunol.172.3.1444
CAS PubMed Web of Science® Google Scholar
36 Elwood, E. T., Larsen, C. P., Maurer, D. H., Routenberg, K. L., Neylan, J. F., Whelchel, J. D., O'Brien, D. P. and Pearson, T. C., Microchimerism and rejection in clinical transplantation. Lancet 1997. 349: 1358–1360.
10.1016/S0140-6736(96)09105-2
PubMed Web of Science® Google Scholar
37 Hisanaga, M., Hundrieser, J., Boker, K., Uthoff, K., Raddatz, G., Wahlers, T., Wonigeit, K. et al., Development, stability, and clinical correlations of allogeneic microchimerism after solid organ transplantation. Transplantation 1996. 61: 40–45.
10.1097/00007890-199601150-00010
PubMed Web of Science® Google Scholar
38 Umemura, A., Morita, H., Li, X. C., Tahan, S., Monaco, A. P. and Maki, T., Dissociation of hemopoietic chimerism and allograft tolerance after allogeneic bone marrow transplantation. J. Immunol. 2001. 167: 3043–3048.
10.4049/jimmunol.167.6.3043
CAS PubMed Web of Science® Google Scholar
39 Ildstad, S. T., Wren, S. M., Bluestone, J. A., Barbieri, S. A., Stephany, D. and Sachs, D. H., Effect of selective T cell depletion of host and/or donor bone marrow on lymphopoietic repopulation, tolerance, and graft-vs.-host disease in mixed allogeneic chimeras (B10 + B10.D2----B10). J. Immunol. 1986. 136: 28–33.
CAS PubMed Web of Science® Google Scholar
40 Ildstad, S. T., Wren, S. M., Bluestone, J. A., Barbieri, J. A. and Sachs, D. H., Characterization of mixed allogeneic chimeras. Immunocompetence, in vitro reactivity, and genetic specificity of tolerance. J. Exp. Med. 1985. 162: 231–244.
10.1084/jem.162.1.231
PubMed Web of Science® Google Scholar
41 Wekerle, T. and Sykes, M., Mixed chimerism and transplantation tolerance. Annu. Rev. Med. 2001. 52: 353–370.
10.1146/annurev.med.52.1.353
CAS PubMed Web of Science® Google Scholar
42 Thomas, J. M., Carver, F. M., Foil, M. B., Hall, W. R., Adams, C., Fahrenbruch, G. B. and Thomas, F. T., Renal allograft tolerance induced with ATG and donor bone marrow in outbred rhesus monkeys. Transplantation 1983. 36: 104–106.
10.1097/00007890-198307000-00021
PubMed Web of Science® Google Scholar
43 Kimikawa, M., Sachs, D. H., Colvin, R. B., Bartholomew, A., Kawai, T. and Cosimi, A. B., Modifications of the conditioning regimen for achieving mixed chimerism and donor-specific tolerance in cynomolgus monkeys. Transplantation 1997. 64: 709–716.
10.1097/00007890-199709150-00008
PubMed Web of Science® Google Scholar
44 Kawai, T., Wee, S. L., Bazin, H., Latinne, D., Phelan, J., Boskovic, S., Ko, D. S. et al., Association of natural killer cell depletion with induction of mixed chimerism and allograft tolerance in non-human primates. Transplantation 2000. 70: 368–374.
10.1097/00007890-200007270-00023
CAS PubMed Web of Science® Google Scholar
45 Ruedi, E., Sykes, M., Ildstad, S. T., Chester, C. H., Althage, A., Hengartner, H., Sachs, D. H. and Zinkernagel, R. M., Antiviral T cell competence and restriction specificity of mixed allogeneic (P1 + P2----P1) irradiation chimeras. Cell. Immunol. 1989. 121: 185–195.
10.1016/0008-8749(89)90016-6
CAS PubMed Web of Science® Google Scholar
46 Colson, Y. L., Li, H., Boggs, S. S., Patrene, K. D., Johnson, P. C. and Ildstad, S. T., Durable mixed allogeneic chimerism and tolerance by a nonlethal radiation-based cytoreductive approach. J. Immunol. 1996. 157: 2820–2829.
CAS PubMed Web of Science® Google Scholar
47 Sykes, M., Szot, G. L., Swenson, K. A. and Pearson, D. A., Induction of high levels of allogeneic hematopoietic reconstitution and donor-specific tolerance without myelosuppressive conditioning. Nat. Med. 1997. 3: 783–787.
10.1038/nm0797-783
CAS PubMed Web of Science® Google Scholar
48 Colson, Y. L., Lange, J., Fowler, K. and Ildstad, S. T., Mechanism for cotolerance in nonlethally conditioned mixed chimeras: Negative selection of the Vbeta T-cell receptor repertoire by both host and donor bone marrow-derived cells. Blood 1996. 88: 4601–4610.
CAS PubMed Web of Science® Google Scholar
49 Spitzer, T. R., Delmonico, F., Tolkoff-Rubin, N., McAfee, S., Sackstein, R., Saidman, S., Colby, C. et al., Combined histocompatibility leukocyte antigen-matched donor bone marrow and renal transplantation for multiple myeloma with end stage renal disease: The induction of allograft tolerance through mixed lymphohematopoietic chimerism. Transplantation 1999. 68: 480–484.
10.1097/00007890-199908270-00006
CAS PubMed Web of Science® Google Scholar
50 Ricordi, C., Karatzas, T., Nery, J., Webb, M., Selvaggi, G., Fernandez, L., Khan, F. A. et al., 1997. High-dose donor bone marrow infusions to enhance allograft survival: The effect of timing. Transplantation 1997. 63: 7–11.
10.1097/00007890-199701150-00003
PubMed Web of Science® Google Scholar
51 Rao, A. S., Fontes, P., Zeevi, A., Rugeles, M., Shapiro, R. Jordan, M., Corry, R. et al., Enhancement of donor cell chimerism in whole organ allograft recipients by adjuvant bone marrow transplantation. Transplant. Proc. 1995. 27: 3387–3388.
CAS PubMed Web of Science® Google Scholar
52 Rao, A. S., Fontes, P., Zeevi, A., Trucco, M., Dodson, F. S., Rybka, W. B., Shapiro, R. et al., Augmentation of chimerism in whole organ recipients by simultaneous infusion of donor bone marrow cells. Transplant. Proc. 1995. 27: 210–212.
PubMed Web of Science® Google Scholar
53 Zeevi, A., Pavlick, M., Banas, R., Bentlejewski, C., Spichty, K., Rao, A. S., Fontes, P. et al., Three years of follow-up of bone marrow-augmented organ transplant recipients: The impact on donor-specific immune modulation. Transplant. Proc. 1997. 29: 1205–1206.
10.1016/S0041-1345(96)00552-0
PubMed Web of Science® Google Scholar
54 Corry, R. J., Chakrabarti, P. K., Shapiro, R., Rao, A. S., Dvorchik, I., Jordan, M. L., Scantlebury, V. P. et al., Simultaneous administration of adjuvant donor bone marrow in pancreas transplant recipients. Ann. Surg. 1999. 230: 372–379.
10.1097/00000658-199909000-00010
CAS PubMed Web of Science® Google Scholar
55 Edinger, M., Hoffmann, P., Ermann, J., Drago, K., Fathman, C. G., Strober, S. and Negrin, R. S., CD4⁺CD25⁺ regulatory T cells preserve graft-versus-tumor activity while inhibiting graft-versus-host disease after bone marrow transplantation. Nat. Med. 2003. 9: 1144–1150.
10.1038/nm915
CAS PubMed Web of Science® Google Scholar
56 Ermann, J., Hoffmann, P., Edinger, M., Dutt, S., Blankenberg, F. G., Higgins, J. P., Negrin, R. S. et al., Only the CD62L⁺ subpopulation of CD4⁺CD25⁺ regulatory T cells protects from lethal acute GVHD. Blood 2005. 105: 2220–2226.
10.1182/blood-2004-05-2044
CAS PubMed Web of Science® Google Scholar
57 Wysocki, C. A., Jiang, Q., Panoskaltsis-Mortari, A., Taylor, P. A., McKinnon, K. P., Su, L., Blazar, B. R. and Serody, J. S., Critical role for CCR5 in the function of donor CD4⁺CD25⁺ regulatory T cells during acute graft-versus-host disease. Blood 2005. 106: 3300–3307.
10.1182/blood-2005-04-1632
CAS PubMed Web of Science® Google Scholar
58 Cohen, J. L., Trenado, A., Vasey, D., Klatzmann, D. and Salomon, B. L., CD4(+)CD25(+) immunoregulatory T cells: New therapeutics for graft-versus-host disease. J. Exp. Med. 196: 401–406.
Google Scholar
59 von Boehmer, H., Mechanisms of suppression by suppressor T cells. Nat. Immunol. 2005. 6: 338–344.
10.1038/ni1180
CAS PubMed Web of Science® Google Scholar
60 James, M. J., Belaramani, L., Prodromidou, K., Datta, A., Nourshargh, S., Lombardi, G., Dyson, J. et al., Anergic T cells exert antigen-independent inhibition of cell-cell interactions via chemokine metabolism. Blood 2003. 102: 2173–2179.
10.1182/blood-2003-02-0637
CAS PubMed Web of Science® Google Scholar
61 Fallarino, F., Grohmann, U., Hwang, K. W., Orabona, C., Vacca, C., Bianchi, R., Belladonna, M. L. et al., Modulation of tryptophan catabolism by regulatory T cells. Nat. Immunol. 2003. 4: 1206–1212.
10.1038/ni1003
CAS PubMed Web of Science® Google Scholar
62 Janssens, W., Carlier, V., Wu, B., VanderElst, L., Jacquemin, M. G. and Saint-Remy, J. M., CD4⁺CD25⁺ T cells lyse antigen-presenting B cells by Fas-Fas ligand interaction in an epitope-specific manner. J. Immunol. 2003. 171: 4604–4612.
10.1084/jem.20051511
CAS PubMed Web of Science® Google Scholar
63 Grossman, W. J., Verbsky, J. W., Tollefsen, B. L., Kemper, C., Atkinson, J. P. and Ley, T. J., Differential expression of granzymes A and B in human cytotoxic lymphocyte subsets and T regulatory cells. Blood 2004. 104: 2840–2848.
10.1182/blood-2004-03-0859
CAS PubMed Web of Science® Google Scholar
64 Ghiringhelli, F., Menard, C., Terme, M., Flament, C., Taieb, J., Chaput, N., Puig, P. E. et al., CD4⁺CD25⁺ regulatory T cells inhibit natural killer cell functions in a transforming growth factor-beta-dependent manner. J. Exp. Med. 2005. 202: 1075–1085.
10.1084/jem.20051511
CAS PubMed Web of Science® Google Scholar
65 Bellone, G., Aste-Amezaga, M., Trinchieri, G. and Rodeck, U., Regulation of NK cell functions by TGF-beta 1. J. Immunol. 1995. 155: 1066–1073.
CAS PubMed Web of Science® Google Scholar
66 Hamad, A. R., Mohamood, A. S., Trujillo, C. J., Huang, C. T., Yuan, E. and Schneck, J. P., B220⁺ double-negative T cells suppress polyclonal T cell activation by a Fas-independent mechanism that involves inhibition of IL-2 production. J. Immunol. 2003. 171: 2421–2426.
10.4049/jimmunol.171.5.2421
CAS PubMed Web of Science® Google Scholar
67 Koh, C. Y., Ortaldo, J. R., Blazar, B. R., Bennett, M. and Murphy, W. J., NK-cell purging of leukemia: Superior antitumor effects of NK cells H2 allogeneic to the tumor and augmentation with inhibitory receptor blockade. Blood 2003. 102: 4067–4075.
10.1182/blood-2003-04-1367
CAS PubMed Web of Science® Google Scholar
68 Matzinger, P., The JAM test. A simple assay for DNA fragmentation and cell death. J. Immunol. Methods 1991. 145: 185–192.
10.1016/0022-1759(91)90325-A
CAS PubMed Web of Science® Google Scholar
69 Hoves, S., Krause, S. W., Scholmerich, J. and Fleck, M., The JAM-assay: Optimized conditions to determine death-receptor-mediated apoptosis. Methods 2003. 31: 127–134.
10.1016/S1046-2023(03)00122-1
CAS PubMed Web of Science® Google Scholar
70 Ayres, F. M., Narita, M., Takahashi, M., Alldawi, L., Liu, A., Osman, Y., Abe, T. et al., A comparative study of the JAM test and ⁵¹Cr-release assay to assess the cytotoxicity of dendritic cells on hematopoietic tumor cells. Immunol. Invest. 2003. 32: 219–227.
10.1081/IMM-120025102
CAS PubMed Web of Science® Google Scholar

Citing Literature

Volume37, Issue12

December 2007

Pages 3455-3466

Donor double-negative Treg promote allogeneic mixed chimerism and tolerance