Smad3 and Smad4 mediate transforming growth factor-β1-induced IgA expression in murine B lymphocytes

2.1 Involvement of TGF-β1 and Smad proteins in GLα transcription

TGF-β1 increases IgA class switching in cultured cells 1–3. In the present study, we examined the mechanisms by which TGF-β1 induces IgA expression in the sIgM⁺ mouse B cell line, CH12.LX.4933 and in normal mouse spleen B cells. First, we determined whether TGF-β1 increases the expression of GLα transcripts in CH12.LX B lymphoma cell lines, CH12.LX.4933 (sIgM⁺) and CH12.LX.4F10 (sIgA⁺). Measurable amounts of endogenous GLα transcripts were detected in LPS-stimulated CH12.LX.4933 in the absence of TGF-β1 and the level was substantially increased in the presence of TGF-β1. In contrast, no GLα transcripts were detected in LPS-stimulated CH12.LX.4F10 (α⁺) cells which have already switched to IgA expression (Fig. 1A). To further understand how TGF-β1 induces GLα transcription, CH12.LX.4933 lymphomas were transfected with pFL3, a plasmid reporter containing a portion of GLα promoter 12, and stimulated with TGF-β1. TGF-β1 stimulated reporter gene activity by approximately 2.5-fold (Fig. 1B) and, further, it increased the reporter activity in a dose-dependent manner (data not shown). These results strongly confirm previous results suggesting that TGF-β1 induces endogenous GLα transcription through the GLα promoter 11–14. Next, we examined whether Smad proteins play any role in signaling of TGF-β1-induced GLα promoter activity. Smad3 was overexpressed with pFL3 in CH12.LX.4933 lymphomas. As shown in Fig. 1B, Smad3 caused 2-fold increase in GLα promoter activity. To verify that transfected Smad3 gene is expressed at the protein level, we performed immunoprecipitation with anti-FLAG antibody and Western blotting with anti-Smad3 antibody (Fig. 1C).

Subsequently, we examined whether Smad4 and Smad7 regulate the activity of the GLα promoter (Fig. 2). Smad4 or Smad7 alone had little effect on the activity of pFL3. However, overexpressed Smad4 synergized with Smad3 leading to a 16-fold increased induction of the GLα promoter. These results are consistent with previous reports indicating that Smad3 and Smad4 cooperatively induce TGF-β1-dependent heteromeric complex for transcriptional activation 20, 21, 27. On the other hand, overexpression of Smad7, a TGF-β-inducible antagonist of TGF-β signaling 28, led to 76% reduction in the promoter activity in the Smad3/4-mediated promoter activity (Fig. 2).

Since phosphorylated Smad2 and Smad3 are known to form heterodimeric complexes with Smad4, the involvement of Smad2 in GLα promoter activity was also examined. Transfected Smad2 alone or Smad2/4 in combination did not increase the promoter activity (data not shown). Similar to our results, Smad2 has also been found to be unable to activate a reporter plasmid driven by an intact GLα promoter, although Smad3 in combination with Smad4 activate it well 25.

2.2 Effect of Smad3 and 4 on IgA expression in B lymphoma cells

Since overexpressed Smad3 and 4 markedly increased GLα promoter activity, it was important to ask next whether Smad3 and 4 are involved in inducing IgA switching events. I.29μ B lymphoma cells were transfected with Smad3 and 4 and their effects on IgA expression was assessed by measuring the degree of surface IgA expression and IgA secretion. As shown in Table 1, TGF-β1 significantly increased surface IgA expression and this was further augmented by overexpressed Smad3/4. In parallel, Smad3/4 further enhanced the total IgA secretion which was mediated by TGF-β1. Thus, these data suggest that Smad3 and Smad4 mediate TGF-β1-induced IgA isotype synthesis in the tested B lymphomas.

2.3 Smad3 and 4 mediate TGF-β1-induced endogenous GLα transcription

To obtain the direct evidence that Smad molecules are implicated in IgA regulation in normal B cell population, we determined the effect of transfected Smad3/4 on endogenous GLα transcripts in LPS-activated spleen cells. Since it is generally believed to be difficult to transfect the primary cell population, transfection efficiency of expression vectors was demonstrated using pGFP-C1, a plasmid expressing green fluorescent protein (GFP), in normal spleen cells. At 2 days following electroporation, up to 46% of the normal spleen cells expressed GFP, depending on the electroporation condition (Fig. 3). These conditions were adopted for further transfections. As shown in Fig. 4, in the absence of TGF-β1, endogenous GLα transcripts are not expressed by LPS-activated spleen cells, unlike CH12.LX B lymphoma cells (Fig. 1A). TGF-β1 increases expression of endogenous GLα transcripts and this increase is further augmented by overexpressed Smad3/4. In contrast, expression of endogenous GLγ1 transcripts is diminished by transfected Smad3/4 in the presence of TGF-β1 (Fig. 4). Similarly, transfected Smad3/4 also decreased the expression of GLγ3 transcripts (data not shown). Taken together, our results suggest that Smad3 and Smad4 are specific transducing molecules in TGF-β1-induced GLα transcription in normal spleen B cells.

2.4 Effect of Smad3/4 on Ig synthesis in normal spleen B cells

We and others have previously shown that IgA isotype expression is selectively induced by TGF-β1 and is further augmented by the addition of either IL-2 or IL-5 to cultures of LPS-activated murine spleen B cells 1–3 or to PWM or CD40L (or anti-CD40) -activated human tonsillar B cells 29. In contrast, TGF-β1 suppresses the production of IgM and IgG1 isotypes by LPS-activated murine spleen B cells. It was important to ask, therefore, whether overexpressed Smad3/4 could augment TGF-β1-induced IgA expression in LPS-activated murine spleen cells. TGF-β1 treatment induces surface IgA expression by approximately twofold, and this is further increased when Smad3/4 is overexpressed (approximately fourfold) in whole spleen cells (Fig. 5A). Furthermore, under the same conditions, a similar pattern of surface IgA expression was observed using a purified B cell population (Fig. 5B).

To determine if these B cells could proceed to secretion of IgA, we measured total IgA and IgG1 secretion. IgA secretion is slightly increased by TGF-β1 and this is further augmented by overexpression of Smad3/4 in the culture of whole spleen cells (Table 2). In contrast, total IgG1 production was decreased by TGF-β1 and further diminished by overexpressed Smad3/4. Subsequently, we determined the effect of Smad3/4 on Ig secretion by fractionated spleen B cells. As shown in Table 2, the effect of TGF-β1 and Smad3/4 on IgA secretion was more striking than that by unfractionated whole spleen cells. Thus, overexpressed Smad3/4 in the presence of TGF-β1 increased IgA secretion by LPS-activated spleen B cells by four- to tenfold. In addition, This Smad3/4-mediated TGF-β1-stimulatory effect on IgA secretion was further augmented by IL-5. In contrast, TGF-β1 consistently decreased IgG1 secretion under any conditions, and overexpressed Smad3/4 resulted in little to marginal effect on IgG1 secretion.

These data suggest that the ability of Smad3 and 4 to mediate TGF-β1 induction of GLα transcripts results in an increase in IgA surface expression and secretion by mouse B cells. Furthermore, TGF-β1 inhibits GLγ1 transcripts and IgG1 secretion in these same cultures.

4.1 Animals

BALB/c mice were purchased from B&K Universal Co. (Fermont, CA) and maintained ad libitum on Purina Laboratory Rodent Chow 5001 (Ralston Purina Co., Richmond, IN) in an animal environmental control chamber (Myung-Jin Inst. Co., Seoul). Eight- to twelve-week-old mice were used in this study.

4.2 Cell lines and cell culture

Murine B cell lymphoma lines, CH12.LX.4933 (surface μ⁺δ⁺) and CH12.LX.4F10 (surface α⁺) were generously provided by Dr. Geoffrey Haughton (University of North Carolina, Chapel Hill, NC). These cells were cultured at 37°C in a humidified atmosphere containing 5% CO₂ in RPMI 1640 medium (Sigma) supplemented with 10% FBS, 50 μM 2-ME, 5 mM HEPES, penicillin (100 U/ml)/ streptomycin (100 μg/ml). I.29μ (subclone, 22D; sIgM⁺ B cell lines) cells were provided by Dr. Janet Stavnezer (University of Massachusetts Medical School, MA). I.29μ were cultured in 8% CO₂, and the medium was supplemented with 0.1 U/ml of purified human insulin (Novo Nordisk, Princeton, NJ), and 20% FBS.

Mouse spleen cell suspensions were prepared as described before 51. Spleens removed from mice were smashed on sterile metal gauze in 0.01 M PBS. Cell suspensions were briefly washed in PBS and treated with 0.83% ammonium chloride to lyse RBC. Cells were then washed with HBSS two times and suspended in complete medium. Whole spleen cells (1×10⁶ cells/ml) were cultured with addition of LPS (12.5 μg/ml, E. coli 0127:B8, Sigma) and TGF-β1 (1 ng/ml). Spleen B cells were purified by depletion of T cells, using rat mAb for Thy1.2 (HO13.4),Thy1 (Jij.10), CD4 (GK1.5), and CD8 (3.168) followed by addition of anti-rat κ-chain mAb (MAR 18.5) and guinea pig complement. Purified spleen B cells were cultured with addition of LPS (25 μg/ml) and TGF-β1 (0.2 ng/ml).

4.3 Expression plasmids

Mammalian expression vectors, Smad2 32, Smad3 27, Smad4 52 and Smad7 28, which were subcloned into N-terminal Flag tagged-pcDNA3 44, were generously provided by Dr. Masahiro Kawabata (Department of Biochemistry, The Cancer Institute, Tokyo, Japan). A reporter plasmid, pFL3 containing the luciferase gene driven by TGF-β-responsive element of the GLα promoter 12, was provided by Dr. Janet Stavnezer (University of Massachusetts Medical School, Worcester, MA).

4.4 Transfection and luciferase assays

A total of 1×10⁷ cells for CH12.LX.4933 or 5×10⁷ cells for I.29μ or 2×10⁷–3×10⁷ cells for normal spleen cells were suspended in 800 μl RPMI 1640 (serum and antibiotics free) and transferred to a 1.5-ml microtube. For luciferase assays, 30 μg of each expression vector and reporter along with 10 μg pCMV5β gal (Stratagene) were transfected to CH12.LX. 4933. The final volume of the mixture was adjusted to 800 μl in a cuvette (Gap: 0.4 cm). The cells were exposed to a single pulse at 950 μF and 300–400 Vusing a Gene Pulser II (Bio-Rad, Hercules, CA). After transfection, cells were rested at room temperature for 10 min and then diluted into culture medium (RPMI 1640) including 10% FBS, LPS and TGF-β1. Cells were incubated at 37°C in a CO₂ incubator. For the luciferase and β-gal assays, cells were harvested following 24 h of culture, and lysed in Triton X-100 buffer (0.1% Triton X-100, 1 M Tris-HCl, pH 8.0). Cell debris was removed by centrifugation at 12,000 rpm for 15 min, and then the extracts were stored at –70°C until used. Samples with an equal amount of proteins were mixed with luciferin substrate solution and level of luciferase activity was determined by a luminometer (Berthold Multi-Biolumat LB9505C, Laboratorium, Germany). The β-gal assay was also performed toassess the activity of pCMV5βgal 53. Values of luciferase activity were normalized by β-gal activity.

4.5 Immunoprecipitation and Western blot

CH12.LX.4933 cells were transfected with 50 μg pcDNA3-Flag-Smad3 or pcDNA3 plasmid. At 72 h post-transfection, cells were washed and solubilized in a buffer containing 50 mM Tris, 150 mM NaCl, 1% Triton X-100, 0.5% NP40, 1 mM Na₃VO₄ plus protease inhibitors. The cell lysates were pelleted by centrifugation and the supernatants were incubated with anti-Flag M2 antibodies (Sigma) for 2 h, followed by incubation with protein A-Sepharose beads (Pharmacia biotech, Piscataway, NJ) for 1 h at 4°C. The beads were washed twice with the solubilizing buffer. The immune complexes were then eluted by boiling for 5 min in SDS sample buffer (50 mM Tris-HCl, pH 6.8, 0.1% bromophenol blue, 10% glycerol, 2% SDS) containing 100 mM DTT and separated by SDS-8% polyacrylamidegel electrophoresis. Proteins were electrotransferred to nitrocellulose membrane and the membrane was incubated with rabbit anti-Smad3 antibody (Zymed, San Francisco, CA) for 1.5 h at room temperature. Subsequently, horseradish peroxidase-conjugated goat anti-rabbit antibody (Sigma) was added and incubated for 1.5 h at room temperature. The membrane was developed using 3 mg/ml chloronaphthol in 0.01 M PBS and 0.03 M H₂O₂.

4.6 RNA preparation and RT-PCR

Total cellular RNA were extracted from cultured cells using TRIzol (Gibco BRL, Grand Island, NY) according to manufacturer's instructions. In brief, cells were lysed in 1 ml of TRIzol solution. After adding 0.2 ml of chloroform and mixing completely, the mixture was incubated at room temperature for 3 min. After centrifugation, the aqueous phase was transferred to a new tube and precipitated by addition to an equal volume of isopropanol, followed by incubation at room temperature for 10 min. RNA was recovered by centrifugation at 4^oC for 10 min. The RNA pellet was dissolved in DEPC-treated H₂O and quantified by UV scanning.

Reverse transcription and PCR were performed as follows. Briefly, 1 μg RNA was reverse-transcribed in the presence of 2.5 μM oligo d(T)₁₆ as primers and 50 U Moloney murine leukemia virus reverse transcriptase in a buffer containing 10 mM Tris-HCl (pH 8.3), 50 mM MgCl₂, 20 U RNase inhibitor, and 1 mM of the four deoxyribonucleotide triphosphate (dNTP), in a total volume of 20 μl. The mixture was incubated at 37°C for 1 h for cDNA synthesis and further incubated at 95°C for 10 min for heat inactivation, and stored at 4°C until used. For cDNA amplification, 40 μl of PCR master mixed containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 2 mM MgCl₂, 200 μM dNTP, 1 U Taq DNA polymerase and 50 pmol each of "downstream" and "upstream" primers were added to each sample. The primers were synthesized by Bioneer Corp. (Seoul, Korea), i.e. GLα sense, CTACCATAGGGGAAGATAGCCT and antisense, TAATCGTGAATCAGGCAG (amplified product, 225bp) 54; GLγ1 sense, CAGCCTGGTGTCAACTAG and antisense, CTGTACATATGCAAGGCT (amplified product, 532 bp) 54; β-actin sense, CATGTTTGAGACCTTCAACACCCC and antisense, GCCATCTCCTGCTCGAAGTCTAG. All reagents except primers were purchased from Promega Corp. (Madison, WI). The number of PCR cycles performed to yield an optimal signal was established experimentallyas 38 cycles for GLα and γ1 transcripts and 30 cycles for β-actin. Hot start PCR was used to increase specificity of the amplification. Each cycle consisted of 45 s at 95°C for DNA denaturation, 45 s at 55°C for primer annealing, and 2 min at 72°C for primer extension. The PCR reaction for GLα transcripts and GLγ1 transcripts was performed in parallel with β-actin to normalize the cDNA concentrations within each set of samples. After the cycles, aliquots of PCR products were resolved by electrophoresis in a 2% agarose gel.

4.7 Flow cytometry analysis

Cultured cells were washed with HBSS and resuspended in DMEM, 5% FBS, 0.1% NaN₃ at a density of 1×10⁶ cells/ml. FITC-conjugated goat anti-mouse IgA (Becton Dickinson, San Jose, CA) was added to the cell suspension and placed at 4°C for 30 min. Cells were washed with HBSS three times and resuspended in PBS-1% formalin. Cytofluorometric analysis was carried out usinga FACScan (Becton Dickinson, Mountain View, CA).

4.8 Isotype-specific ELISA

Produced antibodies were detected using a modified ELISA 50. Affinity-purified anti-isotype-specific antibody was added at 1.2 μg/ml in 0.05 M bicarbonate buffer (pH 9.3) to 96-well U-bottom polyvinyl microplates (Falcon, Becton Dickinson & Co., Oxnard, CA). Plates were washed with PBS containing 0.05% Tween-20 followed by overnight incubation at 4°C, and blocked for 1 h with 1% gelatin solution. After washing, 50 μl of standard myeloma proteins and culture supernatants were added to each well and incubated for 1 h at 37°C. Horseradish-peroxidase conjugated anti-isotype-specific antibody (Southern Biotechnology, Birmingham, AL) were added to each well and incubated for 1 h. Plates were then washed and 0.2 mM 2,2′-azino-bis (3-ethylbenzthiazoline)-6-sulfonic acid (ABTS, Sigma) was added. After 15-min incubation, colorimetric reaction was measured at 405 nm with an automatic microtiter reader (450; Bio-Rad).