Association study between polymorphisms in glutathione-related genes and methamphetamine use disorder in a Japanese population†
Please cite this article as follows: Hashimoto T, Hashimoto K, Miyatake R, Matsuzawa D, Sekine Y, Inada T, Ozaki N, Iwata N, Harano M, Komiyama T, Yamada M, Sora I, Ujike H, Iyo M. 2007. Association Study Between Polymorphisms in Glutathione-Related Genes and Methamphetamine Use Disorder in a Japanese Population. Am J Med Genet Part B 147B:1040–1046.
Abstract
Accumulating evidence suggests that oxidative stress plays a role in the mechanisms of action of methamphetamine (METH) in the brain. In the present study, we investigated the association between the genetic polymorphisms among glutathione (GSH)-related enzymes; glutathione S-transferases (GSTs) such as GSTT1 (Non-deletion/Null), GSTT2 (Met139Ile), GSTA1 (−69C/T), and GSTO1 (Ala140Asp); glutathione peroxidase 1 (GPX1) (Pro198Leu); and glutamate-cysteine ligase modifier (GCLM) subunit and METH use disorder in a Japanese population. Two hundred eighteen METH abusers and 233 healthy controls were enrolled in the study. There was a significant difference in GSTT1 genotype frequency between patients with METH psychosis and controls (P = 0.039, odds ratio: 1.52, 95% CI 1.03–2.24). Furthermore, the frequency (66.0%) of the GSTT1 null genotype among prolonged-type METH psychotic patients with spontaneous relapse was significantly higher (P = 0.025, odds ratio: 2.43, 95% CI 1.13–5.23) than that (44.4%) of transient-type METH psychotic patients without spontaneous relapse. However, there were no associations between the polymorphisms of other genes and METH abuse. The present study suggests that the polymorphism of the GSTT1 gene might be a genetic risk factor of the development of METH psychosis in a Japanese population. © 2008 Wiley-Liss, Inc.
INTRODUCTION
Methamphetamine (METH) is one of the most widely used illicit drugs, and its abuse continues to be a growing problem worldwide. Accumulating evidence has suggested that genetic factors play a role in vulnerability to METH abuse and in the psychiatric symptoms related to METH abuse [Kosten et al., 1998; Merikangas et al., 1998; Kendler et al., 2000; Uhl et al., 2002; Goldman et al., 2005; Hashimoto, 2007; Matsuzawa et al., 2007].
Several lines of evidence suggest that oxidative stress may be involved in the METH-induced neuronal damage in the brain, and that antioxidants including glutathione (GSH) and N-acetyl-L-cysteine could be potential therapeutic drugs for METH psychosis and addiction [Cubells et al., 1994; Choi et al., 2002; Cadet et al., 2003; Fukami et al., 2004; Hashimoto et al., 2004; Miyazaki et al., 2006; Achat-Mendes et al., 2007; Hashimoto, 2007]. Glutathione (GSH), one of the major non-protein antioxidants and redox regulators, detoxifies reactive oxidative stress (ROS) and thus plays a major role in protecting neural tissues [Dringen, 2000; Schulz et al., 2000]. A number of papers have demonstrated the neuroprotective effects of GSH or its related compounds such as N-acetyl-L-cysteine on METH-induced dopaminergic neuronal damage [Choi et al., 2002; Fukami et al., 2004; Hashimoto et al., 2004]. Given the role of GSH in the antioxidative process, the genes encoding the proteins known as polymorphic glutathione S-transferases (GSTs: Enzyme Commission (EC) number 2.5.1.18), glutathione cysteine ligase (GCL: EC 6.3.2.2), and glutathione peroxidase (GPX: EC 1.11.1.9) are clearly worthy of investigation [Thomas et al., 1990; Smythies and Galzigna, 1998; Anema et al., 1999; Nakamura et al., 2002; McIlwain et al., 2006]. The GSTs are a family of multifunctional enzymes that catalyze the conjugation of reduced GSH with electrophilic groups of a wide variety of compounds, including carcinogens, environmental contamination, and products of oxidative stress [Mannervik, 1985; Hayes and Strange, 2000; Hayes et al., 2005]. We reported that the functional polymorphisms of the GSTP1 and GSTM1 genes are associated with METH abuse and METH-induced psychosis [Koizumi et al., 2004; Hashimoto et al., 2005], suggesting that the GSTP1 and GSTM1 genes play a role in the pathogenesis of METH abuse.
Both GSTM1 and GSTT1 contain gene deletions, resulting in no enzymatic activity for that isozyme [McLellan et al., 1997; Sprenger et al., 2000]. The single nucleotide polymorphisms (SNPs) related to amino acid substitution among GSTs were shown in GSTT2 (G > A, Met139Ile, rs1622002) and GSTO1 (C > A, Ala140Asp, rs4925) [Yoshimura et al., 2003; Li et al., 2006]. The SNPs in the promoter regions of the GSTA1 gene contain three linked base substitutions (−567T/G, −69C/T, and −52G/A), and affect the gene expression [Ambrosone et al., 2006]. Furthermore, glutathione peroxidase 1 (GPX1), which belongs to a family of selenium-dependent peroxidases, protects cells by eliminating hydrogen peroxides and a wide range of organic peroxides by using GSH as a reducing substrate [Schweizer et al., 2004]. One functional polymorphism of the GPX1 gene is a substitution at codon 198 (Pro198Leu), and the leucine allele is less responsive to added selenium than the proline allele [Hu and Diamond, 2003]. Human glutamate cysteine ligase (GCL) is a rate-limiting enzyme for GSH synthesis, and GCL modifier (GCLM) is one of two subunits composing GCL [Huang et al., 1993]. The SNP (−588C/T) in the promoter region of the GCLM gene was associated with higher promoter activity [Nakamura et al., 2002], and an SNP (G > A, rs2301022) in the intron was demonstrated to be associated with the pathogenesis of schizophrenia [Tosic et al., 2006].
Given these findings, it is of great interest to study the association between the gene polymorphisms in GSH-related enzymes and METH abusers. The present study was undertaken to examine the association between the genetic polymorphisms among GSH-related enzymes (GSTT1, GSTT2, GSTA1, GSTO1, GPX1, GCLM) and METH use disorder in a Japanese population.
MATERIALS AND METHODS
Subjects
The subjects included 218 patients (176 males and 42 females, age: 36.9 ± 12.0 years (mean ± SD), age range: 18–69 years) with METH dependence and a psychotic disorder meeting the ICD-10-DCR criteria (F15.2 and F15.5) and who were outpatients or inpatients of psychiatric hospitals affiliated with the Japanese Genetics Initiative for Drug Abuse (JGIDA), and 233 age-, gender-, and geographical-origin-matched normal controls (187 males and 46 females, age: 38.7 ± 12.6 years (mean ± SD), age range: 19–73 years) with no past history and no family history of drug dependence or psychotic disorders (Table I). The age of the normal subjects did not differ from that of the METH abusers (Table I). The research was performed after approval was obtained from the Ethics Committees of each institute of the JGIDA, and all subjects provided written informed consent for the use of their DNA samples as part of this study.
| Variable | Controls | Abusers | P values |
|---|---|---|---|
| Sex, male/female | 187/46 | 176/42 | 0.906* |
| Age, mean ± SD, y | 38.7 ± 12.6 (19–73) | 36.9 ± 12.0 (18–69) | 0.131** |
| METH psychosis | 191 | ||
| Transient type | 104 | ||
| Prolonged type | 87 | ||
| Spontaneous relapse | |||
| Positive | 91 | ||
| Negative | 100 |
- * The comparison between two groups was performed using the χ2 test.
- ** The comparison between two groups was performed using the t-test.
Background of METH Abusers
Diagnoses were made by two trained psychiatrists based on interviews and available information, including hospital records. Subjects were excluded if they had a clinical diagnosis of schizophrenia, another psychotic disorder, or an organic mental syndrome. All subjects were Japanese, and were born and living in restricted areas of Japan, including northern Kyushu, Setouchi, Chukyo, Tokai, and Kanto. The patients were divided into subgroups based on their characteristic clinical features (Table I). We excluded the subjects for whom there was insufficient clinical data to analyze the genetic polymorphisms in the subgroups of METH abusers. One hundred fifty-two patients had abused both METH and other drugs in the present or the past. After METH, organic solvents and marijuana were the most frequently used substances. Cocaine and heroin were rarely abused in this sample of subjects.
Clinical Course of METH Psychosis
Prognosis of psychosis
The prognosis of METH psychosis varied among patients, some of whom showed continued psychotic symptoms, even after METH discontinuance, as previously reported [Sato et al., 1983, 1992]. Accordingly, the patients were categorized by prognosis into two groups, a transient type and a prolonged type, based on the duration of the psychotic state after METH discontinuance. The transient type of patient was defined as a patient whose symptoms improved within 1 month after METH discontinuance and the start of treatment with neuroleptics, and the prolonged type was defined as a patient whose psychosis continued for more than 1 month after METH discontinuance and the start of treatment with neuroleptics. In this study, there were 104 transient-type and 87 prolonged-type patients with METH psychosis (Table I). One of the issues in categorizing was the difficulty of distinguishing patients who coincidentally developed schizophrenia. Therefore, we excluded cases in which the predominant symptoms were of the negative and/or disorganized type, in order to maintain the homogeneity of the subgroup.
Spontaneous relapse
It has been well documented that once METH psychosis has developed, patients in a state of remission are susceptible to spontaneous relapse without re-consumption of METH [Sato et al., 1983, 1992]. It has thus been postulated that a sensitization phenomenon induced by the repeated consumption of METH develops in the brains of patients with METH psychosis, which provides a neural basis for an enhanced susceptibility to relapse. Therefore, the patients in this study were divided into two groups according to the presence or absence of spontaneous relapse. In this study, 91 patients underwent a spontaneous relapse, and 100 patients did not (Table I).
Genotyping of Identified Polymorphisms
A multiplex polymerase chain reaction (PCR) technique that detects homozygous deletion of GSTT1 was used, including primers for the β-globin gene (forward, 5′-CAA CTT CAT CCA CGT TCA CC-3′; reverse; 5′-GAA GAG CCA AGG ACA GGT AC-3′) as an internal control, with an annealing temperature of 60°C. For GSTT1, primers forward (5'-TTC CTT ACT GGT CCT CAC ATC TC-3′) and reverse (5'-TCA CCG GAT CAT GGC CAG CA-3′) were used. The PCR products were separated on 2% agarose gel stained with ethidium bromide.
The absence of amplified GSTT1 product (in the presence of β-globin as a PCR product) indicated the respective “null” genotype. The individuals in whom the GSTT1 gene was present were genotyped as “non-deletion” referring to previous studies [Sreelekha et al., 2001; Ambrosone et al., 2006]. The genotype of GSTA1 (GSTA1*A-69C and GSTA1*B-69T) was determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) according to Coles et al. 2001. Briefly, the primers used in the PCR were a forward primer (5′-TGT TGA TTG TTT GCC TGA AAT T-3′) and a reverse primer (5′-GTT AAA CGC TGT CAC CCG TCC T-3′). The amplification was performed by denaturing at 94°C for 5 min, followed by 36 cycles at 94°C for 20 sec, annealing at 65°C for 20 sec, and extending at 72°C for 20 sec. The amplification products (10 µl) were digested by 6 U of restriction endonuclease Ear1 (New England Biolabs, Inc., Beverly, MA) at 37°C for 6 hr.
Table II shows the following SNPs information. For genotyping of GSTT2 (G > A, rs1622002), GSTO1 (C > A, rs4925), GPX1 (C > T, rs1050450), GCLM-588 (C > T), and GCLM (G > A, rs2301022), we used TaqMan SNP Genotyping Assays to score SNPs with the ABI Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA). Thermal cycling conditions for PCR were 1 cycle at 95°C for 10 min followed by 50 cycles of 92°C for 15 sec and 60°C for 1 min. The data were analyzed using the Allelic Discrimination Program (Applied Biosystems).
| SNP | Primer sequences forward, F, or reverse, R, primer (5′–3′) | Probe sequences reporter VIC or FAM probe (5′–3′) |
|---|---|---|
| GSTT2 (rs1622002, G > A) | F: GAGAAGGTGGAACGCAACAG | VIC-CTGCCATGGACCAGG-MGB |
| R: TTGTCCTCCAGCCATTGCA | FAM-CTGCCATAGACCAGG-MGB | |
| GSTO1 (rs4925, C > A) | F: GCCATCCTTGGTAGGAAGCTTTAT | VIC-TCTTTTAGGCCAGCATAGT-MGB |
| R: GGAGAAATAATTACCTCCTCTAGCTTGGT | FAM-TTCTTTTAGGCCATCATAGT-MGB | |
| GPX1 (rs1050450, C > T) | F: CATCGAAGCCCTGCTGTCT | VIC-ACAGCTGGGCCCTT-MGB |
| R: CACTGCAACTGCCAAGCA | FAM-ACAGCTGAGCCCTT-MGB | |
| GCLM −588C/T (C > T) | F: GCCCTTTAAAGAGACGTGTAGGAA | VIC-CTCCCGGCGTTCAG-MGB |
| R: CCGCCTGGTGAGGTAGAC | FAM-TCTCCCAGCGTTCAG-MGB | |
| GCLM (rs2301022, G > A) | F: CAGAGTCACACACCACAGTTTGTA | VIC-CAAAGGACTAATTCTGG-MGB |
| R: GTTTTATCCTACTGTTATGAAGCACCCTAA | FAM-CAAAGGACTAGTTCTGG-MGB |
Statistical Analysis
Genotype deviation from the Hardy–Weinberg equilibrium was evaluated Chi-square test. The differences between groups were evaluated by Fisher's exact test. The odds ratio and 95% confidence intervals (CI) between two variables were calculated as an estimate of risk. We estimated the power of association for our sample size using Genetic Power Calculator Software [Purcell et al., 2003] with an α of 0.05 and a disease prevalence of 0.01. Differences were considered significant at P < 0.05.
RESULTS
The genotypic and allelic frequencies of the seven polymorphisms are presented in Table III. For confirmation of the appropriate genotyping, the genotypic frequencies of all variants (GSTT2 (rs1622002): P = 0.168, GSTA1 (−69C/T): P = 0.688, GSTO1 (rs4925): P = 0.168, GPX1 (rs1050450): P = 0.374, GCLM (−588C/T): P = 0.380, GCLM (rs2301022): P = 0.371) in the all subjects including METH abuser samples and control samples were found to be in Hardy–Weinberg equilibrium.
| GSTT1 | n | Genotype | Odds ratios (95%CI) | P | |
|---|---|---|---|---|---|
| Non-deletion | Null | ||||
| Controls | 233 | 140 (60.1%) | 93 (39.9%) | ||
| Abusers | 218 | 109 (50.0%) | 109 (50.0%) | 1.51 (1.04–2.19) | 0.037* |
| Prognosis of psychosis | 191 | 95 (49.7%) | 96 (50.3%) | 1.52 (1.03–2.24) | 0.039* |
| Transient | 104 | 59 (56.7%) | 45 (43.3%) | 1.15 (0.72–1.83) | 0.632 |
| Prolonged | 87 | 36 (41.4%) | 51 (58.6%) | 2.13 (1.29–3.52) | 0.0036** |
| Spontaneous relapse | |||||
| Positive | 91 | 41 (45.1%) | 50 (54.9%) | 1.84 (1.13–2.99) | 0.018* |
| Negative | 100 | 54 (54.0%) | 46 (46.0%) | 1.28 (0.80–2.06) | 0.333 |
| GSTT2 (rs1622002) | n | Genotype | P | Allele | P | |||
|---|---|---|---|---|---|---|---|---|
| G/G | G/A | A/A | G | A | ||||
| Controls | 233 | 157 (67.4%) | 73 (31.3%) | 3 (1.3%) | 387 (83.0%) | 79 (17.0%) | ||
| Abusers | 218 | 149 (68.3%) | 63 (28.9%) | 6 (2.8%) | 0.501 | 361 (82.8%) | 75 (17.2%) | 0.930 |
| Prognosis of psychosis | 191 | 133 (69.6%) | 52 (27.2%) | 6 (3.2%) | 0.298 | 318 (83.2%) | 64 (16.8%) | 1 |
| Transient | 104 | 71 (68.3%) | 30 (28.8%) | 3 (2.9%) | 0.536 | 172 (82.7%) | 36 (17.3%) | 0.912 |
| Prolonged | 87 | 62 (71.3%) | 22 (25.3%) | 3 (3.4%) | 0.256 | 146 (83.9%) | 28 (16.1%) | 0.905 |
| Spontaneous relapse | ||||||||
| Positive | 91 | 63 (69.2%) | 27 (29.7%) | 1 (1.1%) | 0.912 | 153 (84.1%) | 29 (15.9%) | 0.815 |
| Negative | 100 | 70 (70.0%) | 25 (25.0%) | 5 (5.0%) | 0.080 | 165 (82.5%) | 35 (17.5%) | 0.911 |
| GSTA1 −69C/T | n | Genotype | P | Allele | P | |||
|---|---|---|---|---|---|---|---|---|
| C/C | C/T | T/T | C | T | ||||
| Controls | 233 | 180 (77.3%) | 50 (21.4%) | 3 (1.3%) | 410 (88.0%) | 56 (12.0%) | ||
| Abusers | 218 | 158 (72.5%) | 56 (25.7%) | 4 (1.8%) | 0.508 | 372 (85.3%) | 64 (14.7%) | 0.241 |
| Prognosis of psychosis | 191 | 144 (75.4%) | 44 (23.0%) | 3 (1.6%) | 0.916 | 332 (86.9%) | 50 (13.1%) | 0.677 |
| Transient | 104 | 79 (76.0%) | 23 (22.1%) | 2 (1.9%) | 0.811 | 181 (87.0%) | 27 (13.0%) | 0.706 |
| Prolonged | 87 | 65 (74.7%) | 21 (24.1%) | 1 (1.2%) | 0.852 | 151 (86.8%) | 23 (13.2%) | 0.686 |
| Spontaneous relapse | ||||||||
| Positive | 91 | 66 (72.5%) | 23 (25.3%) | 2 (2.2%) | 0.552 | 155 (85.2%) | 27 (14.8%) | 0.360 |
| Negative | 100 | 78 (78.0%) | 21 (21.0%) | 1 (1.0%) | 1 | 177 (88.5%) | 23 (11.5%) | 0.897 |
| GSTO1 (rs4925) | n | Genotype | P | Allele | P | |||
|---|---|---|---|---|---|---|---|---|
| C/C | C/A | A/A | C | A | ||||
| Controls | 233 | 166 (71.2%) | 55 (23.6%) | 12 (5.2%) | 387 (83.0%) | 79 (17.0%) | ||
| Abusers | 218 | 163 (74.8%) | 53 (24.3%) | 2 (0.9%) | 0.033* | 379 (86.9%) | 57 (13.1%) | 0.114 |
| Prognosis of psychosis | 191 | 140 (73.3%) | 49 (25.7%) | 2 (1.0%) | 0.057 | 329 (86.1%) | 53 (13.9%) | 0.253 |
| Transient | 104 | 74 (71.1%) | 29 (27.9%) | 1 (1.0%) | 0.140 | 177 (85.1%) | 31 (14.9%) | 0.573 |
| prolonged | 87 | 66 (75.9%) | 20 (23.0%) | 1 (1.1%) | 0.295 | 152 (87.4%) | 22 (12.6%) | 0.223 |
| Spontaneous relapse | ||||||||
| Positive | 91 | 64 (70.3%) | 27 (29.7%) | 0 (0.0%) | 0.042* | 155 (85.2%) | 27 (14.8%) | 0.556 |
| Negative | 100 | 76 (76.0%) | 22 (22.0%) | 2 (2.0%) | 0.404 | 174 (87.0%) | 26 (13.0%) | 0.246 |
| GPX1 (rs1050450) | n | Genotype | P | Allele | P | |||
|---|---|---|---|---|---|---|---|---|
| C/C | C/T | T/T | C | T | ||||
| Controls | 233 | 207 (88.8%) | 23 (9.9%) | 3 (1.3%) | 437 (93.8%) | 29 (6.2%) | ||
| Abusers | 218 | 189 (86.7%) | 29 (13.3%) | 0 (0.0%) | 0.142 | 407 (93.3%) | 29 (6.7%) | 0.892 |
| Prognosis of psychosis | 191 | 165 (86.4%) | 26 (13.6%) | 0 (0.0%) | 0.185 | 356 (93.2%) | 26 (6.8%) | 0.780 |
| Transient | 104 | 90 (86.5%) | 14 (13.5%) | 0 (0.0%) | 0.457 | 194 (93.3%) | 14 (6.7%) | 0.865 |
| Prolonged | 87 | 75 (86.2%) | 12 (13.8%) | 0 (0.0%) | 0.403 | 162 (93.1%) | 12 (6.9%) | 0.720 |
| Spontaneous relapse | ||||||||
| Positive | 91 | 82 (90.1%) | 9 (9.9%) | 0 (0.0%) | 0.796 | 173 (95.1%) | 9 (4.9%) | 0.710 |
| Negative | 100 | 83 (83.0%) | 17 (17.0%) | 0 (0.0%) | 0.105 | 183 (91.5%) | 17 (8.5%) | 0.318 |
| GCLM −588C/T | n | Genotype | P | Allele | P | |||
|---|---|---|---|---|---|---|---|---|
| C/C | C/T | T/T | C | T | ||||
| Controls | 233 | 172 (73.8%) | 59 (25.3%) | 2 (0.9%) | 403 (86.5%) | 63 (13.5%) | ||
| Abusers | 218 | 150 (68.8%) | 62 (28.4%) | 6 (2.8%) | 0.214 | 362 (83.0%) | 74 (17.0%) | 0.164 |
| Prognosis of psychosis | 191 | 131 (68.6%) | 55 (28.8%) | 5 (2.6%) | 0.241 | 317 (83.0%) | 65 (17.0%) | 0.177 |
| Transient | 104 | 73 (70.2%) | 29 (27.9%) | 2 (1.9%) | 0.594 | 175 (84.1%) | 33 (15.9%) | 0.474 |
| Prolonged | 87 | 58 (66.7%) | 26 (29.9%) | 3 (3.4%) | 0.143 | 142 (81.6%) | 32 (18.4%) | 0.134 |
| Spontaneous relapse | ||||||||
| Positive | 91 | 60 (65.9%) | 29 (31.9%) | 2 (2.2%) | 0.217 | 149 (81.9%) | 33 (18.1%) | 0.141 |
| Negative | 100 | 71 (71.0%) | 26 (26.0%) | 3 (3.0%) | 0.343 | 168 (84.0%) | 32 (16.0%) | 0.400 |
| GCLM (rs2301022) | n | Genotype | P | Allele | P | |||
|---|---|---|---|---|---|---|---|---|
| G/G | G/A | A/A | G | A | ||||
| Controls | 233 | 125 (53.7%) | 90 (38.6%) | 18 (7.7%) | 340 (73.0%) | 126 (27.0%) | ||
| Abusers | 218 | 126 (57.8%) | 76 (34.9%) | 16 (7.3%) | 0.682 | 328 (75.2%) | 108 (24.8%) | 0.448 |
| Prognosis of psychosis | 191 | 109 (57.1%) | 66 (34.5%) | 16 (8.4%) | 0.694 | 284 (74.3%) | 98 (25.7%) | 0.696 |
| Transient | 104 | 61 (58.7%) | 34 (32.7%) | 9 (8.6%) | 0.587 | 156 (75.0%) | 52 (25.0%) | 0.636 |
| Prolonged | 87 | 48 (55.2%) | 32 (36.8%) | 7 (8.0%) | 0.925 | 128 (73.6%) | 46 (26.4%) | 0.920 |
| Spontaneous relapse | ||||||||
| Positive | 91 | 52 (57.1%) | 34 (37.4%) | 5 (5.5%) | 0.790 | 138 (75.8%) | 44 (24.2%) | 0.488 |
| Negative | 100 | 57 (57.0%) | 32 (32.0%) | 11 (11.0%) | 0.403 | 146 (73.0%) | 54 (27.0%) | 1 |
- Bold shows a significant difference.
- * P < 0.05, **P < 0.01 as compared to control group.
We found significantly different frequencies of genotype between METH abusers and controls in GSTT1 (Table III). There was a significant difference in GSTT1 genotype frequency between METH abusers and controls (P = 0.037). The frequency (50.0%) of the GSTT1 null genotype among METH abusers was significantly higher (P = 0.037, odds ratio: 1.51, 95% CI 1.04–2.19) than that (39.9%) in controls. There was also a significant difference in GSTT1 genotype frequency between patients with METH psychosis and controls (P = 0.039). The frequency (50.3%) of the GSTT1 null genotype among patients with METH psychosis was also significantly higher (P = 0.039, odds ratio: 1.52, 95% CI 1.03–2.24) than that (39.9%) in controls. We examined the association between the clinical features of patients with METH psychosis (i.e., transient-type or prolonged-type psychosis, with or without spontaneous relapse) and controls in GSTT1 genotype frequency (Table III). The frequency (58.6%) of the GSTT1 null genotype among patients who were METH abusers with prolonged-type psychosis was significantly higher (P = 0.0036, odds ratio: 2.13, 95% CI 1.29–3.52) than that (39.9%) of controls, although there was no difference in GSTT1 genotype frequency between METH abusers with transient-type psychosis and controls (Table III). The frequency (54.9%) of the GSTT1 null genotype among METH abusers with spontaneous relapse was significantly higher (P = 0.018, odds ratio: 1.84, 95% CI 1.13–2.99) than that (39.9%) of controls, although there was no difference in GSTT1 genotype frequencies between METH abusers without spontaneous relapse and controls (Table III). Furthermore, to examine the association between GSTT1 gene polymorphism and the clinical course of METH psychosis, we analyzed the frequency of the GSTT1 genotype among patients with METH psychosis. As shown in Table IV, we classified patients with METH psychosis into four subgroups based on the course of METH psychosis (i.e., transient or prolonged METH psychosis with or without spontaneous relapse of psychotic symptoms). There was a significant difference in GSTT1 genotype frequency between prolonged-type METH psychotic patients with spontaneous relapse and transient-type METH psychotic patients without spontaneous relapse (P = 0.025). The frequency (66.0%) of the GSTT1 null genotype among prolonged-type METH psychotic patients with spontaneous relapse was significantly higher (P = 0.025, odds ratio: 2.43, 95% CI 1.13–5.23) than that (44.4%) of transient-type METH psychotic patients without spontaneous relapse (Table IV).
| n | Age, mean ± SD | Genotype | Odds ratios (95% CI) | P | ||
|---|---|---|---|---|---|---|
| Non-deletion | Null | |||||
| Transient-type psychosis spontaneous relapse | ||||||
| Negative | 63 | 38.9 ± 11.7 | 35 (55.6%) | 28 (44.4%) | ||
| Positive | 41 | 37.1 ± 10.5 | 24 (58.5%) | 17 (41.5%) | 0.89 (0.40–1.96) | 0.84 |
| Prolonged-type psychosis spontaneous relapse | ||||||
| Negative | 37 | 33.4 ± 13.8 | 19 (51.4%) | 18 (48.6%) | 1.18 (0.52–2.67) | 0.84 |
| Positive | 50 | 38.1 ± 12.0 | 17 (34.0%) | 33 (66.0%) | 2.43 (1.13–5.23) | 0.025* |
- P-value as compared to transient METH psychotic patients without spontaneous relapse (Fisher's exact test).
- Bold shows a significant difference.
- * P < 0.05 as compared to transient METH psychotic patients without spontaneous relapse.
No significant differences were found in the allelic and genotypic frequencies of the SNPs of GSTT2 (rs1622002), GSTA1 (−69C/T), GPX1 (rs1050450), GCLM −588C/T, and GCLM (rs2301022) between METH abusers and controls (Table III). Although there was a significant difference in the genotype frequency (P = 0.033) of GSTO1 (rs4925) between METH abusers and controls, no difference in terms of allele frequency (P = 0.114, odds ratio: 0.74, 95% CI 0.51–1.07) was detected between the two groups. There was also no difference in the allele frequency (P = 0.556) of GSTO1 between METH abusers with spontaneous relapse and controls, though a significant difference in genotype frequency (P = 0.042) of GSTO1 was detected between the two groups.
DISCUSSION
The present study showed that the polymorphism of the GSTT1 gene was associated with METH psychosis in a Japanese population. The finding supports the hypothesis that oxidative stress mechanisms including GSH-related enzymes might play a role in the pathogenesis of METH psychosis. In this study, we found that the frequency of the GSTT1 null genotype was significantly higher among patients with METH psychosis than among controls. This finding was consistent with our previous report that the frequency of the GSTP1 gene with the 105 valine allele, which results in low activity of GST [Pemble et al., 1994; Watson et al., 1998], was significantly higher among patients with METH psychosis than among controls [Hashimoto et al., 2005].
It has been suggested that the ROS and dopamine (DA) quinones generated by the administration of METH covalently conjugate with the sulfhydryl group of cysteine on functional proteins such as dopamine transporter (DAT), leading to METH-induced neuronal damage in the brain [Smythies and Galzigna, 1998; Whitehead et al., 2001; Asanuma et al., 2003; Miyazaki et al., 2006; Hashimoto, 2007]. GSTs are considered to play a role in the protective effect against oxidative stress by catalyzing the conjugation of electrophilic substrates such as ROS and DA quinones [Smythies and Galzigna, 1998; Whitehead et al., 2001]. In addition, recent studies reported that the mRNA expressions of both GSTT1 and GSTP1 were detected in the human brain [Nishimura and Naito, 2006], and that GSTT1 and GSTP1 were induced under conditions of oxidative stress [Strange et al., 2000; Brind et al., 2004]. Therefore, these findings suggest that the gene polymorphisms related to low activity of GST may lead to an excess of oxidative products (e.g., ROS and DA quinones) induced by the administration of METH, and might lead to METH-induced neuronal damage in the human brain, and consequently METH-related psychiatric symptoms such as METH psychosis.
In the present study, we found that the polymorphism of GSTT1 gene was associated with prolonged, but not transient, METH psychosis, and with spontaneous relapse of a psychotic state. It is of great interest to find an association between GSTT1 gene polymorphism and the clinical course of METH psychosis. Patients with prolonged-type psychosis, that is, psychosis continuing for more than 1 month even after METH discontinuance, or patients with spontaneous relapse of psychotic symptoms are categorized as having a “severe clinical course of METH psychosis,” while patients with transient-type psychosis, defined as improvement of the psychotic state within 1 month, or patients without spontaneous relapse are categorized as having a “mild clinical course” [Ujike et al., 2003; Ujike and Sato, 2004]. Our findings suggest that the GSTT1 null genotype may be associated with the severe clinical course of METH psychosis. Given that GSTs are considered to play a role in the protective effect against oxidative stress induced by METH in the brain, METH users with the GSTT1 null genotype may be more vulnerable to METH-induced neurotoxicity than those with the GSTT1 non-deletion genotype. Taken all together, the findings of the present study suggest that the polymorphism of the GSTT1 gene might be a genetic risk factor for the development of METH psychosis. Furthermore, it is also likely that a genetic polymorphism in the GSTT1 gene might serve as a molecular marker for monitoring the clinical course among patients with METH psychosis.
In this study, we found no associations between the gene polymorphisms of the GSH-related enzymes, including GSTT2 (rs1622002), GSTA1 (−69C/T), GSTO1 (rs4925), GPX1 (rs1050450), GCLM −588C/T, and GCLM (rs2301022), and METH abusers in a Japanese population, although the genotype frequency of the GSTO1 gene was significantly different between METH abusers and controls. Therefore, the GSH-related genes, including GSTT2, GSTA1, GSTO1, GPX1, and GCLM, may have no major genetic effects on the pathogenesis of METH abuse in the Japanese population. In contrast, a post-mortem brain study showed that GST activity in the putamen of METH users with severe DA loss in the caudate was decreased, although the activities of both GPX and glutamate-cysteine ligase were not changed [Mirecki et al., 2004], a finding that supports the possibility that oxidative stress plays a role in the pathophysiology of patients who engage in METH abuse.
Some limitations of the present study are as follows. First, the sample size is small. Because of the small number of subgroups, we cannot rule out type I or type II errors. Using the genetic statistics package Genetic Power Calculator prepared by Purcell et al. 2003, the genetic power of the present association analysis has been estimated to be as high as 30%. Further studies with larger samples are clearly needed to verify the present findings. Second, there is sample collection in this study. The strengths of the sample collection is the geographically matched sample of cases and controls, since we matched these cases and controls based on geographic data. The weakness of the sample collection is the small sample size of METH users without psychosis, since we collected the sample from subjects at a psychiatric hospital. Therefore, it will be very useful to collect a sample of METH users without psychosis.
In conclusion, the present findings suggest that the polymorphism of the GSTT1 gene might be a genetic risk factor of the development of METH use disorder, and that genetic polymorphism in the GSTT1 gene may serve as a molecular marker for monitoring clinical course among patients with METH psychosis. Furthermore, it is possible that the GSH-related genes, including GSTT2, GSTA1, GSTO1, GPX1, and GCLM, have no major genetic effects on the pathogenesis of schizophrenia in a Japanese population.
Acknowledgements
Funding for this study was provided by grants for Psychiatric and Neurological Disorders and Mental Health from the Ministry of Health, Labor and Welfare, Japan (to K.H.) and Scientific Research from the Ministry of Education, Culture, Sports, Science, and Technology of Japan (to K.H.).
