Volume 2021, Issue 1 2609935
Research Article
Open Access

Intraspecific DNA Barcoding and Variation Analysis for Citri Reticulatae Pericarpium of Citrus reticulata “Chachi”

Mengshi Liu

Mengshi Liu

Key Laboratory of Molecular Target & Clinical Pharmacology and the State Key Laboratory of Respiratory Disease & The Fifth Affiliated Hospital, School of Pharmaceutical Sciences, Guangzhou Medical University, Guangzhou 511436, China gzhmc.edu.cn

Search for more papers by this author
Kanghui Wang

Kanghui Wang

Key Laboratory of Molecular Target & Clinical Pharmacology and the State Key Laboratory of Respiratory Disease & The Fifth Affiliated Hospital, School of Pharmaceutical Sciences, Guangzhou Medical University, Guangzhou 511436, China gzhmc.edu.cn

Search for more papers by this author
Baizhong Chen

Baizhong Chen

Guangdong Xinbaotang Biological Technology Co., Ltd, Guangdong, Jiangmen 529000, China

Search for more papers by this author
Yi Cai

Yi Cai

Key Laboratory of Molecular Target & Clinical Pharmacology and the State Key Laboratory of Respiratory Disease & The Fifth Affiliated Hospital, School of Pharmaceutical Sciences, Guangzhou Medical University, Guangzhou 511436, China gzhmc.edu.cn

Search for more papers by this author
Chuwen Li

Chuwen Li

Key Laboratory of Molecular Target & Clinical Pharmacology and the State Key Laboratory of Respiratory Disease & The Fifth Affiliated Hospital, School of Pharmaceutical Sciences, Guangzhou Medical University, Guangzhou 511436, China gzhmc.edu.cn

Search for more papers by this author
Wanling Yang

Wanling Yang

Key Laboratory of Molecular Target & Clinical Pharmacology and the State Key Laboratory of Respiratory Disease & The Fifth Affiliated Hospital, School of Pharmaceutical Sciences, Guangzhou Medical University, Guangzhou 511436, China gzhmc.edu.cn

Search for more papers by this author
Minyan Wei

Corresponding Author

Minyan Wei

Key Laboratory of Molecular Target & Clinical Pharmacology and the State Key Laboratory of Respiratory Disease & The Fifth Affiliated Hospital, School of Pharmaceutical Sciences, Guangzhou Medical University, Guangzhou 511436, China gzhmc.edu.cn

Search for more papers by this author
Guodong Zheng

Corresponding Author

Guodong Zheng

Key Laboratory of Molecular Target & Clinical Pharmacology and the State Key Laboratory of Respiratory Disease & The Fifth Affiliated Hospital, School of Pharmaceutical Sciences, Guangzhou Medical University, Guangzhou 511436, China gzhmc.edu.cn

Search for more papers by this author
First published: 09 December 2021
Citations: 5
Academic Editor: Francesca Mancianti

Abstract

Citri Reticulatae Pericarpium, the desiccative mature peel of Citrus reticulata Blanco or its cultivated varieties, is a national geographical indicated product that has the concomitant function of both medicine and foodstuff. The primary source of Citri Reticulatae Pericarpium is Citrus reticulata “Chachi,” called “Guang chenpi,” while it differs in variety, propagation, grafting rootstock, and tree age, and the hereditary stability of its biological information between intraspecific plants is worthy of our attention. Homologous analysis result of 4 DNA barcodings in the ribosome or the chloroplast showed that the homology of them (ITS2, rbcl, matK, and psbA-trnH) of 22 samples was 100.00%, 99.97%, 99.99%, and 99.81%, respectively, which indicated that 4 DNA barcodes maintained a high degree of genetic stability in Citrus reticulata “Chachi.” Also, ITS2 was considered to identify Citrus reticulata “Chachi” from other varieties because it presented not only low variability within a certain taxon but also a high level of interspecies variability. Simultaneously, variant site detection of Citrus reticulata “Chachi” was analyzed by comparing with the reference Citrus reticulata genome, and 2652697 SNP sites and 533906 InDel sites were detected from whole-genome resequencing data of 22 samples, providing the data resources and theoretical foundation for the future study about the relevant molecular makers of “Guang chenpi.”

1. Introduction

Citri Reticulatae Pericarpium (CRP), a traditional Chinese medicine that has the concomitant function of both medicine and foodstuff, is the desiccated mature peel of Citrus reticulata Blanco or its cultivated varieties. Thereinto, Citrus reticulata “Chachi,” the main cultivated variety of Citrus reticulata Blanco, is the primary source of genuine Chinese medicinal materials “Guang Chenpi” [1]. As a national product of geographical indication, “Guang Chenpi” is widely used in clinical applications and by-product processing because of its better quality in CRP [24], and most studies have shown that its pharmacological activities include antiasthmatic effects, antineuroinflammatory activity, antioxidant ability, and anticancer activity [57].

Up to now, a large number of studies have focused on the chemical compounds in CRP by morphological identification, microscopic identification, TLC, UV, HPLC, GC-MS, and LC-MS [810], while these method do not distinguish well among different cultivars or among different varieties of Citrus reticulata “Chachi.” As an emerging method of identification of food and natural medicinal materials, molecular marker (DNA barcoding, SNP, and InDel) has considerable untapped potential in the quality control and origin identification of food and medicinal materials. DNA barcoding, an important tool for ecological research, has been widely used in species identification [1114]. A number of studies have shown that plant DNA core barcodes are used internationally in the fields of species discovery, taxonomy, flora, and ecology [1517]. Nevertheless, molecular marker about different cultivars of CRP or different varieties of Citrus reticulata “Chachi” was less studied. Previous studies have reported that the ITS2 region was selected for discrimination of the four CRP cultivars; however, this study did not take the intraspecific variation of Citrus reticulata “Chachi” into consideration [18]. Between different plants of Citrus reticulata “Chachi,” they showed some difference in the tree age and the variety including big-leaf species small-leaf species. Besides, propagations of Citrus reticulata “Chachi” include layerage on its maternal plant or graftage on different rootstocks such as Citrus limonia Osbeck, Citrus reticulata Blanco, and Poncirus trifoliata (L.) Raf.

Herein, 4 DNA barcodings including ITS2, rbcl, matK, and psbA-trnH were chosen for biological evolutionary information analysis about Citrus reticulata “Chachi” of different propagation methods, different tree ages, different varieties, and different rootstocks. Among them, ITS2 is a segment of DNA in the ribosome [19], and rbcl, matK, and psbA-trnH are DNA fragments in the chloroplast.

Except for a study on genetic stability of 4 barcodes, genetic diversity analysis of Citrus reticulata “Chachi” was carried out thought whole-genome resequencing technology with DNBSEQ-T7, compared with the reference published genomic data of Citrus reticulata from the NCBI (GenBank accession number ASM325862v1) [20], further excavating single-nucleotide polymorphism (SNP) sites and insertion-deletion (InDel) sites from whole-genome resequencing data of 22 Citrus reticulata “Chachi” samples.

The objective of this work was to research the hereditary stability of 4 DNA barcodings (ITS2, rbcl, matK, and psbA-trnH) in different Citrus reticulata “Chachi” plants, which can provide screening indicator of DNA barcoding to distinguish Citrus reticulata “Chachi” and other varieties of CRP. Also, variant type detection based on whole-genome resequencing data provides more potential molecular markers to distinguish Citrus reticulata “Chachi” between intraspecific plants or other cultivars, laying a foundation for the further development of “Guang chenpi.”

2. Materials and Methods

2.1. Biological Materials

Twenty-two batches of biological materials were collected from the Germplasm Source and Seedling Breeding Center of “Guang chenpi” (Table 1). 22 Citrus reticulata “Chachi” samples were different in variety, plant propagation, rootstock, and tree age.

Table 1. Information of Citrus reticulata “Chachi” samples.
No. Sample source Plant propagation Variety Rootstock Tree age (years)
A1 Tianma Village, Huicheng Town, Xinhui District, Jiangmen City, Guangdong Province Graftage Big-leaf Citrus limonia Osbeck 11
A2 Dadong Village, Huicheng Town, Xinhui District, Jiangmen City, Guangdong Province Graftage Big-leaf Citrus limonia Osbeck 6
A3 Tianma Village, Huicheng Town, Xinhui District, Jiangmen City, Guangdong Province Graftage Big-leaf Citrus limonia Osbeck 8
A4 Tianma Village, Huicheng Town, Xinhui District, Jiangmen City, Guangdong Province Graftage Big-leaf Citrus limonia Osbeck 8
A5 Dongjia Village, Huicheng Town, Xinhui District, Jiangmen City, Guangdong Province Layerage Big-leaf 10
A6 Qunsheng Village, Huicheng Town, Xinhui District, Jiangmen City, Guangdong Province Layerage Big-leaf 10
A7 Qibao Village, Huicheng Town, Xinhui District, Jiangmen City, Guangdong Province Graftage Big-leaf Citrus limonia Osbeck 11
A8 Shenglu Village, Sanjiang Town, Xinhui District, Jiangmen City, Guangdong Province Graftage Small-leaf Citrus limonia Osbeck 6
A9 Guangtian Village, Sanjiang Town, Xinhui District, Jiangmen City, Guangdong Province Graftage Wild species Citrus reticulata Blanco 5
A10 Shenlu Village, Sanjiang Town, Xinhui District, Jiangmen City, Guangdong Province Graftage Big-leaf Citrus limonia Osbeck 5
A11 Shenlu Village, Sanjiang Town, Xinhui District, Jiangmen City, Guangdong Province Layerage Big-leaf 5
A12 Xinsheng Village, Siqian Town, Xinhui District, Jiangmen City, Guangdong Province Graftage Big-leaf Citrus limonia Osbeck 25
A13 Shanyi Village, Siqian Town, Xinhui District, Jiangmen City, Guangdong Province Graftage Small-leaf Citrus limonia Osbeck 10
A14 Shanyi Village, Siqian Town, Xinhui District, Jiangmen City, Guangdong Province Graftage Small-leaf Citrus limonia Osbeck 10
A15 Shanyi Village, Siqian Town, Xinhui District, Jiangmen City, Guangdong Province Graftage Big-leaf Poncirus trifoliata (L.) Raf. 8
A16 Yaqian Village, Shuangshui Town, Xinhui District, Jiangmen City, Guangdong Province Graftage Big-leaf Citrus limonia Osbeck 8
A17 Shalu Village, Shuangshui Town, Xinhui District, Jiangmen City, Guangdong Province Graftage Big-leaf Citrus limonia Osbeck 5
A18 Guangdong Province seedling breeding farm Graftage Big-leaf Poncirus trifoliata (L.) Raf. 10
A19 Guangdong Province seedling breeding farm Graftage Big-leaf Citrus limonia Osbeck 6
A20 Wenlong Village, Daze Town, Xinhui District, Jiangmen City, Guangdong Province Graftage Big-leaf Citrus limonia Osbeck 10
A21 Yaxi Village, Yamen Town, Xinhui District, Jiangmen City, Guangdong Province Graftage Big-leaf Citrus limonia Osbeck 13
A22 Changsha Village, Gujing Town, Xinhui District, Jiangmen City, Guangdong Province Graftage Big-leaf Citrus limonia Osbeck 10

2.2. DNA Extraction

Genomic DNA was extracted using the plant DNA extraction kit (TSP101-200) of Tsingke. The quality of the extracted genomic DNA was checked by 1% agarose gel electrophoresis with DL2000 DNA marker, and the concentration of them was carried out through the NanoDrop 1000 (Thermo Fisher Scientific, Waltham Massachusetts, US).

2.3. PCR and Sequencing of DNA Barcodings

Genomic DNA was diluted to 15 ng·μl−1 and then was amplified by performing polymerase chain reaction (PCR) using 4 pair of universal primers of DNA barcodings listed in Table 2 [18]. PCR was performed under the following conditions: initial denaturation at 98°C for 2 min, followed by 30 cycles with 98°C denaturation for 10 s, annealing at the melting temperatures (TM) listed in Table 2 for 10 s, and extension at 72°C for 10 s. The final extension step was performed for 5 min at 72°C. Next, an aliquot of the amplification product was resolved on 1% agarose gel electrophoresis documented with a gel documentation system and further analyzed by sequencing.

Table 2. Primer sequence and PCR system of DNA barcodings.
Barcoding Direction Primer sequence (5′⟶3′) PCR system TM (°C)
ITS2 F ATGCGATACTTGGTGTGAAT
  1. 98°C 2 min;
  2. 98°C 10 s, TM °C 10 s, 72°C 10 s;
  3. 72°C 5 min
58
R GACGCTTCTCCAGACTACAAT
rbcl F ATGTCACCACAAACAGAAAC 58
R TCGCATGTACCTGCAGTAGC
matK F AGAGGTATTTGCTGCTGTGGTG 58
R GGAAAGAGTAAAGCAAGAACGTGT
psbA-trnH F AGGTATCTGGTTCACTGCTTTAGGT 59
R GCCTTGATCCACTTGGCTACAT
  • TM, The melting temperature of DNA.

2.4. DNA Library Construction and Illumina Sequencing

Genomic DNA will be randomly interrupted, the end will be repaired, “A” will be added, and the unique connector of DNBSEQ-T7 sequencer will be added. Then, DNA libraries will be constructed by PCR enrichment. Finally, the DNA library was denatured, cycled, and digested to obtain single-stranded circular DNA. Single-stranded circular DNA was amplified by rolling circle amplification (RCA), further producing DNA nanoball (DNB). Illumina sequencing was performed on DNBSEQ-T7 sequencer after the DNA libraries were qualified.

2.5. Whole-Genome Resequencing Data Quality and Filtering

To exclude bias from low-quality reads that arise from the process of base-calling or adapter contamination, the quality of the raw data obtained by whole-genome resequencing was evaluated until the value of Q30 was over than 85%. The clean reads were used for subsequent bioinformatics analysis. For further analysis, we downloaded previously published genomic data of Citrus reticulata from the NCBI (GenBank accession number ASM325862v1). We mapped high-quality data per individual to the reference Citrus reticulata genome using Burrows–Wheeler Aligner (BWA) software [21], then the sequencing read depth and genomic coverage of each sample were counted, and the variation was detected.

2.6. SNP and InDel Calling

SNPs and InDels can be called by mapping the unitigs against a reference genome. The main calling procedures are as follows: (1) for the results of BWA comparison, Mark Duplicate tool of Picard software is used to remove the duplication and shield the influence of PCR-duplication; (2) the Genome Analysis Toolkit (GATK) software [22] is used to perform InDels realignment, with local realignment of the sites near the alignment result with insertion-miss alignment and correction of alignment errors due to insertion-miss alignment; (3) GATK software was used for base recalibration to calibrate the base masses; (4) variant calling of SNPs and InDels was performed by GATK software; and (5) SNPs and InDels with any of the following features were filtered: two SNPs within 5 bp; SNPs within 5 bp near InDel; and two InDels within 10 bp [23].

3. Results and Discussion

3.1. Quality and Concentration of the Extracted DNA

In this work, Genomic DNA was extracted from tender leaves of 22 Citrus reticulata “Chachi” samples by using the plant DNA extraction kit, and OD value (A260/280) and DNA concentration are shown in Table 3. The results showed that the concentration of DNA could be used in subsequent experiments.

Table 3. Quality and concentration of the extracted DNA.
Sample no. OD value (A260/280) DNA concentration (ng/μl) Total DNA (μg)
A1 1.792 178 5.34
A2 1.763 151 4.53
A3 1.671 104 3.12
A4 1.749 240 7.20
A5 1.790 110 3.30
A6 1.115 16 0.47
A7 1.826 153 4.59
A8 1.761 104 3.12
A9 1.707 134 4.02
A10 1.788 186 5.58
A11 1.826 150 4.50
A12 1.882 11 0.32
A13 1.785 125 3.75
A14 1.805 179 5.37
A15 1.816 133 3.99
A16 1.812 166 4.98
A17 1.817 149 4.47
A18 1.656 81 2.42
A19 1.811 112 3.36
A20 1.818 144 4.32
A21 1.740 236 7.08
A22 1.650 120 3.60

3.2. Sequence Features and Homologous Analysis of DNA Barcodings

According to the agarose gel electrophoresis result of PCR amplification products (Figure 1), ITS2, rbcl, matK, and psbA-trnH produced amplification bands of approximately 750 bp, 750 bp, 1000 bp, and 500 bp, respectively. The electrophoresis bands of each sample were uniform, bright, and nonspecific heterozygous, indicating that the success rate of sequence amplification was 100%, which could be further analyzed by sequencing.

Details are in the caption following the image
Agarose gel electrophoresis of ITS2, rbcl, matK, and psbA-trnH.

Four barcodes (ITS2, rbcl, matK, and psbA-trnH) were analyzed by DNAMAN software for the length and base composition of each sequence fragment and further identified by BLAST in Genebank. The success rates of PCR amplification and sequencing of 3 DNA barcodings (ITS2, rbcl, and matK) of 22 samples were 100%. However, due to the large number of fragments missing in the sequencing of two samples (A16 and A21) of the psbA-trnH barcode, 20 psbA-trnH sequences were actually obtained in the experiment. PCR success rate, barcoding length, GC content, variable site, and BLAST rate of 4 DNA barcodings are listed in Table 4. The aligned partial sequences had lengths of 232 bp, 680∼682 bp, 1059 bp, and 537∼538 bp for ITS2, rbcl, matK, and psbA-trnH, respectively. Among them, the ITS2 barcode had the advantages of shorter sequence length and higher GC content (71.60%), followed by the psbA-trnH barcode having shorter sequence length.

Table 4. Sequence features of 4 DNA barcodings.
Barcoding PCR success rate (%) Barcoding length (bp) G + C content (%) Variable site BLAST rate (%)
ITS2 100 232 71.60 0 100.00
rbcl 100 680∼682 44.80 0 99.79
matK 100 1059 36.00 2 100.00
psbA-trnH 100 537∼538 32.46 1 99.91

Moreover, homologous analysis of 4 DNA barcodings about 22 batches of Citrus reticulata “Chachi” samples was carried out by DNAMAN software. The homologous analysis result showed that the homology of ITS2 of 22 samples was 100.00%, which indicated that ITS2 maintained a high degree of genetic stability in Citrus reticulata “Chachi” of different propagation methods, different tree ages, different varieties, and different rootstocks. Also, the homology of rbcl, matK, and psbA-trnH of 22 samples was 99.97%, 99.99%, and 99.81%, respectively.

In addition, among the 22 batches of CRP samples, 2 SNP sites were identified in the matK barcode and 1 Indel site was identified in the psbA-trnH barcode. The results showed that there were still some variations within the species of Citrus reticulata “Chachi,” making us realize molecular breeding of Citrus reticulata “Chachi” and the distinction of Citrus reticulata “Chachi” and related species need more valuable molecular markers. Therefore, whole-genome resequencing was also performed on 22 Citrus reticulata “Chachi” samples of different propagation methods, different tree ages, different varieties, and different rootstocks, which provided more scientific basis for molecular breeding.

Previous studies have reported that the ITS2 region was selected for discrimination of the four CRP cultivars including Citrus reticulata “Chachi,” Citrus reticulata “Dahongpao,” Citrus reticulata “Unshiu,” and Citrus reticulata “Tangerina,” while ITS, trnH-psbA, and rbcL could not distinguish these CRP samples [18]. Different from the existing studies, this work focuses on the hereditary stability of 4 barcodes including ITS2, rbcl, matK, and psbA-trnH in Citrus reticulata “Chachi” with different varieties, propagation methods, grafting rootstocks, and tree ages. Because of DNA degradation in moderately or highly processed products with time, PCR amplification of standard-length (around 650 bp) barcodings is a huge challenge [24]. Combined with existing research and the result in this work, ITS2 was considered to be a useful DNA barcoding to distinguish Citrus reticulata “Chachi” from other varieties, which presented not only low variability within a certain taxa but also a high level of interspecies variability. Also, this work indicated that matK was not considered because of its long length and variable sites within taxa, while rbcl and psbA-trnH had the potential to distinguish Citrus reticulata “Chachi” from other varieties. Actually, combining DNA barcodes in the ribosome and in the chloroplast makes it more convincing in species identification of plants [25, 26].

3.3. Quality Analysis of Whole-Genome Resequencing Data

A total of 22 Citrus reticulata “Chachi” sample genomes were sequenced, which generated 158 Gb raw data. Base coverage depth distribution curve and coverage distribution curve indicated that the coverage depth of the bases on the genome was evenly distributed. The statistical results of insert fragment distribution with a single peak show that insert fragment distribution fits the normal distribution and the construction of DNA libraries was reliable. The chromosome coverage depth map showed that the genome was evenly covered, indicating good randomness of sequencing.

Summary of clean sequencing data results about 22 Citrus reticulata “Chachi” samples is given in Table 5. The size of reference genome Citrus reticulata is 344.27 Mb (assembly level: scaffold). In this work, the average coverage depth was 16X, and the value of Q30 reached 88.94%. The average mapped ratio and genome coverage of all the samples were 98.97% and 93.55%, respectively. The average GC content of Citrus reticulata “Chachi” was 38.68% in line with reference genome Citrus reticulata.

Table 5. Summary of sequencing data results about Citrus reticulata “Chachi.”
No. Clean reads Clean bases Depth (X) Q20 (%) Q30 (%) G + C content (%) Read mapping (%) Genome mapping (%)
A1 49667300 7450095000 17 96.64 89.37 39.04 99.06 94.65
A2 45743350 6861502500 16 95.80 87.28 38.13 98.54 92.53
A3 47316474 7097471100 17 96.33 88.37 37.91 98.98 93.78
A4 41918262 6287739300 15 96.35 88.30 38.14 98.83 93.42
A5 44889792 6733468800 16 96.25 88.36 38.03 98.65 93.06
A6 32910626 4936593900 11 95.86 87.12 38.51 98.86 93.17
A7 45716786 6857517900 16 96.07 88.12 39.22 99.18 94.68
A8 80297744 112044661600 29 96.35 89.09 38.45 99.29 93.83
A9 49858294 7478744100 15 96.71 89.57 40.23 98.81 93.39
A10 43580158 6537023700 15 96.22 88.29 39.44 99.05 94.45
A11 46206262 6930939300 16 96.72 89.52 38.76 98.85 93.56
A12 42274388 6341158200 15 96.74 91.56 38.15 99.02 88.15
A13 53238294 7985744100 18 96.36 88.47 38.62 99.03 93.94
A14 42326498 6348974700 15 96.40 88.89 39.60 99.24 94.72
A15 47956602 7193490300 17 96.52 88.85 38.43 99.04 94.23
A16 47127502 7069125300 16 96.30 88.36 38.03 98.70 92.89
A17 45382574 6807386100 16 96.37 88.52 39.02 99.17 94.85
A18 53972916 8095937400 20 96.33 88.78 37.67 99.15 94.28
A19 48034834 7205225100 17 95.99 87.54 38.21 99.05 93.35
A20 43896212 6584431800 15 96.55 88.99 38.44 98.84 93.40
A21 45485090 6822763500 15 96.42 88.64 39.89 99.10 94.31
A22 43174144 6476121600 14 96.74 89.42 38.98 98.96 93.62

3.4. SNP and InDel Calling of Citrus reticulata “Chachi”

In this study, the variant site detection of Citrus reticulata “Chachi” for the national geographical indicated product CRP was firstly analyzed by SNP and InDel calling from whole-genome resequencing data (Table 6). Except for the high genetic stability of 4 barcodes (ITS2, rbcl, matK, and psbA-trnH), 22 Citrus reticulata “Chachi” samples showed its genetic diversity between different propagation methods, different tree ages, different varieties, and different rootstocks as well.

Table 6. SNPs and InDels of Citrus reticulata “Chachi.”
Variant type Category Number Category/variant type (%) Total
SNP Transition 1741507 65.65 2652697
Transversion 902182 34.01
Transition/transversion 9008 0.34
  
InDel Insertion 275380 51.58 533906
Deletion 241768 45.28
Insertion/deletion 16758 3.14

A total of 2652697 SNP sites were excavated between 22 Citrus reticulata “Chachi” samples, among which 1741507 SNP sites were transition (Ti), 902182 SNP sites were transversion (Tv), and 9008 SNP sites were transition or transversion. These SNP sites were with a Ti/Tv ratio of 1.93, which is in line with general rules of base mutation in natural organisms [27]. In the course of evolution about Citrus reticulata “Chachi,” transition happens much more frequently than transversion, which means that evolution of Citrus reticulata “Chachi” tends to accept the substitution between purines and purines or the substitution between pyrimidines and purines, the substitution between purines and pyrimidines causes bad things to happen, and that substitution has mostly been eliminated by evolution.

In addition, InDel sites, as codominant molecular markers, are widely distributed in the genome with high density, which are suitable for genome-wide molecular marker exploration. A total of 533906 InDel sites were detected between 22 Citrus reticulata “Chachi” samples, among which 275380 InDel sites were insertion, 241768 InDel sites were deletion, and 9008 InDel sites were insertion or deletion. Unlike SNP sites, insertions and deletions of InDel sites are equally likely to occur.

4. Conclusions

Overall, our work indicated that 4 DNA barcodes (ITS2, rbcl, matK, and psbA-trnH) maintained a high degree of genetic stability in Citrus reticulata “Chachi” of different propagation methods, different tree ages, different varieties, and different rootstocks. Because ITS2 presented not only low variability within a certain taxa but also a high level of interspecies variability, it was considered to be an useful DNA barcoding to identify Citrus reticulata “Chachi” from other varieties. Moreover, 2652697 SNP sites and 533906 InDel sites were detected from whole-genome resequencing data of 22 Citrus reticulata “Chachi” samples, fully reflecting the genetic diversity of Citrus reticulata “Chachi” with different varieties or propagation methods. To excavate more useful molecular markers for distinguishing Citrus reticulata “Chachi” between intraspecific plants or other cultivars, DNA barcoding analysis and variant type detection of the Citrus reticulata “Chachi” were studied for the first time in this investigation, which laid a special foundation for the biological information analysis of Citrus reticulata “Chachi” for the national geographical indicated product Citri Reticulatae Pericarpium.

Conflicts of Interest

The authors declare no conflicts of interest.

Authors’ Contributions

Mengshi Liu and Kanghui Wang conceptualized the study, performed visualization, conducted investigation, and wrote the original draft of the manuscript. Baizhong Chen, Yi Cai, Chuwen Li, and Wanling Yang formulated the methodology, were responsible for software, and curated data. Minyan Wei and Guodong Zheng formulated the methodology, were responsible for software, curated data, performed validation, supervised the work, and reviewed and edited the manuscript. All authors agreed to be accountable for all aspects of work ensuring integrity and accuracy. Mengshi Liu and Kanghui Wang contributed equally to this work.

Acknowledgments

This work was primarily supported by the National Key R&D Program of China (Nos. 2017YFC1701103 and 2017YFC1701105), Technology Plan of Zhuhai in 2020 (No. ZH22036207200009PWC), Cultivation Plan for High-Level University Academic Backbone of Guangzhou Medical University in 2017 (No. gydf [2017] 210), and High-level University Construction Fund of Guangdong Province (06-410-2107235).

    Data Availability

    The data used to support the findings of this study are included within the article.

      The full text of this article hosted at iucr.org is unavailable due to technical difficulties.