Volume 2024, Issue 1 8224242

Research Article

Open Access

Antibiotic Resistance and Virulence Factors in Clinical Isolates of Stenotrophomonas maltophilia from Hospitalized Patients in Tehran, Iran

Mahrokh Bahrami

Department of Microbiology , School of Medicine , Shahid Beheshti University of Medical Sciences , Tehran , Iran , sbmu.ac.ir

Search for more papers by this author

Narjess Bostanghadiri,

Narjess Bostanghadiri

orcid.org/0000-0003-4500-5764

Department of Microbiology , School of Medicine , Iran University of Medical Sciences , Tehran , Iran , iums.ac.ir

Search for more papers by this author

Mehdi Goudarzi,

Mehdi Goudarzi

orcid.org/0000-0001-6720-9341

Department of Microbiology , School of Medicine , Shahid Beheshti University of Medical Sciences , Tehran , Iran , sbmu.ac.ir

Search for more papers by this author

Niloufar Khodaei,

Niloufar Khodaei

orcid.org/0009-0002-6303-4446

Department of Microbiology , School of Medicine , Iran University of Medical Sciences , Tehran , Iran , iums.ac.ir

Search for more papers by this author

Ali Hashemi,

Corresponding Author

Ali Hashemi

[email protected]

orcid.org/0000-0002-7258-5541

Department of Microbiology , School of Medicine , Shahid Beheshti University of Medical Sciences , Tehran , Iran , sbmu.ac.ir

Search for more papers by this author

Mahrokh Bahrami,

Mahrokh Bahrami

Department of Microbiology , School of Medicine , Shahid Beheshti University of Medical Sciences , Tehran , Iran , sbmu.ac.ir

Search for more papers by this author

Narjess Bostanghadiri,

Narjess Bostanghadiri

orcid.org/0000-0003-4500-5764

Department of Microbiology , School of Medicine , Iran University of Medical Sciences , Tehran , Iran , iums.ac.ir

Search for more papers by this author

Mehdi Goudarzi,

Mehdi Goudarzi

orcid.org/0000-0001-6720-9341

Department of Microbiology , School of Medicine , Shahid Beheshti University of Medical Sciences , Tehran , Iran , sbmu.ac.ir

Search for more papers by this author

Niloufar Khodaei,

Niloufar Khodaei

orcid.org/0009-0002-6303-4446

Department of Microbiology , School of Medicine , Iran University of Medical Sciences , Tehran , Iran , iums.ac.ir

Search for more papers by this author

Ali Hashemi,

Corresponding Author

Ali Hashemi

[email protected]

orcid.org/0000-0002-7258-5541

Department of Microbiology , School of Medicine , Shahid Beheshti University of Medical Sciences , Tehran , Iran , sbmu.ac.ir

Search for more papers by this author

First published: 30 September 2024

https://doi.org/10.1155/2024/8224242

Academic Editor: Joseph Falkinham

Share a link

Email
Wechat
Bluesky

Abstract

Stenotrophomonas maltophilia causes challenging infections in immunocompromised patients, exhibiting increasing resistance to multiple antimicrobials and possessing various virulence genes, including emerging resistance to trimethoprim-sulfamethoxazole. A total of 80 clinical isolates of S. maltophilia were collected from multiple hospitals in Tehran, Iran. This study conducted an analysis of antibiotic susceptibility by disc diffusion method and E-test assay, resistance and virulence gene frequencies were examined by PCR-sequencing, and multilocus sequencing typing (MLST) was performed for strain typing. Across the tested isolates, we observed notably high resistance rates for imipenem 80 (100%), meropenem 78(97.5%), and ceftazidime 72 (90%), while trimethoprim-sulfamethoxazole (SXT) showed a lower resistance rate of 2 (2.5%). Minocycline and levofloxacin demonstrated the highest susceptibility rates, with 70 (87.5%) and 80 (100%), respectively. The prevalence of antibiotic resistance genes bla_L1, and bla_L2 was 71 (88.75%) and 76 (95%), respectively. Additionally, the PCR analysis revealed that the frequency of virulence genes (fliC, virB, papD, pilU, hlyIII, stmPr1, and stmPr2) was 78 (97.5%), 77 (96.25%), 58 (72.5%), 77 (96.2%), 76 (95%), 31 (38.75%), and 80 (100%), respectively. Resistance to SXT isolate belong to the sequence type (ST15) and exhibits allelic profiles of (10, 29, 21, 21, 32, 32, and 10). The data obtained from our investigation have indicated that SXT remains an efficacious antibiotic and also highlighted the importance of effective management, identification of resistant isolates, and typing methods to address the global prevalence of antibiotic resistance in S. maltophilia.

1. Introduction

Stenotrophomonas maltophilia is a common Gram-negative bacterium known for its resistance to antibiotics. It has the potential to act as an opportunistic pathogen, particularly in vulnerable populations such as individuals undergoing chemotherapy for hemato-oncologic diseases [1–3]. It is pathogenic in individuals with malignancy, immunodeficiency, chronic respiratory diseases, or those taking long-term antibiotics [4, 5]. The recent surge in infections among ICU patients and newborns includes hospital-acquired infections, bloodstream infections, pneumonia, skin/soft tissue infections, catheter-related infections, urinary tract infections, surgical site infections, and endophthalmitis [6, 7]. The prevalence of S. maltophilia has been increasing during the COVID-19 pandemic, along with other pathogens such as Acinetobacter baumannii and Mycobacterium tuberculosis [8–10].

To understand S. maltophilia’s pathogenicity, a thorough genetic investigation is crucial. Key genetic components include the FliC gene, which produces the flagellum. The flagellum in bacteria is not just for movement; it is also essential in causing infections. It helps the bacteria stick to and invade host cells, form biofilms, and even start immune responses in the infected host [11, 12]. Additionally, stmPr1 and stmPr2, the primary and secondary serine proteases, degrade immune cells and extracellular matrix proteins, causing human disease. StmPr1, notably, triggers harmful processes in human lung cells, potentially contributing significantly to how S. maltophilia causes illness. Although less is known about stmPr2, its connection to the bacterium’s secretion system suggests that it might also play a role in causing disease [13]. Other critical genes include hly, related to hemolysin, a protein that breaks down red blood cells, virB involved in Type IV secretion systems and about 86.6% of S. maltophilia strains carry it, linked to a system used for delivering molecules to host cells, the pilU gene, present in 96.6% of strains, contributes to twitching motility powered by type IV pili, and papD associated with colonization [14–16].

S. maltophilia has developed resistance to antibiotics, and it was previously sensitive to including fluoroquinolones, aminoglycosides, and β-lactams [17, 18]. This resistance is due to several factors, such as structural changes in antibiotics, efflux pumps, reduced membrane permeability, and beta-lactamase production [19, 20]. The bacterium has two inducible beta-lactamases, bla_L1 and bla_L2, classified as B and A in the Ambler classification, respectively [17]. bla_L1 (MBL) is responsible for resistance to beta-lactams other than monobactams, while bla_L2 is a cephalosporinase that is sensitive to clavulanic acid and resistant to cephalosporins, penicillins, and aztreonam [17, 21, 22]. bla_L1, an inherent chromosomal gene, and bla_L2, identified through comprehensive genome analysis, actively contribute to the bacterium’s natural resistance against β-lactams, including the vital carbapenems. This resistance mechanism undermines the effectiveness of these antibiotics, often considered a last line of defense against infections caused by multidrug-resistant bacteria [23, 24]. Trimethoprim-sulfamethoxazole (SXT) is often the first choice for treating S. maltophilia infections because it works well against this bacterium. MLST, a method used to explore genetic relationships in bacteria, helps researchers track how resistance genes, potentially including those resisting SXT, spread in S. maltophilia [25–27]. Further research and identification of alternative antibiotics are needed to address this issue.

S. maltophilia can be grouped into three Genovars based on 16SrRNA gene analysis, with two associated with environmental isolates and one with clinical and aquatic isolates [28]. The main DNA fingerprinting methods used for typing S. maltophilia strains are PCR-restriction fragment length polymorphism (PCR-RFLP), and amplified fragment length polymorphism (AFLP), with other available methods including pulsed-field gel electrophoresis (PFGE), gyrB RFLP, repetitive extragenic palindromic (rep)-PCR, DL automated rep-PCR, multiple-locus variable number of tandem repeats analysis (MLVA), and multilocus sequence typing (MLST) [29]. MLST is a high-resolution genetic technique that uses seven housekeeping genes as persistent markers for comparing strains over time and geography [30]. MLST is preferred over other typing methods for studying antibiotic resistance and virulence factors in clinical isolates of S. maltophilia due to its high resolution and reliability in understanding genetic diversity. It offers a comprehensive view of relationships between isolates, their resistance profiles, and virulence traits, making it valuable in epidemiological and clinical studies [29]. The antibiotics levofloxacin, minocycline, imipenem, meropenem, and SXT are chosen for studying S. maltophilia resistance due to their effectiveness in treating its infections. They help identify resistance patterns, guiding effective treatment strategies for this bacterium [31, 32].

The primary aim of the present investigation was to appraise the patterns of antimicrobial resistance and pathogenic factors’ genes among the clinical S. maltophilia strains isolated from several hospitals in Tehran, Iran. Furthermore, the research also scrutinized the genetic diversity of the isolates.

2. Methods

2.1. Ethical Considerations

The Ethics Committee of Shahid Beheshti University of Medical Sciences (IR.SBMU.MSP.REC.1398.806) provided ethical approval for this study. To ensure participant privacy, no personal data were gathered or included in the research, and all participants remained anonymous.

2.2. Bacterial Species Isolation and Identification Process

This was a retrospective study. A total of 80 nonduplicate clinical isolates of S. maltophilia were obtained randomly from several hospitals in Tehran, Iran, from January 2018 to January 2019. The laboratory employed standard biochemical methods to identify the isolates. To confirm the S. maltophilia isolates, 16S rRNA gene amplification and sequencing techniques were employed (as indicated in Table 1) [34]. The isolates were stored in the Luria–Bertani (LB) liquid medium (Merck company-Germany) supplemented with 20% glycerol and maintained at −70°C. Additionally, quality control strains, including Escherichia coli ATCC 25922 and Pseudomonas aeruginosa ATCC 27853, were included in the study.

Table 1. Oligonucleotide primers used in this study.

Gene	Primer sequences 5“-3”	Amplified fragment (bp)	Reference
Primers for amplification of resistance and virulence factor genes
16srRNA	F: AGTTCGCATCGTTTAGGG	762	[30]
16srRNA	R: ACGGCAGCACAGAAGAGC	762	[30]
bla_L1	F: ATCTACGGCTGATCCTGCTC	373	[24]
bla_L1	R: GGATAGCGTGCGTTGTACTG	373	[24]
bla_L2	F: CGATTCCTGCAGTTCAGT	905	[21]
bla_L2	R: CGGTTACCTCATCCGATC	905	[21]
stmPr1	F: TGAAAGCAAATGCGCCGTT	850	[16]
stmPr1	R: GTGATGGCGTCGGTGATGTC	850	[16]
stmPr2	F: GCCGATTCCGGCATTCACACC	1764	[13]
stmPr2	R: GGTCAGGCCCGAGAAGGTGCT	1764	[13]
virB	F: GCATCATGCAGAACGAGCTG	1075	[16]
virB	R: GACGGCTCGTACTTCTGCAC	1075
hlyIII	F: CGTCCATTGCTTCGATCCGTG	605
hlyIII	R: GACGAAGTGGCAGACGCTG	605
pilU	F: CGACCACCATCGATTTCACTTCG	778
pilU	R: GACAGGTCCATCAGCAGCTG	778
papD	F: CACGCGAGTGATCTATCCGG	579
papD	R: GTGATGAAGCGCACCTGGTC	579
fliC	F: CGATCTCCGAGCGCTTCG	296
fliC	R: GAACAGCTGGCTGGAGAACG	296

Primers used for MLST
atpD	F: ATGAGTCAGGGCAAGATCGTTC	854	[33]
atpD	R: TCCTGCAGGACGCCCATTTC	854
gapA	F: TGGCAATCAAGGTTGGTATCAAC	800
gapA	R: TTCGCTCTGTGCCTTCACTTC	800
gapA	F: AGGAGCTTGAGAAATGGCAA	975
gapA	R: GAGTAGCCCCACTCGTTGTC	975
guaA	F: AACGAAGAAAAGCGCTGGTA	700
guaA	R: ACGGATGGCGGTAGACCAT	700
mutM	F: AACTGCCCGAAGTCGAAAC	614
mutM	R: GAGGATCTCCTTCACCGCATC	614
nuoD	F: TTCGCAACTACACCATGAAC	514
nuoD	R: CAGCGCGACTCCTTGTACTT	514
ppsA	F: CAAGGCGATCCGCATGGTGTATTC	612
ppsA	R: CCTTCGTAGATGAA(A/g)CCGGT(A/G)TC	612
recA	F: ATGGACGAGAACAAGAAGCGC	783
recA	R: GGTGATGACCTGCTTGAACGG	783

atpD (H(+)-transporting two-sector ATPase)
gapA (NAD-dependent glyceraldehyde-3-phosphate dehydrogenase)
guaA (GMP synthase [glutamine-hydrolyzing])
mutM (DNA-formamidopyrimidine glycosylase)
nuoD (NADH dehydrogenase [ubiquinone])
ppsA (Pyruvate, water dikinase)
recA (RecA protein)

2.3. Antimicrobial Susceptibility Testing (AST)

The susceptibility of S. maltophilia isolates was assessed following the guidelines provided by the Clinical and Laboratory Standards Institute (CLSI) [35]. The Kirby–Bauer disc diffusion technique was employed to test the susceptibility to various antibiotics, including levofloxacin (5 μg), minocycline (30 μg), imipenem (10 μg), meropenem (10 μg), ceftazidime (30 μg), and sulfamethoxazole/trimethoprim (1.25/23.75 μg) (MAST Diagnostics, Merseyside, UK). The MIC-Test Strip (Liofilchem Italy) was utilized to measure the minimal inhibitory concentration (MIC) for two antibiotics, including SXT and ceftazidime. Muller–Hinton agar plates with disks or strips were incubated in ambient air at 35°C ± 2°C and read after 20 to 24 h of incubation. The bacteria’s sensitivity or resistance was assessed using the values found in the CLSI guidelines. Escherichia coli ATCC 25922 and Pseudomonas aeruginosa ATCC 27853 were used as controls.

2.4. Polymerase Chain Reaction Sequencing Technique (PCR)

Genomic DNA was extracted by the High Pure PCR Template kit (GeNet Bio Company, Daejeon, Korea; Cat. No, K-3000) as per the manufacturer’s guidelines and utilized for the detection of resistance genes (bla_L1 and bla_L2) and virulence genes (virB, fliC, stmPr1, stmPr2, pilU, hlyIII, and papD) through the Polymerase Chain Reaction (PCR) technique. PCR was performed in 25 μl reaction volumes using specific primers listed in Table 1. The PCR reaction mixture included 1 μl (20 ng) of DNA template, 1 × PCR buffer, 12.5 μl of 2 × Master Mix (SinaClon-Iran), 3 mmol/L MgCl2, 0.4 mmol/L dNTPs, 9.5 μl of sterile distilled water, 1 μl of 10 pmol of each primer, and 0.08 IU of Taq DNA polymerase. The negative control in all analyses consisted of all the components of the reaction mixture, excluding bacterial genomic DNA. In addition, we used S. maltophilia strain ng 49 and strain as 40 with accession numbers MF458984 and MF497329, which were submitted in a previous study as bla_L1 and bla_L2 positive controls, respectively [30].

The PCR conditions comprised an initial denaturation at 94°C for 5 min, followed by 36 cycles of denaturation at 94°C for 45 s, annealing at 56–62°C (depending on the gene-specific primers) for 45 s, and extension at 72°C for 45 s. A final extension step was performed at 72°C for 5 min. The resulting PCR products were then analyzed using agarose gel electrophoresis (1% gel), stained with DNA Safe, and visualized under UV light. For sequencing and verification, the PCR products were sent to Shahid Rajaee Hospital in Tehran, Iran. The obtained sequences were further analyzed using MEGA-4 and Chromas 1.45 software and confirmed through Blast on the NCBI website.

2.5. Multilocus Sequence Typing (MLST)

The MLST technique was implemented to analyze the molecular typing of S. maltophilia isolates which were resistant to SXT [36]. The entire putative coding sequences of the housekeeping genes were selected from the PubMLST website (https://pubmlst.org/organisms/stenotrophomonas-maltophilia/) (Table 1). A reaction volume of 25 μl was prepared for the Polymerase Chain Reaction (PCR) using specific primers. The components included 3 μl (20 ng) of the DNA template, 12.5 μl of 2 × Master Mix (SinaClon-Iran, CAT. No., PR901638), 1 × PCR buffer, 0.4 mmol/L deoxy-nucleotide triphosphates (dNTPs), 3 mmol/L MgCl2, 0.08 IU Taq DNA polymerase, 1 μl of 10 pmol of each primer, and 7.5 μl of sterile distilled water. The PCR products were analyzed on an agarose gel and were then subjected to sequencing by Rajaie Hospital, Tehran, Iran. The sequence was analyzed using the Chromas version 1.45 software. In addition, sequence alignment was conducted by the Nucleotide BLAST program.

The obtained sequences of each seven genes submitted to the PUBMLST.ORG website to determine the allele number and specific sequence type (ST) [33]. A combination of the allelic sequences of the seven genes yielded the allelic profile for each isolate.

2.6. Statistical Analysis

SPSS v.20.0 software (SPSS Inc. Chicago, IL, USA) and the chi-squared test were used for the statistical analyses. In this study, statistical significance was defined as a p value of less than 0.05.

3. Results

3.1. Patient Background and Bacterial Isolation

In the present cross-sectional study, 80 isolates of nonrepetitive S. maltophilia were gathered from hospitalized patients across various wards in four hospitals: Loghman-e Hakim Hospital (35 isolates), Children’s Medical Center (30 isolates), Shariati Hospital (8 isolates), and Rasoul Akram Hospital (7 isolates). The majority of the S. maltophilia isolates (85%) were obtained from the bloodstream infection, with 11.25% from tracheal tubes, and 3.75% from pharyngeal secretions. Of the 80 isolates, 47 (58.75%) were from males and 33 (41.25%) were from females (male:female ratio = 1.25). The age of the patients ranged in age from 6 months to 80 years.

3.2. Antibiotic-Susceptibility Testing

Based on the interpretive criteria established by CLSI, approximately 80(100%), 78(97.5%), and 72(90%) of the isolates were resistant to imipenem, meropenem, and ceftazidime. It was observed that 2 (2.5%) isolates exhibited resistance towards SXT. The greatest sensitivity was seen in levofloxacin, SXT, and minocycline at 80 (100%), 75 (93.75%), and 70 (87.5%), respectively. Table 2 displays the percentage of isolates demonstrating resistance, intermediate, or susceptibility to the antimicrobial agents and along with the MIC ranges, MIC50 and MIC90.

Table 2. The antimicrobial susceptibility profile exhibited by S. maltophilia isolates.

Antimicrobial agents	MIC (μg/ml)			Disc diffusion number (%)
Antimicrobial agents	Range	MIC₅₀	MIC₉₀	Susceptible	Intermediate	Resistant
Meropenem	—	—	—	2 (2.5%)	—	78 (97.5%)
Imipenem	—	—	—	—	—	80 (100%)
Minocycline	—	—	—	70 (87.5%)	10 (12.5%)	—
Ceftazidime	8_32	8	32	2 (2.5%)	6 (7.5%)	72 (90%)
Levofloxacin				80 (100%)	—	—
Trimethoprim-sulfamethoxazole	2.38–4.76	≤2.38	≤4.76	75 (93.75%)	3 (3.75%)	2 (2.5%)

PCR-based resistance genes revealed that from 78 isolates resistant to meropenem, 82% had bla_L1 and 90% had bla_L2. Among 80 isolates where resistance to imipenem 88.75% and 95% carrying bla_L1 and bla_L2, respectively (Figure 1).

Details are in the caption following the image — **Figure 1**
Open in figure viewer PowerPoint

Prevalence of antibiotic resistance genes (bla_L1 and bla_L2) among imipenem and meropenem resistance isolates (p ≤ 0.001).

3.3. Virulence Gene Detection

The results of the virulence gene detection showed that the positive rates of the seven virulence genes were 78/80 (97.5%) for fliC, 77/80 (96.25%) for virB, 58/80 (72.5%) for papD, 77/80 (96.2%) for pilU, 76/80 (95%) for hlyIII, 31/80 (38.75%) for stmPr1, and 80/80 (100%) for stmPr2. There were 31 isolates of S. maltophilia that carried all four of the genes (Table 3). The statistical results showed no significant (p > 0.05) association between the presence of virulence genes and antibiotic resistance.

Table 3. Prevalence of virulence genes among 80 S. maltophilia isolates.

Virulence genes, no. (%)
fliC	virB	papD	pilU	hlyIII	stmPr1	stmPr2
78 (97.5%)	77 (96.25%)	58 (72.5%)	77 (96.2%)	76 (95%)	31 (38.75%)	80 (100%)

FliC: flagellum
virB gene: (TSS4)
PapD: colonization
pilU: (pili type 4)
HlyIII: hemolysin
StmPr1: serine proteases
StmPr2: serine proteases

3.4. Multilocus Sequence Typing (MLST) Analysis

Two strains with resistance to SXT underwent molecular typing. As presented in Table 4, one of the strains belonged to ST15 based on MLST analysis and exhibited allelic profiles of (10, 29, 21, 21, 32, 32, and 10). The other strain’s identity remained undetermined.

Table 4. The number of alleles of and sequence type (ST) of TMP-SMX-resistant S. maltophilia in the present study.

	atpD	gapA	guaA	mutM	nuoD	ppsA	recA	ST
Strain 78	Allele 10	Allele 29	Allele 21	Allele 21	Allele 32	Allele 32	Allele 10	15

4. Discussion

S. maltophilia is a Gram-negative bacterium that has been identified as an opportunistic pathogen, particularly in patients with weakened or impaired immune systems. This organism has been linked to the development of various medical conditions such as meningitis, pneumonia, bacteremia, urinary tract infections, and respiratory issues in those suffering from cystic fibrosis [37]. The management of S. maltophilia poses significant challenges, owing to its inherent resistance to several antibiotics, and its ability to acquire novel resistance mechanisms via horizontal gene transfer and mutations [38].

In many countries, the rise of carbapenem resistance is alarming. Madrid, Spain, for instance, faces a critical situation with specific resistance rates of 99% for imipenem and 87.9% for meropenem. Moreover, in another country, all isolates demonstrated resistance to imipenem [39]. The ongoing investigation supports these findings, demonstrating significant carbapenem resistance with meropenem 78 (97.5%) and complete resistance with imipenem 80 (100%). Resistance towards carbapenems in S. maltophilia is attributed to a variety of mechanisms, which may include the expression of intrinsic β-lactamase. The present study has identified that a significant proportion of isolates (71 (88.75%) and 76 (95%) for bla_L1 and bla_L2 genes, respectively) harbor these genes. Notably, both genes were found in resistant to imipenem and meropenem samples, except for the higher amount of bla_L2 compared to bla_L1. In a study in China involving 118 S. maltophilia isolates, the positive rates for bla_L1 and bla_L2 genes were 75% (89/118) and 22% (26/118), respectively, and all 118 isolates exhibited resistance to carbapenems [40]. Additionally, an Iranian study reported that among 23 isolated S. maltophilia strains, 82.66% were beta-lactamase positive, and 60.86% were Metallo-beta-lactamase positive, with 39.13% of MBL-positive isolates also positive for the bla_L1 gene [41]. These collective findings strongly suggest an association between the bla_L1 and bla_L2 genes and carbapenem resistance, corroborating our study’s observations.

Our study’s outcomes highlight a susceptibility rate of S. maltophilia isolates to ceftazidime, measured at 2.5%. These findings align with prior research, displaying MIC50 and MIC90 values of 8 and 32 μg/ml, respectively [42]. Conversely, Jamali et al. and Ebrahim-Saraie reported a significantly higher susceptibility rate of 82%, 93.2% for ceftazidime, respectively [43, 44]. Moreover, variations in susceptibility rates for this drug were evident across regions: Latin America recorded rates of 93.3%, whereas the United States, Canada, and Turkey reported rates of 64.7%, 27%, and 67%, respectively [45]. Additionally, in a separate study conducted in China, the susceptibility to ceftazidime was lower at 20.0% [46], further emphasizing the variability in susceptibility observed across different geographical locations and research studies.

The recommended treatment for S. maltophilia involves SXT as the primary choice [47]. In our study, the MIC50 and MIC90 for this antibiotic were reported as ≤2.38 µg/ml and ≤4.76 µg/ml, respectively. Out of the 80 isolates tested, only 2 (2.5%) showed resistance, 3 (3.75%) were intermediate, and the majority, 75 (93.75%), were sensitive to SXT. In contrast, other studies have reported varying rates of resistance, ranging from 17.7% to 38.7% [21, 25, 48, 49]. In the recent meta-analysis, global resistance to this antibiotic was 14.6%, with the highest resistance rates reported in Asia (19.29%), Europe (10.52%), and the Americas (7.01%) [50, 51]. Our study observed a lower percentage of resistance to SXT compared to these reports. Insights from studies conducted by Jamali et al. and Madi et al. highlighted the sensitivity of S. maltophilia to SXT. Specifically, their findings showed MIC50 values of 0.5 μg/ml and ≥4 µg/ml and MIC90 values of 2 μg/ml and ≥32 µg/ml, respectively [52, 53]. Additionally, in our study, levofloxacin displayed complete sensitivity 80 (100%), while minocycline exhibited a high sensitivity rate of 70(87.5%). These findings are consistent with another study, reporting a 6.1% resistance rate for levofloxacin and complete sensitivity to minocycline [49]. Our research aligns with this by identifying minocycline as the most effective antibiotic. However, unlike the previous study, none of our isolates showed any resistance to levofloxacin, indicating a discrepancy in resistance percentages that might be attributed to differences in sample sizes. Another study by Madi et al. showcased a complete susceptibility of all isolated strains to levofloxacin [53]. Differences in S. maltophilia studies’ findings may be due to various factors, namely, geographical variations in antibiotic use and local isolates, methodological differences in testing, time-related shifts in resistance patterns, sample size, and strain variations influencing antibiotic susceptibility. This disparity highlights the complexity and potential influencing factors in determining antibiotic resistance patterns across studies.

To gain a comprehensive understanding of the virulence of S. maltophilia, the isolates were subjected to thorough characterization based on the occurrence of specific potential virulence factors. StmPr1 and stmPr2 are extracellular serine proteases in S. maltophilia, breaking down proteins outside the cell. They impact antibiotic resistance alongside other mechanisms, influencing the bacterium’s resistance profile [13, 44]. The frequency of stmpr1 and stmpr2 virulence genes was determined by Duan et al. to be 79.6% and 91.4%, respectively [54]. In contrast, among 80 isolates our study found the presence of the stmPr1 gene to be 31 (38.75%) and Stmpr2 to be 80 (100%). According to a singular study, stmPr1, as opposed to stmPr2, may be a pertinent virulence factor of S. maltophilia [55]. This discrepancy may be a result of the more diverse isolates used in the previous study. Insufficient knowledge exists regarding the pathogenic mechanisms employed by S. maltophilia. Therefore, further investigation is required in this realm. In our study, among isolated, most of them had other genes which are related to the virulence factor in S. maltophilia and fliC, virB, papD, pilU, and hlyIII were 78 (97.5%), 77 (96.25%), 58 (72.5%), 77 (96.2%), and 76 (95%), respectively. Zamboni et al. found that the frequencies of fliC, virB, papD, pilU, hlyIII, and stmPr1 virulence genes were 90%, 86.6%, 80%, 96.6%, 90%, and 50%, respectively [56]. These results are similar to those of our study. Saleh et al. reported the incidence of virulence genes, which comprised fliC, stmPr1, virB, pilU, hlyIII, and papD, among the isolates. The study revealed that 93%, 87%, 73%, 62%, 59%, and 57% of the isolates harbored these respective genes [57]. Except for fliC, there were discrepancies in the frequency of the other genes, which could explain the considerable difference in the number and type of isolates. These discrepancies highlight the need for further investigation into the pathogenic mechanisms employed by S. maltophilia. Understanding the prevalence and role of these virulence factors is crucial for developing effective treatment strategies against this pathogen.

The MLST method, based on the identification of 7 housekeeping genes of 500−450 bp in size, effectively compares strains across different times and geographical locations. This technique is a reliable indicator for distinguishing between intraspecies and interspecies S. maltophilia strains [58]. Distinct sequence types may carry varying sets of virulence genes, impacting the bacteria’s pathogenicity, antibiotic resistance, and overall behavior in a host or environment [59]. In this study, trimethoprim-sulfamethoxazole-resistant strain belonging to ST15 was identified using MLST analysis. The alleles for the 7 housekeeping genes atpD, gapA, guaA, mutM, nuoD, ppsA, and recA were 10-29-21-21-32-32-10, respectively, with ST15 matching the strain found in China, India, and southern Poland [54, 60–62]. A study conducted in the South of Poland that focused on typing isolates of nonfermenting Gram-negative bacteria in blood infections revealed that one of the isolates was ST15. Additionally, seven other isolates had new STs [60]. Similarly in 2019, a study conducted in India identified a single isolate as being of sequence type 15 (ST15) [62]. Zamboni et al. revealed that the clinical and environmental strains of S. maltophilia were divided into five ST groups: ST304, ST239, ST24, ST150, and ST290 [16]. Consistent with prior research, various sequence types were ascertained for S. maltophilia isolates, encompassing STs 5, 4, 26, 31, 8, 14, 29, 39, 77, 78, 92, 93, 94, 122, and 152 [63, 64]. The widespread identification of ST15 across different geographic regions implies its global prevalence, potentially influencing S. maltophilia’s global epidemiology, and it provides a point of comparison for new research. The presence of ST15 in trimethoprim-sulfamethoxazole-resistant strains emphasizes the association between this sequence type and antibiotic resistance, although more research would be needed to confirm this. Overall, our study adds to the expanding understanding of S. maltophilia’s genetic diversity and antibiotic resistance. This insight is vital for shaping treatment approaches and public health measures. Further research is needed to fully understand the implications of these findings and to continue monitoring the evolution and spread of S. maltophilia. Uncertainty about effective management strategies for S. maltophilia infections stems from the limited availability of treatment options, supported by both in vitro and clinical evidence. In addition, distinguishing between colonization and invasive infections caused by S. maltophilia can be a significant challenge. Based on promising in vitro activity and positive clinical outcomes, TMP-SMX is generally considered the preferred therapeutic option for the treatment of S. maltophilia infections.

5. Conclusion

Our study highlights the critical role of microbiology laboratories in the identification and understanding of antibiotic resistance and virulence factors in S. maltophilia. The high percentage of antibiotic resistance mechanisms among S. maltophilia strains isolated from hospitalized patients emphasizes the enhancement of laboratory expertise for accurate diagnosis and effective prevention of resistant pathogen transmission. The development of reliable assays for the detection of latent resistance is necessary, as is the importance of careful prescribing practices supported by antibiogram testing to ensure appropriate treatment strategies.

Our findings reveal a concerning rise in resistance to SXT, particularly worrisome given that S. maltophilia is already resistant to numerous antibiotics, leaving SXT as one of the few viable treatment options. Even minimal resistance levels pose challenges, as they limit therapeutic choices and complicate infection management. While current resistance reports remain low, the gradual increase warrants close monitoring and proactive intervention strategies to mitigate the potential escalation of resistance and preserve SXT’s efficacy. Additionally, the identification of multiple virulence genes contributing to S. maltophilia highlights the importance of addressing both antibiotic resistance and virulence factors in the control of this opportunistic pathogen. These insights offer a way for future interventions and surveillance strategies, underscoring the need for a comprehensive approach that includes effective laboratory expertise, development of reliable assays, cautious prescribing practices, improved infection control measures, and a focus on both antibiotic resistance and virulence factors. This approach is vital for the effective management of S. maltophilia, which leads to enhance patient outcomes and reduce global mortality rates.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Acknowledgments

This study was financially supported by the Research Department of the School of Medicine, Shahid Beheshti University of Medical Sciences (grant no. 19223).

Open Research

Data Availability

The data used to support the findings of this study are included in the article.

References

1 García G., Girón J. A., Yañez J. A., and Cedillo M. L., Stenotrophomonas maltophilia and its ability to form biofilms, Microbiology Research. (2022) 14, no. 1, 1–20, https://doi.org/10.3390/microbiolres14010001.
10.3390/microbiolres14010001
Web of Science® Google Scholar
2 Dimopoulos G., Garnacho-Montero J., Paramythiotou E., Gutierrez-Pizarraya A., Gogos C., Adriansen-Pérez M., Diakaki C., Matthaiou D. K., Poulakou G., and Akinosoglou K., Upraising stenotrophomonas maltophilia in critically ill patients: a new enemy?, Diagnostics. (2023) 13, no. 6, https://doi.org/10.3390/diagnostics13061106.
10.3390/diagnostics13061106
PubMed Google Scholar
3 Brooke J. S., Stenotrophomonas maltophilia: an emerging global opportunistic pathogen, Clinical Microbiology Reviews. (2012) 25, no. 1, 2–41, https://doi.org/10.1128/cmr.00019-11, 2-s2.0-84855650410.
10.1128/CMR.00019-11
CAS PubMed Web of Science® Google Scholar
4 Falagas M. E., Kastoris A. C., Vouloumanou E. K., Rafailidis P. I., Kapaskelis A. M., and Dimopoulos G., Attributable mortality of Stenotrophomonas maltophilia infections: a systematic review of the literature, Future Microbiology. (2009) 4, no. 9, 1103–1109, https://doi.org/10.2217/fmb.09.84, 2-s2.0-73649146224.
10.2217/fmb.09.84
PubMed Web of Science® Google Scholar
5 Apisarnthanarak A., Mayfield J. L., Garison T., McLendon P. M., DiPersio J. F., Fraser V. J., and Polish L. B., Risk factors for Stenotrophomonas maltophilia bacteremia in oncology patients: a case–control study, Infection Control and Hospital Epidemiology. (2003) 24, no. 4, 269–274, https://doi.org/10.1086/502197, 2-s2.0-0038071628.
10.1086/502197
PubMed Web of Science® Google Scholar
6 Fihman V., Le Monnier A., Corvec S., Jaureguy F., Tankovic J., Jacquier H., Carbonnelle E., Bille E., Illiaquer M., Cattoir V., and Zahar J. R., Stenotrophomonas maltophilia–the most worrisome threat among unusual non-fermentative gram-negative bacilli from hospitalized patients: a prospective multicenter study, Journal of Infection. (2012) 64, no. 4, 391–398, https://doi.org/10.1016/j.jinf.2012.01.001, 2-s2.0-84858443801.
10.1016/j.jinf.2012.01.001
PubMed Google Scholar
7 Gales A. C., Jones R., Forward K., Linares J., Sader H. S., and Verhoef J., Emerging importance of multidrug-resistant Acinetobacter species and Stenotrophomonas maltophilia as pathogens in seriously ill patients: geographic patterns, epidemiological features, and trends in the SENTRY Antimicrobial Surveillance Program (1997–1999), Clinical Infectious Diseases. (2001) 32, no. s2, S104–S113, https://doi.org/10.1086/320183.
10.1086/320183
CAS PubMed Web of Science® Google Scholar
8 Huang R.-C., Chiu C.-H., Chiang T.-T., Tsai C.-C., Wang Y.-C., Chang F.-Y., Yang Y.-S., and Wang C.-H., Hospital-acquired infections in patients hospitalized with COVID-19: first report from Taiwan, Journal of the Chinese Medical Association. (2022) 85, no. 9, 922–927, https://doi.org/10.1097/jcma.0000000000000764.
10.1097/JCMA.0000000000000764
CAS PubMed Google Scholar
9 Bostanghadiri N., Jazi F. M., Razavi S., Fattorini L., and Darban-Sarokhalil D., Mycobacterium tuberculosis and SARS-CoV-2 coinfections: a review, Frontiers in Microbiology. (2021) 12, https://doi.org/10.3389/fmicb.2021.747827.
10.3389/fmicb.2021.747827
PubMed Google Scholar
10 Bostanghadiri N., Ziaeefar P., Mofrad M. G., Yousefzadeh P., Hashemi A., and Darban-Sarokhalil D., COVID-19: an overview of SARS-CoV-2 variants—the current vaccines and drug development, BioMed Research International. (2023) 2023, 6, 1879554, https://doi.org/10.1155/2023/1879554.
10.1155/2023/1879554
PubMed Google Scholar
11 Flores-Treviño S., Bocanegra-Ibarias P., Camacho-Ortiz A., Morfín-Otero R., Salazar-Sesatty H. A., and Garza-González E., Stenotrophomonas maltophilia biofilm: its role in infectious diseases, Expert Review of Anti-infective Therapy. (2019) 17, no. 11, 877–893, https://doi.org/10.1080/14787210.2019.1685875.
10.1080/14787210.2019.1685875
CAS PubMed Web of Science® Google Scholar
12 Zgair A. K. and Chhibber S., Adhesion of Stenotrophomonas maltophilia to mouse tracheal mucus is mediated through flagella, Journal of Medical Microbiology. (2011) 60, no. 7, 1032–1037, https://doi.org/10.1099/jmm.0.026377-0, 2-s2.0-79959508218.
10.1099/jmm.0.026377-0
PubMed Web of Science® Google Scholar
13 DuMont A. L., Karaba S. M., and Cianciotto N. P., Type II secretion-dependent degradative and cytotoxic activities mediated by Stenotrophomonas maltophilia serine proteases StmPr1 and StmPr2, Infection and Immunity. (2015) 83, no. 10, 3825–3837, https://doi.org/10.1128/iai.00672-15, 2-s2.0-84944472776.
10.1128/IAI.00672-15
CAS PubMed Google Scholar
14 Adamek M., Linke B., and Schwartz T., Virulence genes in clinical and environmental Stenotrophomas maltophilia isolates: a genome sequencing and gene expression approach, Microbial Pathogenesis. (2014) 68, 20–30, https://doi.org/10.1016/j.micpath.2014.02.001, 2-s2.0-84895134254.
10.1016/j.micpath.2014.02.001
Google Scholar
15 Nas M. Y., Gabell J., and Cianciotto N. P., Effectors of the Stenotrophomonas maltophilia type IV secretion system mediate killing of clinical isolates of Pseudomonas aeruginosa, Molecular Biology. (2021) 12, no. 3, https://doi.org/10.1128/mbio.01502-21.
10.1128/mbio.01502-21
Google Scholar
16 Cruz-Córdova A., Mancilla-Rojano J., Luna-Pineda V. M., Escalona-Venegas G., Cázares-Domínguez V., Ormsby C., Franco-Hernández I., Zavala-Vega S., Hernández M. A., Medina-Pelcastre M., Parra-Ortega I., la Rosa-Zamboni D. D., Ochoa S. A., and Xicohtencatl-Cortes J., Molecular epidemiology, antibiotic resistance, and virulence traits of Stenotrophomonas maltophilia strains associated with an outbreak in a Mexican tertiary care hospital, Frontiers in Cellular and Infection Microbiology. (2020) 10, https://doi.org/10.3389/fcimb.2020.00050.
10.3389/fcimb.2020.00050
PubMed Google Scholar
17 Gil-Gil T., Martínez J. L., and Blanco P., Mechanisms of antimicrobial resistance in Stenotrophomonas maltophilia: a review of current knowledge, Expert Review of Anti-Infective Therapy. (2020) 18, no. 4, 335–347, https://doi.org/10.1080/14787210.2020.1730178.
10.1080/14787210.2020.1730178
CAS PubMed Web of Science® Google Scholar
18 Brooke J. S., New Strategies against Stenotrophomonas Maltophilia: A Serious Worldwide Intrinsically Drug-Resistant Opportunistic Pathogen, 2014, Taylor and Francis, Florida, NY, USA.
Google Scholar
19 Sánchez M. B., Antibiotic resistance in the opportunistic pathogen Stenotrophomonas maltophilia, Frontiers in Microbiology. (2015) 6, https://doi.org/10.3389/fmicb.2015.00658, 2-s2.0-84937138142.
10.3389/fmicb.2015.00658
Google Scholar
20 Chang Y.-T., Lin C.-Y., Chen Y.-H., and Hsueh P.-R., Update on infections caused by Stenotrophomonas maltophilia with particular attention to resistance mechanisms and therapeutic options, Frontiers in Microbiology. (2015) 6, https://doi.org/10.3389/fmicb.2015.00893, 2-s2.0-84949667186.
10.3389/fmicb.2015.00893
Web of Science® Google Scholar
21 Flores-Treviño S., Gutierrez-Ferman J. L., Morfín-Otero R., Rodríguez-Noriega E., Estrada-Rivadeneyra D., Rivas-Morales C., Llaca-Díaz J. M., Camacho-Ortíz A., Mendoza-Olazaran S., and Garza-Gonzalez E., Stenotrophomonas maltophilia in Mexico: antimicrobial resistance, biofilm formation and clonal diversity, Journal of Medical Microbiology. (2014) 63, no. 11, 1524–1530, https://doi.org/10.1099/jmm.0.074385-0, 2-s2.0-84908350140.
10.1099/jmm.0.074385-0
PubMed Web of Science® Google Scholar
22 Mojica M. F., Ouellette C. P., Leber A., Becknell M. B., Ardura M. I., Perez F., Shimamura M., Bonomo R. A., Aitken S. L., and Shelburne S. A., Successful treatment of bloodstream infection due to metallo-β-lactamase-producing stenotrophomonas maltophilia in a renal transplant patient, Antimicrobial Agents and Chemotherapy. (2016) 60, no. 9, 5130–5134, https://doi.org/10.1128/aac.00264-16, 2-s2.0-84983593578.
10.1128/AAC.00264-16
CAS PubMed Web of Science® Google Scholar
23 Li X., McLaughlin R. W., and Grover N. A., Characterization of antibiotic-resistant stenotrophomonas isolates from painted turtles living in the wild, Current Microbiology. (2023) 80, no. 3, https://doi.org/10.1007/s00284-023-03193-4.
10.1007/s00284-023-03193-4
Google Scholar
24 Yang Z., Liu W., Cui Q., Niu W., Li H., Zhao X., Wei X., Wang X., Huang S., Dong D., Lu S., Bai C., Li Y., Huang L., and Yuan J., Prevalence and detection of Stenotrophomonas maltophilia carrying metallo-β-lactamase bla L1 in Beijing, China, Frontiers in Microbiology. (2014) 5, https://doi.org/10.3389/fmicb.2014.00692, 2-s2.0-84920696977.
10.3389/fmicb.2014.00692
Google Scholar
25 Hu L.-F., Chen G.-S., Kong Q.-X., Gao L.-P., Chen X., Ye Y., and Li J.-B., Increase in the prevalence of resistance determinants to trimethoprim/sulfamethoxazole in clinical Stenotrophomonas maltophilia isolates in China, PLoS One. (2016) 11, no. 6, https://doi.org/10.1371/journal.pone.0157693, 2-s2.0-84976344565.
10.1371/journal.pone.0157693
Google Scholar
26 Poorabbas B., Mardaneh J., Rezaei Z., Kalani M., Pouladfar G., Alami M. H., Soltani J., Shamsi-Zadeh A., Abdoli-Oskooi S., Saffar M. J., and Alborzi A., Nosocomial Infections: multicenter surveillance of antimicrobial resistance profile of Staphylococcus aureus and Gram negative rods isolated from blood and other sterile body fluids in Iran, Iranian Journal of Microbiology. (2015) 7, no. 3, 127–135.
PubMed Google Scholar
27 Banar M., Sattari-Maraji A., Bayatinejad G., Ebrahimi E., Jabalameli L., Beigverdi R., Emaneini M., and Jabalameli F., Global prevalence and antibiotic resistance in clinical isolates of Stenotrophomonas maltophilia: a systematic review and meta-analysis, Frontiers in Medicine. (2023) 10.
10.3389/fmed.2023.1163439
PubMed Google Scholar
28 Minkwitz A. and Berg G., Comparison of antifungal activities and 16S ribosomal DNA sequences of clinical and environmental isolates of Stenotrophomonas maltophilia, Journal of Clinical Microbiology. (2001) 39, no. 1, 139–145, https://doi.org/10.1128/jcm.39.1.139-145.2001, 2-s2.0-0035164612.
10.1128/JCM.39.1.139-145.2001
CAS PubMed Web of Science® Google Scholar
29 Gherardi G., Creti R., Pompilio A., and Di Bonaventura G., An overview of various typing methods for clinical epidemiology of the emerging pathogen Stenotrophomonas maltophilia, Diagnostic Microbiology and Infectious Disease. (2015) 81, no. 3, 219–226, https://doi.org/10.1016/j.diagmicrobio.2014.11.005, 2-s2.0-84925052608.
10.1016/j.diagmicrobio.2014.11.005
PubMed Web of Science® Google Scholar
30 Bostanghadiri N., Ghalavand Z., Fallah F., Yadegar A., Ardebili A., Tarashi S., Pournajaf A., Mardaneh J., Shams S., and Hashemi A., Characterization of phenotypic and genotypic diversity of Stenotrophomonas maltophilia strains isolated from selected hospitals in Iran, Frontiers in Microbiology. (2019) 10, https://doi.org/10.3389/fmicb.2019.01191, 2-s2.0-85068751583.
10.3389/fmicb.2019.01191
PubMed Web of Science® Google Scholar
31 Shi X., Wang H., Wang X., Jing H., Duan R., Qin S., Lv D., Fan Y., Huang Z., Stirling K., Zhang L., and Wang J., Molecular characterization and antibiotic resistance of Acinetobacter baumannii in cerebrospinal fluid and blood, PLoS One. (2021) 16, no. 2, https://doi.org/10.1371/journal.pone.0247418.
10.1371/journal.pone.0247418
Google Scholar
32 Hu S., Lv Y., Xu H., Zheng B., and Xiao Y., Biofilm formation and antibiotic sensitivity in Elizabethkingia anophelis, Frontiers in Cellular and Infection Microbiology. (2022) 12, https://doi.org/10.3389/fcimb.2022.953780.
10.3389/fcimb.2022.953780
Web of Science® Google Scholar
33 Adamek M., Overhage J., Bathe S., Winter J., Fischer R., and Schwartz T., Genotyping of environmental and clinical Stenotrophomonas maltophilia isolates and their pathogenic potential, PLoS One. (2011) 6, no. 11, https://doi.org/10.1371/journal.pone.0027615, 2-s2.0-84858763910.
10.1371/journal.pone.0027615
PubMed Google Scholar
34 Al-Anazi K. A. and Al-Jasser A. M., Infections caused by Stenotrophomonas maltophilia in recipients of hematopoietic stem cell transplantation, Frontiers in Oncology. (2014) 4, https://doi.org/10.3389/fonc.2014.00232, 2-s2.0-84906261103.
10.3389/fonc.2014.00232
Google Scholar
35 Lubbers B., Diaz-Campos D., and Schwarz S., Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals 5th edn CLSI supplement VET01S, 2020, https://clsi.org/media/2325/vet01ed5_sample.pdf.
Google Scholar
36 Kaiser S., Biehler K., and Jonas D., A Stenotrophomonas maltophilia multilocus sequence typing scheme for inferring population structure, Journal of Bacteriology. (2009) 191, no. 9, 2934–2943, https://doi.org/10.1128/jb.00892-08, 2-s2.0-65549131178.
10.1128/JB.00892-08
CAS PubMed Web of Science® Google Scholar
37 Samonis G., Karageorgopoulos D. E., Maraki S., Levis P., Dimopoulou D., Spernovasilis N. A., Kofteridis D. P., and Falagas M. E., Stenotrophomonas maltophilia infections in a general hospital: patient characteristics, antimicrobial susceptibility, and treatment outcome, PLoS One. (2012) 7, no. 5, https://doi.org/10.1371/journal.pone.0037375, 2-s2.0-84862062038.
10.1371/journal.pone.0037375
PubMed Google Scholar
38 Wu P.-S., Lu C.-Y., Chang L.-Y., Hsueh P.-R., Lee P.-I., Chen J.-M., Lee C.-Y., Chan P.-C., Chang P.-Y., Yang T.-T., and Huang L. M., Stenotrophomonas maltophilia bacteremia in pediatric patients-a 10-year analysis, Journal of Microbiology, Immunology, and Infection. (2006) 39, no. 2, 144–149.
Google Scholar
39 Liu B. and Tong S., An investigation of Stenotrophomonas maltophilia-positive culture caused by fiberoptic bronchoscope contamination, Bio Medical Centeral Infectious Diseases. (2019) 19, 1072–1076, https://doi.org/10.1186/s12879-019-4670-3.
10.1186/s12879-019-4670-3
PubMed Google Scholar
40 Han L., Zhang R.-M., Jia L., Bai S.-C., Liu X.-W., Wei R., Cui C.-Y., Sun R.-Y., Wang M.-G., Cai D.-T., Liao X. P., Liu Y. H., and Sun J., Diversity of L1/L2 genes and molecular epidemiology of high-level carbapenem resistance Stenotrophomonas maltophilia isolates from animal production environment in China, Infection, Genetics and Evolution. (2020) 86, https://doi.org/10.1016/j.meegid.2020.104531.
10.1016/j.meegid.2020.104531
PubMed Google Scholar
41 Amoli R. I. and Nowroozi J., Investigation of metallo-beta-lactamase genes (L1 and NDM1) in isolates of stenotrophomonas maltophilia, Acta Medica Iranica. (2022) 429–435.
Google Scholar
42 Nicodemo A. and Paez J. I. G., Antimicrobial therapy for Stenotrophomonas maltophilia infections, European Journal of Clinical Microbiology & Infectious Diseases. (2007) 26, no. 4, 229–237, https://doi.org/10.1007/s10096-007-0279-3, 2-s2.0-34147163353.
10.1007/s10096-007-0279-3
CAS PubMed Web of Science® Google Scholar
43 Ebrahim-Saraie H. S., Heidari H., Soltani B., Mardaneh J., and Motamedifar M., Prevalence of antibiotic resistance and integrons, sul and Smqnr genes in clinical isolates of Stenotrophomonas maltophilia from a tertiary care hospital in Southwest Iran, Iranian journal of basic medical sciences. (2019) 22, no. 8, 872–877, https://doi.org/10.22038/ijbms.2019.31291.7540, 2-s2.0-85071760921.
10.22038/ijbms.2019.31291.7540
PubMed Web of Science® Google Scholar
44 Fluit A. C., Bayjanov J. R., Aguilar M. D., Cantón R., Elborn S., Tunney M. M., Scharringa J., Benaissa-Trouw B. J., and Ekkelenkamp M. B., Taxonomic position, antibiotic resistance and virulence factor production by Stenotrophomonas isolates from patients with cystic fibrosis and other chronic respiratory infections, Bio Medical Centeral Microbiology. (2022) 22, no. 1, https://doi.org/10.1186/s12866-022-02466-5.
10.1186/s12866-022-02466-5
Google Scholar
45 Pfaller M., Jones R., Doern G., Sader H., Kugler K., Beach M., and Group S. P., Survey of blood stream infections attributable to gram-positive cocci: frequency of occurrence and antimicrobial susceptibility of isolates collected in 1997 in the United States, Canada, and Latin America from the SENTRY Antimicrobial Surveillance Program, Diagnostic Microbiology and Infectious Disease. (1999) 33, no. 4, 283–297, https://doi.org/10.1016/s0732-8893(98)00149-7, 2-s2.0-0033027926.
10.1016/S0732-8893(98)00149-7
CAS PubMed Web of Science® Google Scholar
46 Wei C., Ni W., Cai X., Zhao J., and Cui J., Evaluation of trimethoprim/sulfamethoxazole (SXT), minocycline, tigecycline, moxifloxacin, and ceftazidime alone and in combinations for SXT-susceptible and SXT-resistant Stenotrophomonas maltophilia by in vitro time-kill experiments, PLoS One. (2016) 11, no. 3, https://doi.org/10.1371/journal.pone.0152132, 2-s2.0-84962070962.
10.1371/journal.pone.0152132
Google Scholar
47 Kullar R., Wenzler E., Alexander J., and Goldstein E. J., Overcoming Stenotrophomonas maltophilia resistance for a more rational therapeutic approach, Open Forum Infectious Diseases, 2022, Oxford University Press US, Oxford, UK.
10.1093/ofid/ofac095
Google Scholar
48 Valdezate S., Vindel A., Loza E., Baquero F., and Cantón R., Antimicrobial susceptibilities of unique Stenotrophomonas maltophilia clinical strains, Antimicrobial Agents and Chemotherapy. (2001) 45, no. 5, 1581–1584, https://doi.org/10.1128/aac.45.5.1581-1584.2001, 2-s2.0-0035041053.
10.1128/AAC.45.5.1581-1584.2001
CAS PubMed Web of Science® Google Scholar
49 Kanamori H., Yano H., Tanouchi A., Kakuta R., Endo S., Ichimura S., Ogawa M., Shimojima M., Inomata S., Ozawa D., Aoyagi T., Weber D., and Kaku M., Prevalence of Smqnr and plasmid-mediated quinolone resistance determinants in clinical isolates of Stenotrophomonas maltophilia from Japan: novel variants of Smqnr, New microbes and new infections. (2015) 7, 8–14, https://doi.org/10.1016/j.nmni.2015.04.009, 2-s2.0-84930934159.
10.1016/j.nmni.2015.04.009
CAS PubMed Google Scholar
50 Bostanghadiri N., Sholeh M., Navidifar T., Dadgar-Zankbar L., Elahi Z., van Belkum A., and Darban-Sarokhalil D., Global mapping of antibiotic resistance rates among clinical isolates of Stenotrophomonas maltophilia: a systematic review and meta-analysis, Annals of Clinical Microbiology and Antimicrobials. (2024) 23, no. 1, https://doi.org/10.1186/s12941-024-00685-4.
10.1186/s12941-024-00685-4
PubMed Google Scholar
51 Dadashi M., Hajikhani B., Nazarinejad N., Noorisepehr N., Yazdani S., Hashemi A., Hashemizadeh Z., Goudarzi M., and Fatemeh S., Global prevalence and distribution of antibiotic resistance among clinical isolates of Stenotrophomonas maltophilia: a systematic review and meta-analysis, Journal of Global Antimicrobial Resistance. (2023) 34, 253–267, https://doi.org/10.1016/j.jgar.2023.02.018.
10.1016/j.jgar.2023.02.018
CAS PubMed Google Scholar
52 Jamali F., Boroumand M. A., Yazdani F., Anvari M. S., Pourgholi L., Mahfouzi S., and Khak M., Minimal inhibitory concentration of ceftazidime and Co-trimoxazole for Stenotrophomonas maltophilia using E-test, Journal of Global Infectious Diseases. (2011) 3, no. 3, 254–258, https://doi.org/10.4103/0974-777x.83531, 2-s2.0-80051878791.
10.4103/0974-777X.83531
CAS PubMed Google Scholar
53 Madi H., Lukić J., Vasiljević Z., Biočanin M., Kojić M., Jovčić B., and Lozo J., Genotypic and phenotypic characterization of Stenotrophomonas maltophilia strains from a pediatric tertiary care hospital in Serbia, PLoS One. (2016) 11, no. 10, https://doi.org/10.1371/journal.pone.0165660, 2-s2.0-84993982969.
10.1371/journal.pone.0165660
Google Scholar
54 Duan Z., Qin J., Liu Y., Li C., and Ying C., Molecular epidemiology and risk factors of Stenotrophomonas maltophilia infections in a Chinese teaching hospital, Bio Medical Centeral Microbiology. (2020) 20, 294–299, https://doi.org/10.1186/s12866-020-01985-3.
10.1186/s12866-020-01985-3
CAS Google Scholar
55 Nicoletti M., Iacobino A., Prosseda G., Fiscarelli E., Zarrilli R., De Carolis E., Petrucca A., Nencioni L., Colonna B., and Casalino M., Stenotrophomonas maltophilia strains from cystic fibrosis patients: genomic variability and molecular characterization of some virulence determinants, International Journal of Medical Microbiology. (2011) 301, no. 1, 34–43, https://doi.org/10.1016/j.ijmm.2010.07.003, 2-s2.0-78649633270.
10.1016/j.ijmm.2010.07.003
CAS PubMed Web of Science® Google Scholar
56 Chung H.-S., Kim K., Hong S. S., Hong S. G., Lee K., and Chong Y., The sul1 gene in Stenotrophomonas maltophilia with high-level resistance to trimethoprim/sulfamethoxazole, Annals of laboratory medicine. (2015) 35, no. 2, 246–249, https://doi.org/10.3343/alm.2015.35.2.246, 2-s2.0-84923683982.
10.3343/alm.2015.35.2.246
CAS PubMed Web of Science® Google Scholar
57 Saleh R. O., Hussen B. M., Mubarak S. M., and Mostafavi S. K. S., High diversity of virulent and multidrug-resistant Stenotrophomonas maltophilia in Iraq, Gene Reports. (2021) 23, https://doi.org/10.1016/j.genrep.2021.101124.
10.1016/j.genrep.2021.101124
Google Scholar
58 Pérez-Losada M., Cabezas P., Castro-Nallar E., and Crandall K. A., Pathogen typing in the genomics era: MLST and the future of molecular epidemiology, Infection, Genetics and Evolution. (2013) 16, 38–53, https://doi.org/10.1016/j.meegid.2013.01.009, 2-s2.0-84875255868.
10.1016/j.meegid.2013.01.009
CAS PubMed Web of Science® Google Scholar
59 de Nies L., Lopes S., Busi S. B., Galata V., Heintz-Buschart A., Laczny C. C., May P., and Wilmes P., PathoFact: a pipeline for the prediction of virulence factors and antimicrobial resistance genes in metagenomic data, Microbiome. (2021) 9, 49–14, https://doi.org/10.1186/s40168-020-00993-9.
10.1186/s40168-020-00993-9
CAS PubMed Google Scholar
60 Chmielarczyk A., Pobiega M., Romaniszyn D., and Wójkowska-Mach J., Multi-locus sequence typing (MLST) of non-fermentative Gram-negative bacilli isolated from bloodstream infections in southern Poland, Folia Microbiologica. (2018) 63, no. 2, 191–196, https://doi.org/10.1007/s12223-017-0550-7, 2-s2.0-85029768044.
10.1007/s12223-017-0550-7
CAS PubMed Google Scholar
61 Devanga Ragupathi N. K. and Veeraraghavan B., Data on whole genome shotgun sequencing report of clinical S. maltophilia strains from India, Data in Brief. (2018) 21, 263–268, https://doi.org/10.1016/j.dib.2018.10.005, 2-s2.0-85054862022.
10.1016/j.dib.2018.10.005
PubMed Google Scholar
62 Perumalla S. K., Ragupathi N. K. D., Neeravi A. R., Anandan S., Michael J. S., and Veeraraghavan B., Molecular characterisation of stenotrophomonas maltophilia in nosocomial infections: challenges and way forward, Journal of Clinical and Diagnostic Research. (2019) 13, no. 1, https://doi.org/10.7860/jcdr/2019/39753.12434.
10.7860/jcdr/2019/39753.12434
Google Scholar
63 Zhao Y., Niu W., Sun Y., Hao H., Yu D., Xu G., Shang X., Tang X., Lu S., Yue J., and Li Y., Identification and characterization of a serious multidrug resistant Stenotrophomonas maltophilia strain in China, Bio Medical Research International. (2015) 2015, 10, 580240, https://doi.org/10.1155/2015/580240, 2-s2.0-84947648701.
10.1155/2015/580240
PubMed Google Scholar
64 Corlouer C., Lamy B., Desroches M., Ramos-Vivas J., Mehiri-Zghal E., Lemenand O., Delarbre J., Decousser J., Aberanne S., Belmonte O., Blondiaux N., Cattoir V., Dekeyser S., Delarbre J., Desroches M., Jaouen A., Laurens E., Lemenand O., Mehiri-Zghal E., Parisi Duchene E., Pangon B., Plassart C., Picot S., Vachee A., and Ramos-Vivas J., Stenotrophomonas maltophilia healthcare-associated infections: identification of two main pathogenic genetic backgrounds, Journal of Hospital Infection. (2017) 96, no. 2, 183–188, https://doi.org/10.1016/j.jhin.2017.02.003, 2-s2.0-85019238832.
10.1016/j.jhin.2017.02.003
CAS PubMed Google Scholar

All articles

Antibiotic Resistance and Virulence Factors in Clinical Isolates of Stenotrophomonas maltophilia from Hospitalized Patients in Tehran, Iran

Abstract

1. Introduction