Genetic analyses

DNA was extracted from the patients' peripheral blood, and whole-exome sequencing (WES) was conducted at the Institute of Human Genetics, Technical University of Munich, Germany. WES was performed on an Illumina NovaSeq6000 system (Illumina, San Diego, California) using a SureSelect Human All Exon Kit (Agilent 60mb V6) for enrichment in the index patient and a Twist Human Exome 2.0 Plus Comprehensive Exome Spike-in and Mitochondrial Panel in the brother of the index patient. Reads were aligned to the Genome Reference Consortium Human Build 37 (GRCh37) using Burrow-Wheeler Aligner.¹⁰ Single nucleotide variants and small insertions and deletions were analyzed using the SAMtools pipeline,¹¹ and ExomeDepth as well as Pindel were used to detect copy number variations.¹² Variant calling was carried out with the exome variant analysis database (EVAdb) pipeline of the Institute of Human Genetics of the Technical University Munich as previously described.¹³ Apolipoprotein E (APOE) status was evaluated performing qPCR with TaqMan assays (Thermofisher) at two SNP positions of the APOE gene (rs429358 and rs7412). Allelic discrimination analysis of both positions was used to determine the APOE genotype. Chromosome 9 open reading frame 72 (C9orf72) genotyping was performed using flanking PCR and repeat primed PCR with FAM-labeled primers as previously described.¹⁴ Detection and sizing of PCR products were performed on the ABI 3500 Instrument (Applied Biosystems) using GeneScanTM LIZ600 size standard v.2.0. (Applied Biosystems).

Neuropathological examination

Postmortem histopathological brain examination was conducted in the index patient. Gross brain examination was followed by the evaluation of formalin fixed and paraffin-embedded tissue blocks representing both hemispheres that included the following anatomical regions: prefrontal cortex, motor cortex, anterior cingulate, parietal, temporal, occipital cortices, hippocampus, ento- and transentorhinal cortex, amygdala, anterior and posterior basal ganglia, thalamus, mesencephalon, pons, medulla oblongata, spinal cord, and cerebellum. In addition to hematoxylin and eosin (HE) and Luxol-fast-blue staining, the following mouse monoclonal antibodies were applied for immunohistochemistry: anti-phosphorylated tau (1:2000, clone AT8, pS202/pT205; Thermo Scientific, Rockford, IL, USA), anti-phosphorylated TDP-43 (1:20,000, clone 11–9, pS409/410; Cosmo Bio, Tokyo, Japan), anti-p62 (1:500, clone 3/p62 lck ligand; BD Transduction Laboratories, Franklin Lakes, NJ, USA), anti-ßA4-amyloid (1:100, clone 6F/3D; DAKO, Glostrup, Denmark), anti-alpha-synuclein (1:4000, clone 5G4; Roboscreen, Leipzig, Germany), and two anti-optineurin antibodies (non-C-terminal: 1:500 polyclonal Proteintech Group, Rosemont, IL, US; C-terminal: 1:800, polyclonal, Cayman Chemical, Ann Arbor, MI, US). The DAKO EnVision© detection kit, peroxidase/DAB, rabbit/mouse (Dako, Glostrup, Denmark) was used for visualization of antibody reactions.

RNA extraction and rtPCR

The RNAeasy Plus Mini Kit (QIAGEN) was used for extraction of RNA from PBMCs (brother of the index patient and control) and following the manufacturer's instructions. cDNA was then synthesized from 30 ng RNA with an iScript cDNA synthesis Kit (Bio-Rad, Cat. No 1708891). Quantitative rt-PCR was performed with the SYBR™ Green Master Mix (ThermoFisher) using the Agilent AriaMx rt-PCR system. The primers for the target gene (OPTN, forward: AAAACTGGAACTGGCAGAGAA, reverse: TGCAATGCCAGTTGCTCCTTT) and house-keeping gene (GAPDH, forward: ATGGTGAAGGTCGGAGTGAA, reverse: CGTGGGTGGAATCATACTGG) were used to analyze RNA expression. Technical triplicates were performed.

Protein extraction and western blot

For western blot analyses, protein was extracted from fresh deep frozen frontal cortex tissue (index patient and control) and PBMC lysates (brother of the index patient and control). Following digestion with up to 300 μL cold RIPA buffer (ThermoFisher) and addition of Complete™ protease inhibitor cocktail (Merck) and PhosSTOP™ phosphatase inhibitor (Merck) samples, centrifugation at 14,000 rcf (for 10 min at 4°C) was performed and supernatants were used for further analysis. Protein concentrations were quantified with a Bradford Protein Assay Kit (Bio-Rad). To achieve a final concentration of 1 μg/μL, protein samples were diluted with RIPA buffer (ThermoFisher), 2x Laemmli buffer (Bio-Rad, 1610737), and distilled water. Proteins were then denatured at 70°C for 10 min.

Brain tissue lysates and PBMC lysates were loaded onto NuPAGE™ Bis-Tris 4–12% gradient gels (ThermoFisher) at a total protein quantity of 5 μg and 30 μg per well, respectively. Proteins were separated by gel electrophoresis with NuPAGE™ MOPS SDS running buffer (ThermoFisher) at up to 90 V (brain tissue lysates) or 120 V (PBMC lysates). The Trans-Blot Turbo™ Transfer System was used for transfer of proteins onto nitrocellulose membranes at 25 V for 15 min. Membranes with loaded proteins were incubated with EveryBlot Blocking Buffer (Bio-Rad) at room temperature for 30–60 min, followed by incubation with primary antibodies at 4°C for at least 8 h. We used two OPTN polyclonal antibodies (Proteintech, Cat. No. 10837-1-AP, at a dilution of 1:10,000 & Cayman, Item No. 100000, at a dilution of 1:1000), of which one binds to the C-terminus of optineurin (Cayman), and a GAPDH antibody (Cell Signaling, Cat No. 2118, at a dilution of 1:1000). This was followed by washing membranes with TBS-T 3x for 10 min, incubation with the appropriate anti-horseradish peroxidase (HRP)-coupled secondary antibodies (mouse: Cell Signaling, Cat. No 7076; rabbit: Merck Millipore, Cat No. GENA934-1:10,000 dilution) for 30 min, and a second washing course with TBS-T as described above. Before imaging with the VILBER FUSION FX system, membranes were incubated with Clarity ECL solution (Bio-Rad) for 30–45 sec. Technical triplicates were performed.

Index patient

The 41-year-old male patient developed dysphagia, cervical pain, and headache followed by rapidly progressing clinical features of upper and lower motor neuron dysfunction, starting with dysarthria and weakness of his right arm and further evolving into a right-accentuated spastic tetraparesis with muscle atrophy and fasciculations. He experienced cognitive deterioration, affecting his attention, memory, language, and executive function. He developed behavioral changes, which started with paranoid delusions and intermittent bursts of aggression and evolved into a severe depressive state with suicidal ideation and apathy. The patient did not show any extrapyramidal signs in his clinical course. He was admitted to the Department of Neurology of the Medical University of Vienna 8 months after symptom onset. At the time of hospitalization, the patient was tetraparetic and unable to walk or communicate with a score of 12 at the revised amyotrophic lateral sclerosis functional rating scale (ALSFRSR). He was diagnosed with ALS-FTD based on current diagnostic criteria.^{15, 16}

The patient had a history of rheumatoid arthritis (RA), affecting primarily his lower extremities, although at the time of admission there were no related clinical symptoms and the patient did not receive any immunosuppressive therapy.

3-Tesla magnetic resonance imaging (MRI) was acquired on a Siemens Vida and showed increased symmetrical T2 signal intensities in the pyramidal tracts (Fig. 1A), band-like cortical/juxtacortical paramagnetic susceptibility artifacts in the precentral gyrus, consistent with a motor band sign in susceptibility weighted images (SWI) (Fig. 1B), and increased symmetric STIR signal intensities of the shoulder girdle musculature, consistent with denervation edema. Electromyography revealed signs of acute denervation in the bulbar, cervical, and lumbar region and showed no evidence of chronic denervation. Cerebrospinal fluid (CSF) and blood biomarker profile are summarized in Table 1. The concentration of total tau (tTau) in the CSF was increased (664 pg/mL, reference value <300 pg/mL), phosphorylated tau181 (pTau181) was normal (30 pg/mL, reference value <61 pg/mL), whereas the level of amyloid-β 42 (Aβ42) was decreased (350 pg/mL, reference value >500 pg/mL). The Aβ42/40 ratio was within the normal range (0.12 pg/mL, “in-house” reference value >0.07). Only a few days after admission, the patient developed aspiration pneumonia and died due to respiratory insufficiency 8 months after symptom onset.

Brother of index patient

The 44-year-old brother of the index patient started to exhibit progressive behavioral changes and mnestic deficits at the age of 38. The patient gradually isolated himself, lost all forms of social contact and neglected personal care. He was diagnosed with FTD at the age of 43 according to current diagnostic criteria.¹⁶ Follow-up examinations showed a progressing decline in memory, executive and language function as well as increasing apathy, loss of empathy and dietary changes, without any clinical evidence of extrapyramidal or motor neuron dysfunction. Neurophysiological examination did not show any abnormalities.

Cranial MRI demonstrated a global gray matter volume loss with regional and global metrics below the age- and sex-corrected tenth percentile (Siemens syngo.via) without any evidence of imaging features associated with ALS (Fig. 1C,D). PTau181 and tTau CSF levels (104 and 523 pg/mL, respectively) were elevated, while the concentration of Aβ42 was normal (Table 1). The Aβ42/40 ratio was marginally decreased (0.06 pg/mL). Fluorodeoxyglucose positron emission tomography (FDG-PET) scan depicted a frontomesial and parietal accentuated hypometabolism, whereas amyloid-PET imaging was negative. At the time of this report, the brother/patient is still alive with the clinical diagnosis of behavioral FTD.

Familial pedigree

The pedigree is visualized in Figure 2. The described family is of Turkish descent, with both parents being first cousins as well as the index patient and the brother of the index patients being involved in a consanguineous marriage to their first cousins. The pedigree included three cousins on the father's side diagnosed with slow-progressing ALS as well as one uncle on the mother's side and one on the father's side who were affected by dementia at later ages.

Genetic analyses

WES revealed an autosomal-recessive pathogenic homozygous frameshift mutation in the OPTN gene (NM_001008212.2: c.1078_1079del; p.Lys360ValfsTer18) in both siblings (PVS1, PM2 and PM3 according to the 2015 ACMG criteria).¹⁷ Due to the high coverage of the variant with WES in both subjects (37x and 77x coverage, respectively; Figs. S1–S3), we did not perform additional Sanger sequencing. This variant has previously been listed as a (likely) pathogenic variant in ClinVar and has not been listed in the Genome Aggregation Database (gnomAD) v2.1.1. No other candidate mutations in other FTD- and ALS-related genes were observed. The index patient had an APOE3/4 genotype, while his brother was APOE3 homozygous. Additionally, the TMEM106B rs1990622 A/A genotype was excluded in both patients. Rt-PCR revealed expression of OPTN-mRNA, but we could not detect optineurin in western blot analyses and immunohistochemistry of brain tissue from the index patient and PBMCs from his brother (Fig. 4A–C).

Neuropathological findings (index patient)

Basic histopathological examination revealed severe neurodegenerative changes. The motor cortex, the anterior horn of the spinal cord, and the motor nuclei in the brainstem showed a marked loss of motor neurons accompanied by a florid degeneration of the corticospinal tract (Fig. 3A–C). Moreover, a pattern of frontotemporal lobar degeneration was observed and characterized by superficial laminar spongiosis in frontotemporal regions and diffuse neuronal loss and gliosis (Fig. 3G). The basal ganglia and the substantia nigra were also affected by neuronal loss, gliosis, and microglial activation. Immunohistochemical examination revealed widespread TDP-43-pathology in motor and extramotor regions involving neurons and glial cells. The neuronal pathology included diffuse “dash-like” cytoplasmatic, filamentous, and compact morphologies, and affected all cortical layers, diffusely the neurons of the basal ganglia and the motor neurons (Fig. 3E,H,I); there were also fine neurites throughout the cortex. The glial pathology was prominent and characterized by a high density of comma-shaped cytoplasmic oligodendroglial inclusions localized in both the gray matter and white matter (Fig. 3F). These changes were consistent with an ALS-FTLD pattern and with Stage 4 of ALS-related TDP-43 pathology according to Brettschneider et al.¹⁸ The pattern of TDP-43 pathology in cortical and subcortical areas was consistent with a FTLD type B pattern according to Mackenzie et al.^{19, 20} No optineurin aggregates were detected in motor neurons containing phospho-TDP43 inclusions (Fig. 4D–I), in contrast to what we observed in a sporadic ALS case used as a positive control. In addition, there was a prominent temporo-medial tauopathy involving the amygdala and the hippocampus. These areas showed a marked neuronal and glial tau pathology with features that were partly reminiscent of argyrophilic grain type pathology including abundant ballooned neurons (Fig. 3K lower left panel, asterisk), pretangles (Fig. 3L upper panel, arrow heads), small tangles, neuropil threads, coiled bodies (Fig. 3L upper panel), single granular fuzzy astrocytes (Fig. 3L lower left panel), and grain-like structures (Fig. 3K lower right panel). These inclusions were mainly immunoreactive for 4-repeat tau. While the pathology was most prominent in mesiotemporal areas (i.e., amygdala and hippocampus), it also extended to the septal region and minimally to the pontine tegmentum and spinal cord, where isolated neuropil threads and pretangles were identified. Overall, the extent of tau pathology exceeded the range expected by the patient's age. P62-positive and TDP-43-negative inclusions in the hippocampus or cerebellum suggestive of C9orf72-repeat expansion could not be observed. (image not shown). Immunohistochemical screening for other pathological protein aggregates showed no evidence of beta-amyloid pathology in frontal, temporal, parietal, or occipital cortical areas, the hippocampus, the basal ganglia, the midbrain or in the cerebellar cortex. There was also no evidence of α-synuclein pathology in the olfactory bulb, the amygdala, or the medulla oblongata (image not shown).