Aryl Hydrocarbon Receptor (AhR) Modulates Cockroach Allergen-Induced Immune Responses through Active TGFβ1 Release

2.1. Assessment of AhR in Human Airway

Paraffin-embedded human airway sections (5 μm) from asthmatic (n = 4) and healthy individuals (n = 4) were used for immunofluorescence analysis. These human airway sections were provided by Dr. Allen (Johns Hopkins Asthma & Allergen Center). While it is not clear about the allergic status for those asthmatic subjects, all healthy individuals were nonallergic individuals. The human airway sections from three nonallergic heavy smokers also included controlling for AhR expression. In brief, nonspecific binding was blocked using 10% blocking serum in PBS for 1 hour. Sections were subsequently incubated with anti-human polyclonal antibody against Aryl hydrocarbon receptor (ab84833, 1 : 20, Abcam) and fibroblast marker antibody ER-TR7 (sc-73355, 1 : 50, Santa Cruz Biotechnology) overnight at 4°C. Normal rabbit IgG (Sigma-Aldrich) and rat IgG were used as a negative control. Sections were then incubated with Alexa Fluor 594-labeled goat anti-rabbit and FITC-labeled rabbit anti-rat secondary antibodies IgG at 1/100 dilutor for 2 hrs at RT. Nuclei were counterstained with 4′,6-diamidino-2-phenylin-dole, dihydrochloride (DAPI) (Sigma-Aldrich). Sections were subsequently dehydrated, mounted, and observed under the fluorescent microscope. The slides were evaluated using micrographs taken by a fluorescent microscope (Olympus BX-5). Imaging software (iVision; Biovision) was used to analyze areas of positive staining.

2.2. Flow Cytometry

WI-38 cells were fixed with BD Cytofix/Cytoperm solution for 30 min and then incubated with specific first antibody or isotype control for 30 min at 4°C in the dark. Then the cells were washed and incubated with fluorescent-conjugated second antibody. The following antibodies were used: anti-AhR (ab2770, Abcam) and anti-pSmad2/3(cell signaling). The samples were then analyzed on a FACSCalibur flow cytometer (BD Biosystems).

2.3. Immunocytochemical Analysis in WI 38 Cells

Cultured cells were fixed with 10% formalin at room temperature (RT) for 10 minutes and permeabilized for 5 mins with PBS containing Triton X100 and BSA buffer (0.3% TTX, 1% bovine serum albumin: TTX/BSA buffer). The cells were further blocked in 10% blocking serum for 30 min and then incubated with first antibody for 1 hour at RT. After washing with PBS, cells were incubated with fluorescent labelled secondary antibodies for 30 minutes at RT. Nuclei were counterstained with DAPI. Sections were subsequently dehydrated, mounted, and observed under the fluorescent microscope. The following antibodies were used: anti-AhR primary antibody (Abcam, ab2770, 1 : 20); anti-α-SMA (Abcam, ab32575); and anti-vimentin (eBioscience).

2.4. Quantitative Real-Time RT-PCR (qRT-PCR)

Total RNA from WI38 was extracted with RNAeasy kit (Qiagen, Valencia, CA). RT-PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems, USA) according to the manufacturer’s protocol. The primers for each gene were designed on the basis of the respective mRNA sequences so that the targets were 100–200 bp in length. Relative mRNA expression was calculated by normalization of all expression levels to actinand then compared to untreated control cells by the ΔΔCT method as described previously [36]. The following primers were used:

Actin: F, AGAAAATCTGGCACCACACC; R, CAGAGGCGTACAGGGATAGC; AhR: F, GTCGTCTAAGGTGTCTGCTGGA; R, CGCAAACAAAGCCAACTGAGGTG; cyp1a1: F, GATTGAGCACTGTCAGGAGAAGC; R, ATGAGGCTCCAGGAGATAGCAG; cyp1b1: F, GCCACTATCACTGACATCTTCGG; R, CACGACCTGATCCAATTCTGCC; ltbp1: F, TGAATGCCAGCACCGTCATCTC; R, CTGGCAAACACTCTTGTCCTCC; ltbp-2: F, CTGCACAGATGACAACGAGTGTC; R, AGAGTGTAGCCAGGGTAGCAGA; ltbp-3: F, CGGTCACTACAAGTGCAACTGC; R, CTTGTTCTCGCATTTGCCATCCG; ltbp-4: F, TTCCAGTGCAGGACCTGTCCTT; R: GAAGGAGCCTTCGGTGTTAGTG.

2.5. ELISA

Supernatants from cultured fibroblasts (WI38) were collected and measured for active TGFβ1 by ELISA (eBiosciences), according to the manufacturer’s instructions. Results were read with a Bio-Rad Bio-Plex instrument (Bio-Rad Laboratories, Hercules, CA).

2.6. Gene Knockdown by siRNA

Transcriptional knockdown was performed by transfection with siRNA oligonucleotide duplexes as a final concentration of 20 nM in DMEM using DharmaFECT transfection reagent (Thermo Scientific, Waltham, MA). A siRNA/transfection reagent complex was formed when siRNA and transfection reagent were mixed for 20 minutes. Then the transfection complex was added to each experimental well and incubated in the serum free media for 6 hours at 37°C. The transfection medium was replaced with complete medium and incubated at 37°C for an additional 24–48 hours. The gene knockdown was confirmed by qRT-PCR and western blotting. AhR specific siRNA was purchased from Thermo Scientific and LTBP1 specific siRNA was purchased from Sigma.

2.7. Western Blotting

Cells were washed twice with ice cold PBS and lysed in RIPA buffer containing protease and phosphatase inhibitor cocktails (Sigma). Protein content was measured with BCA reagent (Pierce). Equivalent protein samples were subjected to SDS-PAGE electrophoresis and then transferred to a polyvinylidene difluoride membrane (Millipore). After blocking with 5% nonfat dry milk in TBST, the membrane was incubated with primary anti-AhR (Abcam), anti-LTBP1 (GeneTex), anti-α-SMA (Abcam, ab32575), anti-vimentin (eBioscience), or anti-β-actin (clone C4, Santa Cruz) antibody as a loading control for normalization. Proteins reactive with primary Abs were visualized with HRP-conjugated secondary Ab and ECL reagents (Amersham). The levels of proteins were quantified by ImageJ (National Institutes of Health, USA) for the densitometric analysis of the band intensities and normalized to those of β-actin.

2.8. Statistical Analysis

Data are expressed as the means ± SEM for each group. Statistical significance for normally distributed samples was assessed using an independent two-tailed Student’s t-test or with analysis of variance by using GraphPad Prism version 5.1 software (GraphPad Software, La Jolla, CA). Differences with P < 0.05 were considered statistically significant.

3.1. Increased AhR Expression in Fibroblasts from Asthmatic Patients

To examine whether there was a differential expression for AhR in asthmatic and healthy individuals, we performed immunofluorescence analysis for both AhR and fibroblast marker ER-TR7 in human airway sections. Compared to healthy individuals (Figure 1, middle panel), the airway sections from asthmatic patients showed significant expression of AhR, increased fibroblasts marker ER-TR7, and thickening of basal membranes (Figure 1, top panel). Particularly, AhR was predominantly expressed in fibroblasts and basal membranes. Interestingly, significantly increased AhR expression was also observed in airway fibroblasts from heavy smokers (Figure 1, bottom panel). These findings suggest an increased AhR expression in fibroblasts from asthmatic patients and possibly from those who are repeatedly exposed to smoking.

3.2. Increased AhR Expression in CRE-Treated Human Lung Fibroblasts

To delineate the role of AhR in the regulation of fibroblast’s function and its mechanisms, we used human lung fibroblast cell line as an in vitro model. To validate AhR expression in fibroblasts, we detected AhR expression in WI-38, a human lung fibroblast cell line, by flow cytometry and western blot (data not shown). We found that AhR was constitutively expressed in fibroblasts (Figure 2(a)). We next examined whether AhR is functional; we treated fibroblasts using different doses of TCDD known AhR ligands (0.1 nM and 1 nM) for 2 to 48 hours; expression of AhR downstream genes cyp1a1 (Figure 2(b)) and cyp1b1 (Figure 2(c)) was examined by RT-PCR. Compared to those untreated fibroblasts, an increased expression was noted in TCDD treated fibroblasts for cyp1a1 in a dose- and time-dependent manner. There was nearly a 2-fold increase in cyp1a1 expression after treatment with 1.0 nM TCDD for 48 hours. Similarly, an 18.5-fold increase was observed for cyp1b1 when 1.0 nM TCDD was used to treat fibroblasts for 48 hours, suggesting that TCDD can activate the AhR pathway in fibroblasts. Furthermore, to investigate whether CRE can induce AhR expression, we treated fibroblasts with 50 μg/mL CRE for 2–48 hours and AhR expression was examined by RT-PCR. An increased AhR expression was seen with a peak level at 4 hours for a 5.7-fold increase when compared with untreated cells (Figure 2(d)). Increased AhR expression in a dose-dependent manner was further observed by immunofluorescence analysis (Figure 2(e)), suggesting that cockroach allergen can induce AhR expression which may be critical in modulating allergen-induced immune responses.

3.3. AhR Modulates CRE Induced TGFβ1 Production in Fibroblasts

To investigate whether AhR can modulate cockroach allergen-induced TGFβ1 production that may control cell differentiation and immune regulation, we treated fibroblasts with CRE (50 μg/mL) in the presence or absence of AhR agonist TCDD or antagonist CH122319 and detected the levels of active TGFβ1 in supernatants of cultured and treated fibroblasts. We found that TCDD induced a significant release of active TGFβ1 by fibroblasts that were treated with TCDD at various doses (1.0, 10 nM) and times (24, 48 hours, Figure 3(a)). Both cockroach allergen and TCDD as an individual induced increased levels of active TGFβ1 by fibroblasts. Interestingly, the increased TGFβ1 was further enhanced when both of them were combined (Figure 3(b)). In contrast, AhR antagonist CH122319 inhibited CRE+TCDD induced TGFβ1 production (Figure 3(b)). Cockroach allergen-induced active TGFβ1 release and the inhibition of CH122319 were further confirmed by using natural purified cockroach allergen, Bla g2 (Figure 3(c)). These findings suggest that AhR can modulate cockroach allergen-induced TGFβ1 production.

3.4. Reduced Levels of Active TGFβ1 in Fibroblasts with AhR Knockdown

To further examine the modulation of AhR on cockroach allergen-induced TGFβ1 production, we knocked down AhR in fibroblasts using siRNAs. The AhR knockdown was validated by RT-PCR (Figure 4(a)), which showed at least 60% knockdown for si-RNA-2, and by western blotting (Figure 4(b)). AhR expression in Figure 4(b) was further quantified by ImageJ for the densitometric analysis of the band intensities and normalized to those of β-actin and then compared to scramble si-RNA treated group (Figure 4(c)). There was at least 70% knockdown for si-RNA-2. We next used fibroblasts with AhR knocked down by si-AhR-2 to detect TGFβ1 expression at the RNA levels by RT-PCR (Figure 4(d)) and active TGFβ1 secretion by ELISA (Figure 4(e)). We found that TGFβ1 expression at the RNA level or in secretion was significantly reduced for fibroblasts with AhR knockdown. To examine whether AhR knockdown can affect the activation of TGFβ signaling, we treated those fibroblasts with or without AhR knockdown with 5 ng/mL TGFβ1 and measured phosphorylated Smad2/3 (p-Smad2/3) at various times by flow cytometry (Figure 4(f)). We noted an increased activation of Smad2/3 at 15 min for all these treated cells but we noted a decline at 30 mins and 120 mins. Interestingly, fibroblasts with AhR knockdown showed remarkable reduction in the levels of p-Smad2/3 at 120 mins as compared to the control cells. These data suggest that there may be a crosstalk between AhR pathway and TGFβ1 pathway.

3.5. AhR Modulates CRE Induced Fibroblast Differentiation

To examine whether AhR controls fibroblast differentiation induced by CRE, we cultured fibroblasts with and without AhR knockdown and treated with CRE (50 μg/mL) for 24 and 72 hours. Differentiation of fibroblasts was evaluated by the expression of α-SMA with DAPI for nuclei immune-staining. While no clear change was noted in the α-SMA expression for fibroblasts with and without AhR knockdown at basal levels and 24 hours, an increased expression was seen when treated with CRE for 72 hours for fibroblasts without AhR knockdown. The α-SMA positive staining in fibroblasts was quantified and analyzed by Imaging software (Figure 5(b)). A significantly greater expression of α-SMA was observed for fibroblasts with CRE treatment. Finally, reduced α-SMA expression was detected by RT-PCR in fibroblasts with AhR knockdown as compared to those without gene knockdown (Figure 5(c)), suggesting that AhR may control cockroach allergen-induced differentiation. CRE induced fibroblast differentiation was further confirmed by immune-staining (Figure 5(d)) and western blots (Figure 5(e)) with another myofibroblast marker, vimentin.

3.6. Increased LTBP1 Expression in TCDD Treated Fibroblasts

TGFβ1 activity has been shown to be controlled by LTBP-1 [31]. Furthermore, it has been suggested that AhR may control LTBP1 expression, and subsequently activation of TGFβ1 signaling [32]. To investigate whether the AhR ligand can activate LTBP1 that may control TGFβ1 release, we treated fibroblasts using different doses of TCDD (0.1 nM and 10 nM) for different times (2 to 48 hours), and expression of LTBP1 to 4 at the RNA levels was measured by RT-PCR. Of these, increased LTBP1 was observed after treatment with TCDD (Figure 6(a)). The peak level was at 4 h for 0.1 nM and 24 h for 1 nM TCDD, respectively. Reduced expression of LTBP-2 was detected (Figure 6(b)), while no significant changes of LTBP-3 and 4 were detected (data not shown). To see the importance of increased LTBP-1 in AhR modulating active TGFβ1 release, we pretreated fibroblasts with LTBP-1 specific siRNA. We found that TCDD induced active TGFβ1 was significantly inhibited when LTBP-1 was knockdown (Figure 6(c)), suggesting that LTBP-1 may be critical in AhR controlling the release of active TGFβ1.