Free Access

The novel transcriptional regulator SczA mediates protection against Zn²⁺ stress by activation of the Zn²⁺-resistance gene czcD in Streptococcus pneumoniae

Tomas G. Kloosterman

Department of Molecular Genetics, University of Groningen, Groningen Biomolecular Sciences and Biotechnology Institute, PO Box 14, 9750 AA Haren, the Netherlands.

Search for more papers by this author

Magdalena M. Van Der Kooi-Pol,

Magdalena M. Van Der Kooi-Pol

Department of Molecular Genetics, University of Groningen, Groningen Biomolecular Sciences and Biotechnology Institute, PO Box 14, 9750 AA Haren, the Netherlands.

Search for more papers by this author

Jetta J. E. Bijlsma,

Jetta J. E. Bijlsma

Department of Molecular Genetics, University of Groningen, Groningen Biomolecular Sciences and Biotechnology Institute, PO Box 14, 9750 AA Haren, the Netherlands.

Search for more papers by this author

Oscar P. Kuipers,

Corresponding Author

Oscar P. Kuipers

*E-mail [email protected]; Tel. (+31) 50 3632093; Fax (+31) 50 3632348.Search for more papers by this author

Tomas G. Kloosterman,

Tomas G. Kloosterman

Department of Molecular Genetics, University of Groningen, Groningen Biomolecular Sciences and Biotechnology Institute, PO Box 14, 9750 AA Haren, the Netherlands.

Search for more papers by this author

Magdalena M. Van Der Kooi-Pol,

Magdalena M. Van Der Kooi-Pol

Department of Molecular Genetics, University of Groningen, Groningen Biomolecular Sciences and Biotechnology Institute, PO Box 14, 9750 AA Haren, the Netherlands.

Search for more papers by this author

Jetta J. E. Bijlsma,

Jetta J. E. Bijlsma

Department of Molecular Genetics, University of Groningen, Groningen Biomolecular Sciences and Biotechnology Institute, PO Box 14, 9750 AA Haren, the Netherlands.

Search for more papers by this author

Oscar P. Kuipers,

Corresponding Author

Oscar P. Kuipers

*E-mail [email protected]; Tel. (+31) 50 3632093; Fax (+31) 50 3632348.Search for more papers by this author

First published: 19 July 2007

https://doi.org/10.1111/j.1365-2958.2007.05849.x

Citations: 109

Share a link

Email
Wechat
Bluesky

Summary

Maintenance of the intracellular homeostasis of metal ions is important for the virulence of many bacterial pathogens. Here, we demonstrate that the czcD gene of the human pathogen Streptococcus pneumoniae is involved in resistance against Zn²⁺, and that its transcription is induced by the transition-metal ions Zn²⁺, Co²⁺ and Ni²⁺. Upstream of czcD a gene was identified, encoding a novel TetR family regulator, SczA, that is responsible for the metal ion-dependent activation of czcD expression. Transcriptome analyses revealed that in a sczA mutant expression of czcD, a gene encoding a MerR-family transcriptional regulator and a gene encoding a zinc-containing alcohol dehydrogenase (adhB) were downregulated. Activation of the czcD promoter by SczA is shown to proceed by Zn²⁺-dependent binding of SczA to a conserved DNA motif. In the absence of Zn²⁺, SczA binds to a second site in the czcD promoter, thereby fully blocking czcD expression. This is the first example of a metalloregulatory protein belonging to the TetR family that has been described. The presence in S. pneumoniae of the Zn²⁺-resistance system characterized in this study might reflect the need for adjustment to a fluctuating Zn²⁺ pool encountered by this pathogen during infection of the human body.

Introduction

Metal ions are essential for the structure and function of many enzymes and regulatory proteins in bacteria. However, an excess of metal ions can be deleterious to the cell (Finney and O'Halloran, 2003). To maintain the homeostasis of metal ions, bacteria contain systems for metal ion uptake and efflux, of which the expression is tightly controlled by metal-responsive regulatory proteins (Hantke, 2001; Nies, 2003; Moore and Helmann, 2005; Pennella and Giedroc, 2005). Various systems involved in the uptake of metal ions have been studied in the human pathogen Streptococcus pneumoniae. Mn²⁺, and possibly also Zn²⁺, are taken up by the PsaBCA permease (Dintilhac et al., 1997; Lawrence et al., 1998; McAllister et al., 2004), whereas the adcCBA gene cluster likely encodes a Zn²⁺ ABC uptake system (Dintilhac et al., 1997; Dintilhac and Claverys, 1997). In addition, three iron uptake loci, piaABCD, piuBCDA and pit, have been described in S. pneumoniae (Brown et al., 2001; 2002). Both PsaBCA and AdcCBA, as well as their presumed substrates Mn²⁺ and Zn²⁺, are important for competence of S. pneumoniae (Dintilhac et al., 1997; Dintilhac and Claverys, 1997). Furthermore, PsaA (Berry and Paton, 1996; Johnston et al., 2004), PiaA and PiuA (Brown et al., 2001) have been shown to contribute to virulence, and moreover, PsaA contributes to oxidative stress resistance (Tseng et al., 2002; Johnston et al., 2004).

So far, three regulators have been described in S. pneumoniae, that regulate metal ion uptake and contribute to virulence. First, the DtxR-family regulator PsaR represses psaA and other genes in the presence of a high Mn²⁺ concentration (Johnston et al., 2006). Second, the orphan response regulator RitR (Throup et al., 2000) functions as a repressor of iron uptake via the piuABCD operon (Ulijasz et al., 2004). Third, TCS04 activates expression of psaBCA (McCluskey et al., 2004).

Next to metal ion uptake systems, bacterial genomes encode genes that enable the cell to cope with high concentrations of metal ions (Nies, 2003). Prominent protein families include: (i) the resistance nodulation family (RND), which are proton-driven antiporters found in all kingdoms of life; (ii) the cation diffusion facilitators (CDF family) driven by a chemiosmotic gradient or a potassium gradient (Haney et al., 2005); and (iii) P-type ATPases that are driven by ATP hydrolysis (Nies, 2003). In several bacteria, the CDF-family protein CzcD is known to be an important heavy-metal ion-resistance determinant. In the Gram-negative bacterium Ralstonia metallidurans CH34 (= Alcaligenes eutrophus), the czcRS two-component system is involved in regulation of the czcD and czcCBA genes, that mediate resistance against Co²⁺, Zn²⁺ and Cd²⁺ (Nies and Silver, 1989; van der Lelie et al., 1997). In Staphylococcus aureus CzrA, a member of the ArsR/SmtB family of DNA binding proteins, functions as a repressor of the czr operon, that consists of czrA and the gene encoding the CzcD homologue CzrB (Xiong and Jayaswal, 1998; Kuroda et al., 1999; Singh et al., 1999). CzrA-mediated repression is alleviated in the presence of Zn²⁺ and Co²⁺ (Xiong and Jayaswal, 1998; Kuroda et al., 1999; Singh et al., 1999). The Bacillus subtilis cation efflux pump czcD, which mediates resistance against Zn²⁺, Co²⁺, Ni²⁺ and Cu²⁺, is regulated by an ArsR-type repressor (CzrA_BS) as well (Moore et al., 2005).

As metal ions like Zn²⁺, Fe²⁺ and Cu²⁺ are also necessary for the proper functioning of the human immune system (Percival, 1998; Shankar and Prasad, 1998; Rink and Gabriel, 2000; Schaible and Kaufmann, 2004), they might have a significant influence on the interaction between S. pneumoniae and its host. Noteworthy, the concentration of Zn²⁺ may vary greatly between different sites in the human body (15 μM in serum versus 229 μM in the lungs) (Versieck, 1985). In the light of the pivotal role of CzcD homologues in metal ion homeostasis in other organisms, the function of czcD in S. pneumoniae was studied. In this pathogen we demonstrate that czcD is an important determinant for resistance against elevated levels of Zn²⁺. Furthermore, a novel TetR-family regulator, SczA, is shown to function as a Zn²⁺/Co²⁺/Ni²⁺-dependent transcriptional activator of czcD by binding to a regulatory cis-element in the czcD promoter, that is conserved in several related streptococci.

Results

Regulation and function of czcD in S. pneumoniae

The S. pneumoniae czcD orthologue is located in a possible operon with the genes spr1671, encoding a MerR-family regulator, and adhB, encoding a zinc-containing alcohol dehydrogenase, followed by a putative terminator (Fig. 1A). To be able to study the expression of the czcD operon in detail, an ectopic transcriptional lacZ fusion was constructed to the predicted promoter of czcD in D39 (Fig. 1A). Of various metal ions tested, namely Mn²⁺, Mg²⁺, Fe²⁺, Fe³⁺, Zn²⁺, Co²⁺, Ni²⁺ and Cu²⁺, only Zn²⁺, Co²⁺ and Ni²⁺ caused induction of PczcD–lacZ expression (Table 1). To investigate the physiological function of CzcD in S. pneumoniae, growth of an in-frame czcD deletion strain was compared with that of the wild-type in GM17 (Terzaghi and Sandine, 1975; a complex medium used for growth of streptococci, based on casein, soy peptone, beef extract and yeast extract) supplemented with various metal ions. This showed that the czcD mutant displays a strongly decreased resistance against Zn²⁺ compared with the wild-type (Fig. 2A). In addition, resistance against Co²⁺ was also lower in the czcD mutant (Fig. 2B), while resistance to Ni²⁺ was slightly higher compared with the wild-type (Fig. 2C). These data indicate that CzcD protects S. pneumoniae primarily against Zn²⁺ toxicity, and to a lesser extent against Co²⁺.

Details are in the caption following the image — **Figure 1**
Open in figure viewer PowerPoint

Organization of the *czcD* operon in *S. pneumoniae*.
A. Schematic overview of the *czcD* locus in *S. pneumoniae* R6. Lollipops indicate terminator structures with the numbers indicating the predicted ΔG⁰ in kcal mol⁻¹. Right- or left-pointing flags indicate promoters. Below the genes, fragments used for construction of the *lacZ* fusions to PsczA and PczcD (A) and Pspr1671 (B) in pPP2 are indicated. IS indicates the position of the mariner insertion in strain MP112.
B. RT-PCR using primers spr1671-2/czcDKO-3 (*czcD–spr1671* intergenic region) and spr1671-3/spr1671-4 (*spr1671–adhB* intergenic region). DNA, positive control PCR on D39 chromosomal DNA. ‘RT’ and ‘-RT’ indicate PCR on total RNA isolated from D39 wild-type grown in GM17 + 0.05 mM Co²⁺, with and without reverse transcription respectively.

Table 1. Transcriptional regulation of czcD in S. pneumoniae D39.

Medium	β-Galactosidase activity
Medium	wt	ΔsczA	ΔczcD
GM17	3 (2)	3 (2)	12 (3)
Zn²⁺ (0.1 mM)	66 (4)	3 (2)	85 (10)
Co²⁺ (0.05 mM)	78 (5)	5 (2)	25 (8)
Ni²⁺ (0.2 mM)	160 (16)	6 (2)	52 (9)

β-Galactosidase activity (Miller Units) is given for strains MP103 [D39 ΔbgaA::PczcD–lacZ, wt (wild-type)] and MP107 (D39 ΔsczAΔbgaA::PczcD–lacZ, ΔsczA) and MP111 (D39 ΔczcDΔbgaA::PczcD–lacZ, ΔczcD) grown in GM17 with the indicated metal ions. Standard deviation of three independent experiments is given between brackets.

In R. metallidurans, deletion of czcD resulted in increased transcription of the czcCBA heavy-metal-resistance genes, likely due to an increase in the intracellular concentration of metal cations (Nies, 1992; Anton et al., 1999; Grosse et al., 2004). To investigate the possibility that in S. pneumoniae CzcD has a similar effect on expression of its own gene, we measured expression of the PczcD–lacZ transcriptional fusion in the czcD-deletion mutant (Table 1). In the absence of added metal ions, there was expression from PczcD in the mutant but not in the wild-type. The induction of expression by Zn²⁺ was slightly higher in the czcD mutant than in the wild-type. Surprisingly, however, expression from the czcD promoter (PczcD) in response to Co²⁺ and Ni²⁺ was threefold lower in the czcD mutant compared with the wild-type. Thus, deletion of czcD interferes with the responsiveness of PczcD to Co²⁺ and Ni²⁺.

Identification of SczA, a novel TetR-family regulator involved in activation of czcD

blast searches revealed that the S. pneumoniae genome does not contain orthologues of the ArsR-type repressor czrA that regulates expression of czcD in both B. subtilis and S. aureus (Xiong and Jayaswal, 1998; Singh et al., 1999; Kuroda et al., 1999; Moore et al., 2005). Therefore, we used strain MP103 (D39 ΔbgaA::PczcD–lacZ) to perform random mutagenesis with the Himar1 MarC9 transposon (Lampe et al., 1996), screening for mutants that are disturbed in the Zn²⁺-dependent induction of PczcD–lacZ expression. Random mutants were selected in the presence of a subinhibitory concentration of 0.25 mM Zn²⁺ and X-gal, a condition that normally leads to expression of PczcD–lacZ and thus blue colonies. Five white colonies were found among 12 500 blue colony-forming units. The transposon insertion sites were determined to be all at the same position in spr1673, encoding a TetR-family regulator (Ramos et al., 2005), which lies upstream of czcD (Fig. 1A). To unambiguously prove that spr1673 is involved in activation of czcD, we replaced the gene with a spectinomycin-resistance marker. In the resulting mutant, czcD expression was no longer induced by Co²⁺, Zn²⁺ or Ni²⁺ (Table 1). We propose the name SczA for the newly identified regulator, which stands for streptococcal czcDactivator. Thus, SczA activates transcription of the czcD gene in S. pneumoniae, in response to Co²⁺, Zn²⁺ or Ni²⁺.

As SczA activates expression of czcD, we hypothesized that the sczA mutant has the same phenotype as the czcD mutant. This is indeed the case (Fig. 2A–C). In trans expression of a his-tagged SczA version complemented the Zn²⁺-sensitive phenotype of the sczA mutant, excluding the possibility of polar effects of the sczA deletion on czcD (Fig. 2D).

Microarray analysis of the sczA mutant

To determine the influence of the sczA mutation on the transcriptome of S. pneumoniae D39, the wild-type was compared with the isogenic sczA mutant by use of DNA microarrays. To exclude effects due to the increased toxicity of Zn²⁺ to the sczA mutant compared with the wild-type, strains were grown in GM17 with 0.05 mM Co²⁺. Under these conditions, expression from PczcD is activated by SczA, and growth of the mutant and the wild-type is comparable (Fig. 2). The transcriptome analysis showed that in addition to czcD, also two downstream genes, namely the MerR-family regulator spr1671 and the zinc-containing alcohol dehydrogenase adhB (spr1670), were strongly downregulated in the mutant (Table 2).

Table 2. Summary of transcriptome comparison of S. pneumoniae strains MP100 (D39 ΔsczA) with D39 wild-type grown in GM17 with 0.05 mM Co²⁺.

Gene name^a	Function^b	Ratio^c
SP0202/spr0183	Anaerobic ribonucleoside-triphosphate reductase NrdD	2.7
SP0203	Hypothetical protein	2.5
SP0204/spr0184	Predicted acetyltransferase, GNAT family	2.6
SP0205/spr0185	Anaerobic ribonucleoside-triphosphate reductase activating protein NrdG	2.5
SP0206	Hypothetical protein; uridine kinase	2.6
SP0207/spr0186	Hypothetical protein; uridine kinase	2.6
SP1855/spr1670	Alcohol dehydrogenase, zinc-containing, AdhB	−3.9
SP1856/spr1671	Transcriptional regulator, MerR family	−3.8
SP1857/spr1672	Cation efflux system protein CzcD	−17.5
SP1858/spr1673	TetR-family transcriptional regulator protein SczA	−6.2

a. Gene numbers refer to TIGR4 and R6 locus tags.
b. TIGR annotation/R6 annotation (Hoskins et al., 2001; Tettelin et al., 2001).
c. Ratios > 2.0 or < −2.0 (signal intensity for MP100 divided by that for D39), which have a Bayesian P-value < 0.001 and a false discovery rate < 0.01.

There is a 243 bp intergenic region between czcD and spr1671, but no intergenic region between spr1671 and adhB (Fig. 1A). Thus, spr1671 and adhB are likely to be regulated by SczA either via PczcD or via a putative promoter just upstream of spr1671. To investigate this, a transcriptional lacZ fusion with the czcD–spr1671 intergenic region was constructed (Fig. 1A). This lacZ fusion displayed 7 Miller Units promoter activity, which was neither influenced by the sczA mutation nor by the addition of metal ions to the medium (data not shown). In addition, reverse transcription polymerase chain reaction (RT-PCR) showed that spr1671 and adhB are located on the same transcript as czcD (Fig. 1B). Thus, we conclude that spr1671 and adhB are regulated by SczA via PczcD and are at least partially co-transcribed with czcD, i.e. form an operon with it.

A transcriptional unit (spr0183–spr0186) containing the class III nucleotide reductase encoding genes nrdD and nrdG, involved in ribonucleoside triphosphate synthesis, was upregulated in the sczA mutant, suggesting that SczA is directly or indirectly a repressor of these genes. Using a lacZ fusion to the promoter of nrdD (spr0183), the array data could be validated (Table 3). However, expression of PnrdD also seems to be affected by another factor, as an effect of SczA was only seen in the presence of Co²⁺. In conclusion, under these experimental conditions, SczA influences the expression of only a limited number of genes.

Table 3. Expression (Miller Units) of a Pspr0183–lacZ transcriptional fusion in D39 wild-type (wt; strain MP106) and D39 ΔsczA (strain MP110) in GM17 and GM17 with 0.05 mM Co²⁺.

Medium	β-Galactosidase activity
Medium	wt	ΔsczA
GM17	18 (3)	21 (3)
Co²⁺ (0.05 mM)	32 (2)	103 (5)

Standard deviation of three independent experiments is given between brackets.

The sczA–czcD genomic organization is conserved among several streptococcal species

Using blast searches, several organisms were found to contain an orthologue of SczA. Only in S. mitis (90% identity), S. thermophilus (73% identity), S. pyogenes (50% identity) and S. agalactiae (48% identity), which contain the closest SczA homologues, the putative sczA genes were located immediately next to a czcD orthologue (data not shown). This suggests that in these streptococci, SzcA has a similar regulatory function of czcD expression as we here found in S. pneumoniae.

As the sczA–czcD gene order is conserved in the above-mentioned streptococci, the sczA–czcD intergenic regions from these five organisms were subjected to the online tool Gibbs Motif Sampler (Thijs et al., 2002). This resulted in the identification of a conserved palindromic sequence, which is present in the sczA–czcD intergenic region of each of the five organisms, and of several conserved residues that are present just upstream of this palindrome (Fig. 3). Searching the entire S. pneumoniae R6 and D39 genomes for the presence of the putative SczA operator using Genome2D (Baerends et al., 2004) did not reveal additional promoter regions containing a similar sequence.

Identification and verification of a SczA operators in PczcD

To find out whether the identified conserved DNA motif (hereafter designated as motif 1, 4, 8) mediates the SczA-dependent transcriptional control of PczcD, several lacZ fusions were constructed, in which PczcD was truncated from the 5′ end (Fig. 4). This showed that removal of the few conserved bases upstream of the palindromic sequence of motif 1 (PczcD-2), or the whole (PczcD-4) or half (PczcD-3) of the palindromic sequence, led to abolishment of the SczA-dependent activation in the presence of Zn²⁺, whereas a promoter fragment truncated just upstream of motif 1 (PczcD-2b) still showed SczA- and Zn²⁺-dependent activation (Fig. 4). The same was seen when Co²⁺ was used to induce expression (data not shown).

To determine whether motif 1 functions as a binding site for SczA, the promoter truncations were used in direct binding assays with purified H₆-SczA (Fig. 5A), which was functional when expressed in S. pneumoniae (Fig. 2D). Surprisingly, H₆-SczA specifically bound to all truncations, even to PczcD-4, which entirely lacks motif 1 (Fig. 5A). However, only with motif 1 present in its full length, including the bases upstream of the palindrome (PczcD-2b), binding resulted in complexes of higher molecular weight (MW) (Fig. 5A).

Apparently, H₆-SczA also binds to another, more downstream site in PczcD. Closer examination of this 3′ region of PczcD revealed a perfect inverted repeat (motif 2, 4, 8), of which the second half (5′-TGTTCA-3′) is identical to the first half of the palindromic part of the SczA operator (Fig. 8B), which therefore could function as an additional SczA binding site. This motif 2 is, however, not conserved in the other streptococci. To investigate the effect of motif 2 on the SczA-dependent activation of PczcD, four subsequent point-mutations were introduced in promoter fragment PczcD-1 (Fig. 8B). Expression from this PczcD fragment (PczcD-mut1) in the presence of Zn²⁺ or Co²⁺ was four times higher than PczcD-1, and it was also slightly expressed in GM17 (Fig. 6A). Conversely, introduction of four subsequent point-mutations in motif 1 (Fig. 8B, PczcD-mut2) abolished expression in the presence of Zn²⁺ or Co²⁺ completely (data not shown). Binding of purified H₆-SczA to PczcD-mut1 resulted only in the band of higher MW (Fig. 5A), whereas binding to PczcD-mut2 resulted only in the low-MW bands (Fig. 5B). Thus, motif 2 functions as a binding site for SczA, giving rise to the complex of low MW. This interaction is not necessary for the activation of PczcD by SczA, but moderates activation of czcD expression. Motif 1, on the other hand, mediates the SczA-dependent activation of the czcD promoter.

As SczA activates PczcD, we wondered whether it also affects expression of its own promoter, which is located on the same intergenic region (Fig. 1A), and whether this is mediated by motif 2. Therefore, expression of the wild-type (PsczA-1) and a sczA promoter with the four point-mutations in motif 2 (PsczA-mut1) was analysed in the wild-type strain and the sczA mutant (Fig. 6B). This showed that SczA has a twofold repressive effect on the expression of its own gene, which was, however, independent of the addition of the metal ions Zn²⁺ and Co²⁺ (Fig. 6B). The autorepressive effect of SczA was fully relieved upon mutation of motif 2 (Fig. 6B). Taken together, our experiments demonstrate the functionality of a SczA operator sequence (motif 1) that mediates activation of PczcD, as well as a second sequence (motif 2) that mediates autorepression of sczA and furthermore weakens activation of PczcD.

Zn²⁺-dependent binding of SczA to PczcD

To further elucidate the mechanism of transcriptional activation by SczA, the effect of metal ions on binding of H₆-SczA to PczcD was studied. To prevent interference with the binding of metal ions to H₆-SczA, running- and gel buffers without EDTA were used. Under these conditions, H₆-SczA binding to PczcD-1 resulted only in the higher-MW complex (binding to motif 1, Fig. 7A), as opposed to the formation of both high- and low-MW complexes with the standard TBE running buffer that contains 2 mM EDTA, which was used for the shifts in Fig. 5A. Binding of H₆-SczA to PczcD-1 in the absence of EDTA was stimulated by Zn²⁺, Co²⁺ and Ni²⁺, but not by Mn²⁺ and apparently Mg²⁺, which is present in a 5 mM concentration in the binding buffer (Fig. 7A and B). Addition of EDTA to the reaction mixture, however, led to formation of the lower-MW complex (Fig. 7A and B). Titration of Zn²⁺ in the reactions with EDTA indeed led to formation of the higher-MW complex again, while Mn²⁺ did not (Fig. 7A). Also Co²⁺ and Ni²⁺ led to formation of the higher band (Fig. 7B). The fact that the low-MW band was only seen upon addition of EDTA, suggests that the purified H₆-SczA contains a low amount of metal ions, possibly Ni²⁺ as a consequence of the purification procedure, which favours formation of the higher-MW complex.

To analyse the effects observed above in more detail, DNase I footprint analyses were performed with H₆-SczA and PczcD, in the presence of EDTA and in the presence of both EDTA and Zn²⁺(Fig. 8A and B). In the presence of EDTA, only protection was seen of motif 2, whereas the addition of Zn²⁺ led to disappearance of this protected region and the appearance of a protected area comprising motif 1 (Fig. 8A and B). Thus, the data argue for a model in which binding of SczA to motif 1 in PczcD is stimulated by Zn²⁺, while SczA binding to motif 2 is relieved by Zn²⁺, in this way accomplishing the Zn²⁺-dependent activation of czcD expression (Fig. 9).

Discussion

In this study, we investigated the regulation of czcD, which we demonstrate to encode an important Zn²⁺-resistance determinant in the human pathogen S. pneumoniae. A novel TetR-family regulator, SczA, was identified that activates expression of czcD in the presence of Zn²⁺, Co²⁺ and Ni²⁺. Moreover, we identified and demonstrated the functionality of an operator sequence for SczA. TetR-family regulators are known to be involved in a variety of functions, such as regulation of antibiotic biosynthesis, osmotic stress and multidrug resistance, and they usually function as repressors (Ramos et al., 2005). To our knowledge, this is the first metalloregulatory protein belonging to the TetR family identified so far. In addition, it is one of a few examples of regulators from the TetR family that function as a transcriptional activator (Lin et al., 2000; Croxatto et al., 2002; Ramos et al., 2005; Novakova et al., 2005; Christen et al., 2006).

The CDF family, to which CzcD belongs, is an ubiquitous family of transporters present in prokaryotes and eukaryotes, which play a role in metal ion homeostasis, but also appear to fulfil other functions in the cell (Haney et al., 2005). We show that CzcD protects significantly against Zn²⁺ stress in S. pneumoniae, and to a lesser extent against Co²⁺ stress. Alignment shows that S. pneumoniae CczD contains the conserved aspartyl residues that are known to contribute to a metal ion binding site and metal ion transport in the CDF-family Zn²⁺ efflux pump YiiP of Escherichia coli (Wei and Fu, 2006). This suggests that CzcD also functions as a Zn²⁺ efflux pump in S. pneumoniae.

The observation that czcD in S. pneumoniae seems to be primarily involved in resistance towards Zn²⁺ raises the question as to the reason of the strong transcriptional response of PczcD to Co²⁺ and Ni²⁺. Possibly, there are other efflux pumps in S. pneumoniae that are involved in resistance against Co²⁺ and Ni²⁺. This would agree with the observed aberrant regulation of PczcD in the czcD mutant in response to Co²⁺ and Ni²⁺, but not to Zn²⁺. Other candidate heavy-metal-resistance genes encoded by the S. pneumoniae genome are spr1466 (cadD), a putative cadmium-resistance transporter, and spr1411, encoding a CDF-family protein. A possible third metal ion-resistance gene might be spr0641, which shows homology to the PerR-regulated gene pmtA in S. pyogenes involved in resistance to Zn²⁺ (Brenot et al., 2007).

The transcriptional response of czcD in S. pneumoniae shows similarity to that found in B. subtilis, where czcD is induced in the presence of Zn²⁺, Ni²⁺, Co²⁺ and Cu²⁺. However, the regulatory mechanism underlying this response is completely different, as in B. subtilis, an ArsR-type regulator, CzrA, functions as a repressor of czcD (Moore et al., 2005). Close homologues of CzrA (> 45% identity) are present in several Staphylococcus, Bacillus and Listeriae species, whereas SczA is only present (> 45% identity) in a small group of related streptococci, where the sczA gene is linked to czcD. Several other important groups of Gram-positive bacteria, such as lactococci and enterococci, do not seem to contain either regulator type, indicating a yet different regulatory factor governing expression of their czcD orthologues.

The microarray results show that SczA also regulates expression of spr1671, encoding a MerR-family regulator with homology (30% identity) to copper-responsive regulators, and adhB, which are located immediately downstream of czcD. The fact that adhB is regulated by SczA makes sense, as it is predicted to encode a Zn²⁺-containing alcohol dehydrogenase. AdhB was found in an STM screen to be important for virulence in a lung infection model (Hava and Camilli, 2002). Also, spr1671 (SP1856) seems important for virulence based on STM screens (Hava and Camilli, 2002; Hava et al., 2003). Thus, SczA could indirectly influence S. pneumoniae virulence via adhB and spr1671.

The functionality of a putative SczA operator, predicted on the bases of sequence analysis of PczcD regions of different streptococci, was confirmed by promoter subcloning, EMSAs and DNase I footprinting. The operator appears to consist of a palindromic sequence, as well as a stretch of seven bases located just upstream of the palindrome, together making up motif 1. In addition, a second binding site for H₆-SczA was identified, that moderates expression of PczcD and is responsible for the autorepression by SczA. Binding of H₆-SczA to motif 1 was increased by Zn²⁺, whereas binding to motif 2 was decreased in the presence of Zn²⁺. This indicates that in the absence of Zn²⁺, SczA binds to motif 2, thereby tightly shutting down PczcD. However, in the presence of Zn²⁺, SczA binds to motif 1, resulting in activation of PczcD. As repression of transcription from the czcD and sczA promoters mediated by motif 2 was not relieved in the presence of Zn²⁺, the relevance of SczA binding to motif 2 remains somewhat obscure. Maybe, this interaction is only destroyed under extreme metal ion intoxication, thereby giving an extra boost to czcD expression and, as a consequence, metal ion resistance. The observation that binding of H₆-SczA to motif 1 resulted in a band of higher MW than binding of H₆-SczA to motif 2, might indicate that monomeric SczA binds to motif 2, whereas an oligomeric conformation of SczA binds to motif 1 (Fig. 9).

Zn²⁺ has a profound influence on the immune function of the human body (Milanino et al., 1993; Shankar and Prasad, 1998; Schaible and Kaufmann, 2004; Thurnham et al., 2005). Generally, low Zn²⁺ levels lead to decreased functioning of the immune system, while physiologically normal concentrations [12–16 μM in plasma (Versieck, 1985)] secure normal functioning of the immune system (Shankar and Prasad, 1998; Rink and Gabriel, 2000; Ibs and Rink, 2003). High dosages of Zn²⁺ (0.1 mM) may even activate certain cells of the immune system (Ibs and Rink, 2003). Moreover, Zn²⁺ levels in the human body are increased during inflammation (Milanino et al., 1993; Thurnham et al., 2005). Thus, it is well possible that S. pneumoniae encounters fluctuating levels of Zn²⁺ during infection of the human body. One of the strategies S. pneumoniae could employ to cope with this is by activation of the czcD system in the presence of an elevated Zn²⁺ level. Thus, Zn²⁺ might be an important signal during the complex interplay between S. pneumoniae and humans.

Experimental procedures

Bacterial strains, growth conditions, materials and general DNA techniques

Bacterial strains are listed in Table 4. Growth of bacteria and DNA manipulation techniques were performed essentially as described previously (Kloosterman et al., 2006a,b). Metals were used as the following salts: ZnSO₄, CoCl₂, NiSO₄, MgCl₂, MnCl₂, CuSO₄, FeCl₂ and FeCl₃. D39 chromosomal DNA was used as a template for PCR reactions. Primers are listed in Table 5.

Table 4. Strains and plasmids used in this study.

Strain/plasmid	Description	Reference or source
Strain
S. pneumoniae
D39	Serotype 2 strain, cps2	Avery et al. (1944), Lanie et al. (2007) lab. P. Hermans
D39nisRK	D39 ΔbgaA::nisRK; Trmp^R	Kloosterman et al. (2006a)
MP100	D39 ΔsczA; Spec^R	This work
MP101	D39nisRKΔsczA; Spec^R	This work
MP102	D39 ΔczcD	This work
MP103	D39 ΔbgaA::PczcD–lacZ; Tet^R	This work
MP105	D39 ΔbgaA::Pspr1671–lacZ; Tet^R	This work
MP106	D39 ΔbgaA::Pspr0183–lacZ; Tet^R	This work
MP107	MP100 ΔbgaA::PczcD–lacZ; Tet^R Spec^R	This work
MP109	MP100 ΔbgaA::Pspr1671–lacZ; Tet^R Spec^R	This work
MP110	MP100 ΔbgaA::Pspr0183–lacZ; Tet^R Spec^R	This work
MP111	MP102 ΔbgaA::PczcD–lacZ; Tet^R	This work
MP112	MP103 with mariner insertion in sczA Spec^R	This work
MP120	D39 ΔbgaA::PczcD-1–lacZ; Tet^R	This work
MP121	D39 ΔbgaA::PczcD-2–lacZ; Tet^R	This work
MP122	D39 ΔbgaA::PczcD-2b–lacZ; Tet^R	This work
MP123	D39 ΔbgaA::PczcD-3–lacZ; Tet^R	This work
MP124	D39 ΔbgaA::PczcD-4–lacZ; Tet^R	This work
MP125	D39 ΔbgaA::PczcD-mut1–lacZ; Tet^R	This work
MP126	D39 ΔbgaA::PczcD-mut2–lacZ; Tet^R	This work
MP127	D39 ΔbgaA::PsczA-1–lacZ; Tet^R	This work
MP128	D39 ΔbgaA::PsczA-mut1–lacZ; Tet^R	This work
MP130	MP100 ΔbgaA::PczcD-1–lacZ; Tet^R Spec^R	This work
MP131	MP100 ΔbgaA::PczcD-2–lacZ; Tet^R Spec^R	This work
MP132	MP100 ΔbgaA::PczcD-2b–lacZ; Tet^R Spec^R	This work
MP133	MP100 ΔbgaA::PczcD-3–lacZ; Tet^R Spec^R	This work
MP134	MP100 ΔbgaA::PczcD-4–lacZ; Tet^R Spec^R	This work
MP135	MP100 ΔbgaA::PczcD-mut1–lacZ; Tet^R Spec^R	This work
MP126	MP100 ΔbgaA::PczcD-mut2–lacZ; Tet^R Spec^R	This work
MP137	MP100 ΔbgaA::PsczA-1–lacZ; Tet^R Spec^R	This work
MP138	MP100 ΔbgaA::PsczA-mut1–lacZ; Tet^R Spec^R	This work
L. lactis
NZ9000	MG1363 ΔpepN::nisRK	Kuipers et al. (1998)
E. coli
EC1000	Km^R; MC1000 derivative carrying a single copy of the pWV01 repA gene in glgB	Leenhouts et al. (1996)
Plasmid
pR412-T7	SpecR; derivative of pR412 (Martin et al., 2000)	Bijlsma et al. (2007)
pORI13	Em^R; ori⁺repA^-; promoterless lacZ, for single-copy chromosomal lacZ fusions	Sanders et al. (1998)
pORI38	Spec^R; ori⁺repA^-; deletion derivative of pWV01	Leenhouts et al. (1996)
pNZ8048	Cm^R; nisin-inducible PnisA	de Ruyter et al. (1996)
pNG8048E	Cm^R Em^R; nisin-inducible PnisA, pNZ8048 derivative containing em^R gene to facilitate cloning	Laboratory collection
pORI280	Em^R; ori⁺repA^-; deletion derivative of pWV01; constitutive lacZ expression from P32 promoter	Leenhouts et al. (1996)
pPP2	Amp^R Tet^R; promoter-less lacZ. For replacement of bgaA (spr0565) with promoter–lacZ fusions. Derivative of pTP1	Halfmann et al. (2007)
pMP1	pORI280 ΔczcD	This work
pMP2	pPP2 PczcD–lacZ	This work
pMP3	pPP2 Pspr1671–lacZ	This work
pMP5	pPP2 Pspr0183–lacZ	This work
pMP6	pNG8048E carrying H₆-sczA downstream of PnisA	This work
pMP7	pPP2 PczcD-1–lacZ	This work
pMP8	pPP2 PczcD-2–lacZ	This work
pMP9	pPP2 PczcD-2b–lacZ	This work
pMP10	pPP2 PczcD-3–lacZ	This work
pMP11	pPP2 PczcD-4–lacZ	This work
pMP12	pPP2 PczcD-mut1–lacZ	This work
pMP13	pPP2 PsczA-1–lacZ	This work
pMP14	pPP2 PsczA-mut1–lacZ	This work
pMP15	pPP2 PczcD-mut2-lacZ	This work

Trmp^R, trimethoprim resistance; Spec^R, spectinomycin resistance; Em^R, erythromycin resistance; Tet^R, tetracycline resistance; Km^R, kanamycin resistance; Cm^R, chloramphenicol resistance.

Table 5. Oligonucleotide primers used in this study.

Name	Nucleotide sequence (5′ to 3′) (restriction enzyme sites underlined)	Restriction site
PczcD-1	CGGAATTCTAGATGGCTTTTTTGGTTTTGCTG	EcoRI
PczcD-2	CGGGATCCGCAGACTCAGAATAGACTCATTC	BamHI
PczcD_for1	CGGAATTCCTCGTAGCCCTTAGCATTCA	EcoRI
PczcD_for2	CGGAATTCCAAATTGTTCAGAACTGAAT	EcoRI
PczcD_2b	CGGAATTCTGTTAGTCATATGGACACTTAAGG	EcoRI
PczcD_for3	CGGAATTCGAACTGAATAAAGCTGACG	EcoRI
PczcD_for4	CGGAATTCAGCTGACGTTTTGCTTCTAT	EcoRI
PczcD_rev	CGGGATCCAACAGCATATTTTGCCTTCA	BamHI
PczcD-mut1.1	GGAGCCTTGTTCATTATCATTATCCAC	–
PczcD-mut1.2	ATAATGAACAAGGCTCCCATAAATCTATTATAACAAAGG	–
PczcD-mut2.1	GACCTAAAGCTGACGTTTTGCTTC	–
PczcD-mut2.2	CAAAACGTCAGCTTTAGGTCGTTCTGAACAATTTGCCTTAAGTG	–
czcD-KO-1	TGCTCTAGAAGGTCAATGTCTCGATAAAG	XbaI
czcD-KO-2	AGCATATTTTGCCTTCATATTTC	–
czcD-KO-3^a	ATATGAAGGCAAAATATGCTAGTTATGAGCATCAACATTAG^a	–
czcDKO-4	GAAGATCTCTGTAGCTGAGACAAGCGC	BglII
PsczA-for1	CGGGATCCCTCGTAGCCCTTAGCATTCA	BamHI
PsczA-rev	CGGAATTCAACAGCATATTTTGCCTTCA	EcoRI
Spr1673KO-1	CTAACAGATTGATAGTAATCG	–
Spr1673KO-2^b	TCCTCCTCACTATTTTGATTAGATACGGCGGTCAATGTTAGTC^b	–
Spr1673KO-3^b	CGTTTTAGCGTTTATTTCGTTTAGTTTATCTAGACCTTCTCATTCC^b	–
Spr1673KO-4	CTGGACGGCAAGGGCTGGAC	–
spr1671-1	TGCTCTAGAAAGATTTTGCATCCGCAACC	XbaI
spr1671-2.1	CGGGATCCCGGCAGATTTAATATTCACAC	BamHI
spr1671-2	CGGGATCTCGGCAGATTTAATATTCACAC	–
spr1671-3	CATGCCATGGGAGCGCTTGTCTCAGCTACA	–
spr1671-4	GAAGATCTCAAAGCCCATACGCCCTCC	–
TMr_1	TGCATTTAATACTAGCGACGCCATCTATGTGTC	–
TMr_4	GGATCCATTCGCGTCAATTCGAGGGG	–
Spec_Fp	CTAATCAAAATAGTGAGGAGG	–
Spec_Rp	ACTAAACGAAATAAACGC	–
PspaC-1	CCAGTCCAGACTATTCGG	–
PspaC-2	CAGAGGTTGTTCTGG	–
Pspr183-1.2	CGGAATTCCAACCTAAGGTGATTGTGG	EcoRI
Pspr183-2.2	CGGGATCCGAATTTCTGTAATAATTCGC	BamHI
tetR-OX-1-H6	CGAGCCATCATGACTCATCATCATCATCATCATAACATTGACCG	RcaI
tetR-OX-2	CGGGATCCTCAATTTTTAGGAATGAGAAG	BamHI

a. Overlap with czcD-KO-2 in italics.
b. Overlap with specR gene in bold.

Random mutagenesis screen using the mariner transposon

Chromosomal DNA of S. pneumoniae R6 was mutagenized with the Himar1 MarC9 transposase essentially as described (Lampe et al., 1996; Martin et al., 2000). pR412-T7 (Bijlsma et al., 2007), a derivative of pR412 (Martin et al., 2000), containing an outward-facing T7 promoter on each side of the mini-transposon, was used as the source of the 1146 bp long spec mariner mini-transposon. Mutated R6 chromosomal DNA was transformed to strain R6 to generate a mutant library of approximately 20 000 colony-forming units. Chromosomal DNA of this library was isolated and used to transform strain D39 ΔbgaA::PczcD–lacZ (MP103), and was plated on GM17 with 1% sheep blood, 0.006% Xgal, 1.5 μg ml⁻¹ tetracycline and 130 μg ml⁻¹ spectinomycin, and 0.25 mM ZnSO₄. Plates were incubated for 2 days at 37°C. Sites of transposon insertion were determined using an inverse PCR approach. In short, chromosomal DNA of mutants was digested with AvaII and self-ligated at a concentration of 0.02 μg DNA per μl. PCR was performed on this ligation mixture with primers TMr_1 and TMr_4, and the resulting PCR products were isolated from gel with the Qiagen gel-extraction kit and sequenced.

Construction of mutants

A mutant of sczA (spr1673) was made by allelic-replacement mutagenesis. In short, primers Spr1673KO-1/Spr1673KO-2 and Spr1673KO-3/Spr1673KO-4 were used to generate PCR products of the approximately 500 bp left and right flanking regions of sczA, which were, by means of overlap extension PCR (Song et al., 2005), fused to a spectinomycin-resistance gene amplified with primers Spec_Fp and Spec_Rp from plasmid pORI38. The resulting PCR product was transformed to D39 and D39nisRK, yielding strains MP100 and MP101, and the mutation was verified by PCR and sequencing.

An in-frame deletion of czcD (spr1672) was constructed using pORI280 (Leenhouts et al., 1996; Kloosterman et al., 2006a). In short, primer pairs czcD-KO-1/czcD-KO-2 and czcD-KO-3/czcD-KO-4 were used to generate approximately 600 bp PCR fragments of the left and right flanking regions of czcD, which were fused in a separate PCR reaction and cloned into the XbaI/BglII sites of pORI280 in E. coli EC1000, yielding pMP1. A czcD mutant in D39 (MP102) was obtained following the procedure described before (Kloosterman et al., 2006a), and the mutation was verified by PCR and sequencing.

Construction of lacZ fusions

Transcriptional fusions to lacZ were constructed in plasmid pPP2. Primer pairs PczcD-1/PczcD-2, spr1671-1/spr1671-2.1 and Pspr183-1.2/Pspr183-2.2 were used to generate PCR fragments spanning the sczA–czcD, czcD–spr1671 intergenic regions and the nrdD promoter respectively, and cloned in the EcoRI/BamHI, XbaI/BamHI and EcoRI/BamHI sites of pPP2, using E. coli EC1000 as a host, yielding plasmids pMP2–pMP5. Correct constructs were transformed to D39 wild-type and MP100 to generate ectopic lacZ fusions in the bgaA locus, yielding strains MP103, MP105, MP106 and MP107, MP109 and MP110 respectively. The PczcD–lacZ fusion was introduced in the czcD mutant (MP102) as well, giving strain MP111.

Subcloning and mutation of the czcD and sczA promoters

Subclones (PczcD-1, PczcD-2, PczcD-2b, PczcD-3 and PczcD-4) of the PczcD were inserted in the EcoRI/BamHI sites of the lacZ reporter plasmid pPP2, using primer pairs PczcD_for1/PczcD_rev, PczcD_for2/PczcD_rev, PczcD_2b/PczcD_rev, PczcD_for3/PczcD_rev and PczcD_for4/PczcD_rev, giving plasmids pMP7 to pMP11. Four subsequent point-mutations were introduced into motif 2 in the czcD promoter as follows. PCR products were generated on D39 chromosomal DNA with primers PczcD-mut1.1/PczcD_for-1 and PczcD-mut1.2/PczcD_rev. These PCR products overlap for 17 bases and were fused in a separate PCR reaction with the outer primers PczcD-mut1.1 and PczcD_rev. The resulting PCR product was cloned as an EcoRI/BamHI fragment into pPP2, yielding plasmid pMP12. In the same way, four subsequent point-mutations were introduced in motif 2 in the czcD promoter, using primers PczcD-mut2.1/PczcD_for-1 and PczcD-mut2.2/PczcD_rev, yielding plasmid pMP15. The cloned sequences of these plasmids were verified by DNA sequencing, and they were subsequently transformed to D39 wild-type and its isogenic sczA mutant, giving strains MP120–MP126 and MP130–MP136.

The wild-type (PsczA-1) and mutated (PsczA-mut1) sczA promoters were amplified with primers PsczA-for1 and PsczA-rev from plasmids pMP7 and pMP12 respectively, and cloned as EcoRI/BamHI fragments into pPP2. The resulting constructs were verified by DNA sequencing and introduced into strains D39 and MP100, yielding strains MP127, MP128, MP137 and MP138.

Construction of an SczA overexpression construct and purification of H₆-SczA

A his-tagged variant of sczA (H₆-sczA) was PCR amplified with primers tetR-OX-1-H6/tetR-OX-2, digested with RcaI and BamHI and cloned in the NcoI/BamHI sites of pNG8048E, using Lactococcus lactis NZ9000 as the cloning host, giving plasmid pMP6.

Overexpression in L. lactis and purification of H₆-SczA was performed essentially as described (Kloosterman et al., 2006b). H₆-SczA was eluted from the Ni-NTA (Qiagen) beads with 250 mM imidazole. The protein was checked with SDS-PAGE and stored as frozen aliquots with 10% glycerol at −80°C.

Microarray analyses

For DNA microarray analysis, D39 wild-type and its isogenic sczA mutant (MP100) were grown as four biological replicates in GM17 with 0.05 mM CoCl₂ and harvested at an OD₅₉₅ of approximately 0.3. All other procedures regarding microarray analyses were performed as described before (Kloosterman et al., 2006b). Statistical analysis was performed as described (van Hijum et al., 2005). A gene was considered differentially expressed when the Bayesian P-value < 0.001 and a false discovery rate < 0.01, and when at least five measurements were available. The raw and processed data are available at http://molgen.biol.rug.nl/publication/scza_data.

Growth experiments

Growth experiments were performed in microtiterplates in 220 μl volumes. As the inoculum, aliquots of cells frozen in the mid-exponential phase were used, washed once with the proper medium and diluted 1 to 40 for inoculation.

β-Galactosidase assays

β-Galactosidase assays were performed essentially as described (Kloosterman et al., 2006b). Strains were harvested at mid-logarithmic phase of growth. All experiments were performed at least in triplo.

SczA–DNA interaction studies

Electrophoretic mobility shift assays (EMSAs) were performed essentially as described previously (den Hengst et al., 2005). PCR products of PczcD (PczcD-1, PczcD-2, PczcD-2b, PczcD-4 and PczcD-mut1 and PczcD-mut2) were made with the primer pairs as given under ‘subcloning of PczcD’. As a negative control, a PCR fragment of the PspaC promoter was amplified with primers Pspac-1/Pspac-2 from plasmid pDG148 (Stragier et al., 1988). The binding buffer was composed of 20 mM TrisHCl, pH 8.0, 5 mM MgCl₂, 0.1 mM dithiotreitol, 8.7% (w/v) glycerol, 62.5 mM KCl, 25 μg ml⁻¹ bovine serum albumin, 50 μg ml⁻¹ poly(dI–dC) and 3000 cpm of either [γ-³²P]ATP-labelled or [γ-³³P]ATP-labelled PCR product. Purified H₆-SczA, EDTA and metal ions were added as specified in the Results section. Reactions (20 μl) were incubated for 15 min at 37°C, after which they were run on a 6% poly-acrylamide gel for 80 min at 90 V. DNase I footprinting was performed essentially as described (den Hengst et al., 2005). In total, 150 000 cpm of [γ-³³P]ATP-labelled PCR product PczcD-1, amplified either with [γ-³³P]-labelled primer PczcD-for1 (forward strand) or with [γ-³³P]-labelled primer PczcD-rev (reverse strand), was used as probe in 40 μl of binding buffer containing H₆-SczA, EDTA and Zn²⁺ as specified in the Results. Buffer and reaction conditions were the same as for the EMSAs.

Reverse transcription (RT)-PCR

Reverse transcription reactions were performed as described under Microarray analysis on total RNA isolated from S. pneumoniae D39 grown in GM17 + 0.05 mM Co²⁺, except that amino-allyl dUTP was replaced by dTTP. In parallel, reactions were performed in the same way, except that the reverse transcriptase enzyme Superscript III was omitted. These reactions were used as negative controls. PCRs were performed on 1/100 part of the RT reactions with primers as specified in the Results. As a positive control, PCRs were performed on 10 ng per reaction of chromosomal DNA of D39.

Acknowledgements

We thank Peter Burghout (UMC St Radboud, Nijmegen, the Netherlands) for the gift of chromosomal DNA mutagenized with the mariner transposon. We thank Robert Witwicki for skilful technical assistance. We thank Don Morrison (University of Illinois, Chicago, USA) for the generous gift of CSP-1. This work was supported by IOP Grant IGE3002 of the Dutch Ministry of Economic Affairs.

References

Anton, A., Grosse, C., Reissmann, J., Pribyl, T., and Nies, D.H. (1999) CzcD is a heavy metal ion transporter involved in regulation of heavy metal resistance in Ralstonia sp. strain CH34. J Bacteriol 181: 6876–6881.
10.1128/JB.181.22.6876-6881.1999
CAS PubMed Web of Science® Google Scholar
Avery, O.T., Macleod, C.M., and McCarty, M. (1944) Studies on the chemical nature of the substance inducing transformation of pneumococcal types. Induction of transformation by a desoxyribonucleic acid fraction isolated from Pneumococcus type III. Mol Med 1: 344–365.
PubMed Web of Science® Google Scholar
Baerends, R.J.S., De Smits, W.K.J.A., Hamoen, L.W., Kok, J., and Kuipers, O.P. (2004) Genome2D: a visualization tool for the rapid analysis of bacterial transcriptome data. Genome Biol 5: R37.
10.1186/gb-2004-5-5-r37
PubMed Web of Science® Google Scholar
Berry, A.M., and Paton, J.C. (1996) Sequence heterogeneity of PsaA, a 37-kilodalton putative adhesin essential for virulence of Streptococcus pneumoniae. Infect Immun 64: 5255–5262.
10.1128/iai.64.12.5255-5262.1996
CAS PubMed Web of Science® Google Scholar
Bijlsma, J.J., Burghout, P., Kloosterman, T.G., De Bootsma, H.J.J.A., Hermans, P.W., and Kuipers, O.P. (2007) Development of genomic array footprinting for identification of conditionally essential genes in Streptococcus pneumoniae. Appl Environ Microbiol 73: 1514–1524.
10.1128/AEM.01900-06
CAS PubMed Web of Science® Google Scholar
Brenot, A., Weston, B.F., and Caparon, M.G. (2007) A PerR-regulated metal transporter (PmtA) is an interface between oxidative stress and metal homeostasis in Streptococcus pyogenes. Mol Microbiol 63: 1185–1196.
10.1111/j.1365-2958.2006.05577.x
CAS PubMed Web of Science® Google Scholar
Brown, J.S., Gilliland, S.M., and Holden, D.W. (2001) A Streptococcus pneumoniae pathogenicity island encoding an ABC transporter involved in iron uptake and virulence. Mol Microbiol 40: 572–585.
10.1046/j.1365-2958.2001.02414.x
CAS PubMed Web of Science® Google Scholar
Brown, J.S., Gilliland, S.M., Ruiz-Albert, J., and Holden, D.W. (2002) Characterization of pit, a Streptococcus pneumoniae iron uptake ABC transporter. Infect Immun 70: 4389–4398.
10.1128/IAI.70.8.4389-4398.2002
CAS PubMed Web of Science® Google Scholar
Christen, S., Srinivas, A., Bahler, P., Zeller, A., Pridmore, D., Bieniossek, C., et al. (2006) Regulation of the Dha operon of Lactococcus lactis: a deviation from the rule followed by the Tetr family of transcription regulators. J Biol Chem 281: 23129–23137.
10.1074/jbc.M603486200
CAS PubMed Web of Science® Google Scholar
Croxatto, A., Chalker, V.J., Lauritz, J., Jass, J., Hardman, A., Williams, P., et al. (2002) VanT, a homologue of Vibrio harveyi LuxR, regulates serine, metalloprotease, pigment, and biofilm production in Vibrio anguillarum. J Bacteriol 184: 1617–1629.
10.1128/JB.184.6.1617-1629.2002
CAS PubMed Web of Science® Google Scholar
Dintilhac, A., and Claverys, J.P. (1997) The adc locus, which affects competence for genetic transformation in Streptococcus pneumoniae, encodes an ABC transporter with a putative lipoprotein homologous to a family of streptococcal adhesins. Res Microbiol 148: 119–131.
10.1016/S0923-2508(97)87643-7
CAS PubMed Web of Science® Google Scholar
Dintilhac, A., Alloing, G., Granadel, C., and Claverys, J.P. (1997) Competence and virulence of Streptococcus pneumoniae: Adc and PsaA mutants exhibit a requirement for Zn and Mn resulting from inactivation of putative ABC metal permeases. Mol Microbiol 25: 727–739.
10.1046/j.1365-2958.1997.5111879.x
CAS PubMed Web of Science® Google Scholar
Finney, L.A., and O'Halloran, T.V. (2003) Transition metal speciation in the cell: insights from the chemistry of metal ion receptors. Science 300: 931–936.
10.1126/science.1085049
CAS PubMed Web of Science® Google Scholar
Grosse, C., Anton, A., Hoffmann, T., Franke, S., Schleuder, G., and Nies, D.H. (2004) Identification of a regulatory pathway that controls the heavy-metal resistance system Czc via promoter czcNp in Ralstonia metallidurans. Arch Microbiol 182: 109–118.
10.1007/s00203-004-0670-8
CAS PubMed Web of Science® Google Scholar
Halfmann, A., Hakenbeck, R., and Bruckner, R. (2007) A new integrative reporter plasmid for Streptococcus pneumoniae. FEMS Microbiol Lett 268: 217–224.
10.1111/j.1574-6968.2006.00584.x
CAS PubMed Web of Science® Google Scholar
Haney, C.J., Grass, G., Franke, S., and Rensing, C. (2005) New developments in the understanding of the cation diffusion facilitator family. J Ind Microbiol Biotechnol 32: 215–226.
10.1007/s10295-005-0224-3
CAS PubMed Web of Science® Google Scholar
Hantke, K. (2001) Bacterial zinc transporters and regulators. Biometals 14: 239–249.
10.1023/A:1012984713391
CAS PubMed Web of Science® Google Scholar
Hava, D.L., and Camilli, A. (2002) Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors. Mol Microbiol 45: 1389–1406.
10.1046/j.1365-2958.2002.03106.x
CAS PubMed Web of Science® Google Scholar
Hava, D.L., LeMieux, J., and Camilli, A. (2003) From nose to lung: the regulation behind Streptococcus pneumoniae virulence factors. Mol Microbiol 50: 1103–1110.
10.1046/j.1365-2958.2003.03764.x
CAS PubMed Web of Science® Google Scholar
Den Hengst, C.D., Curley, P., Larsen, R., Buist, G., Nauta, A., Van Sinderen, D., et al. (2005) Probing direct interactions between CodY and the oppD promoter of Lactococcus lactis. J Bacteriol 187: 512–521.
10.1128/JB.187.2.512-521.2005
CAS PubMed Web of Science® Google Scholar
Van Hijum, S.A.F.T., De Jong, A., Baerends, R.J.S., Karsens, H.A., Kramer, N.E., Larsen, R., et al. (2005) A generally applicable validation scheme for the assessment of factors involved in reproducibility and quality of DNA-microarray data. BMC Genomics 6: 77.
10.1186/1471-2164-6-77
CAS PubMed Web of Science® Google Scholar
Hoskins, J., Alborn, W.E., Jr, Arnold, J., Blaszczak, L.C., Burgett, S., DeHoff, B.S., et al. (2001) Genome of the bacterium Streptococcus pneumoniae strain R6. J Bacteriol 183: 5709–5717.
10.1128/JB.183.19.5709-5717.2001
CAS PubMed Web of Science® Google Scholar
Ibs, K.H., and Rink, L. (2003) Zinc-altered immune function. J Nutr 133: 1452S–1456S.
10.1093/jn/133.5.1452S
CAS PubMed Web of Science® Google Scholar
Johnston, J.W., Myers, L.E., Ochs, M.M., Benjamin, W.H., Jr, Briles, D.E., and Hollingshead, S.K. (2004) Lipoprotein PsaA in virulence of Streptococcus pneumoniae: surface accessibility and role in protection from superoxide. Infect Immun 72: 5858–5867.
10.1128/IAI.72.10.5858-5867.2004
CAS PubMed Web of Science® Google Scholar
Johnston, J.W., Briles, D.E., Myers, L.E., and Hollingshead, S.K. (2006) Mn2+-dependent regulation of multiple genes in Streptococcus pneumoniae through PsaR and the resultant impact on virulence. Infect Immun 74: 1171–1180.
10.1128/IAI.74.2.1171-1180.2006
CAS PubMed Web of Science® Google Scholar
Kloosterman, T.G., Bijlsma, J.J.E., Kok, J., and Kuipers, O.P. (2006a) To have neighbour's fare: extending the molecular toolbox for Streptococcus pneumoniae. Microbiology 152: 351–359.
10.1099/mic.0.28521-0
CAS PubMed Web of Science® Google Scholar
Kloosterman, T.G., Hendriksen, W.T., Bijlsma, J.J., Bootsma, H.J., Van Hijum, S.A., Kok, J., et al. (2006b) Regulation of glutamine and glutamate metabolism by GlnR and GlnA in Streptococcus pneumoniae. J Biol Chem 281: 25097–25109.
10.1074/jbc.M601661200
CAS PubMed Web of Science® Google Scholar
Kuipers, O.P., Ruyter, P.G., Kleerebezem, M., and Vos, W.M. (1998) Quorum sensing controlled gene expression in lactic acid bacteria. J Biotechnol 64: 15–21.
10.1016/S0168-1656(98)00100-X
CAS Web of Science® Google Scholar
Kuroda, M., Hayashi, H., and Ohta, T. (1999) Chromosome-determined zinc-responsible operon czr in Staphylococcus aureus strain 912. Microbiol Immunol 43: 115–125.
10.1111/j.1348-0421.1999.tb02382.x
CAS PubMed Web of Science® Google Scholar
Lampe, D.J., Churchill, M.E., and Robertson, H.M. (1996) A purified mariner transposase is sufficient to mediate transposition in vitro. EMBO J 15: 5470–5479.
10.1002/j.1460-2075.1996.tb00930.x
CAS PubMed Web of Science® Google Scholar
Lanie, J.A., Ng, W.L., Kazmierczak, K.M., Andrzejewski, T.M., Davidsen, T.M., Wayne, K.J., et al. (2007) Genome sequence of Avery's virulent serotype 2 strain D39 of Streptococcus pneumoniae and comparison with that of unencapsulated laboratory strain R6. J Bacteriol 189: 38–51.
10.1128/JB.01148-06
CAS PubMed Web of Science® Google Scholar
Lawrence, M.C., Pilling, P.A., Epa, V.C., Berry, A.M., Ogunniyi, A.D., and Paton, J.C. (1998) The crystal structure of pneumococcal surface antigen PsaA reveals a metal-binding site and a novel structure for a putative ABC-type binding protein. Structure 6: 1553–1561.
10.1016/S0969-2126(98)00153-1
CAS PubMed Web of Science® Google Scholar
Leenhouts, K., Buist, G., Bolhuis, A., Ten Berge, A., Kiel, J., Mierau, I., et al. (1996) A general system for generating unlabelled gene replacements in bacterial chromosomes. Mol Gen Genet 253: 217–224.
10.1007/s004380050315
CAS PubMed Web of Science® Google Scholar
Van Der Lelie, D., Schwuchow, T., Schwidetzky, U., Wuertz, S., Baeyens, W., Mergeay, M., and Nies, D.H. (1997) Two-component regulatory system involved in transcriptional control of heavy-metal homoeostasis in Alcaligenes eutrophus. Mol Microbiol 23: 493–503.
10.1046/j.1365-2958.1997.d01-1866.x
CAS PubMed Web of Science® Google Scholar
Lin, Y.H., Miyamoto, C., and Meighen, E.A. (2000) Purification and characterization of a luxO promoter binding protein LuxT from Vibrio harveyi. Protein Expr Purif 20: 87–94.
10.1006/prep.2000.1285
CAS PubMed Web of Science® Google Scholar
McAllister, L.J., Tseng, H.J., Ogunniyi, A.D., Jennings, M.P., McEwan, A.G., and Paton, J.C. (2004) Molecular analysis of the psa permease complex of Streptococcus pneumoniae. Mol Microbiol 53: 889–901.
10.1111/j.1365-2958.2004.04164.x
CAS PubMed Web of Science® Google Scholar
McCluskey, J., Hinds, J., Husain, S., Witney, A., and Mitchell, T.J. (2004) A two-component system that controls the expression of pneumococcal surface antigen A (PsaA) and regulates virulence and resistance to oxidative stress in Streptococcus pneumoniae. Mol Microbiol 51: 1661–1675.
10.1111/j.1365-2958.2003.03917.x
CAS PubMed Web of Science® Google Scholar
Martin, B., Prudhomme, M., Alloing, G., Granadel, C., and Claverys, J.P. (2000) Cross-regulation of competence pheromone production and export in the early control of transformation in Streptococcus pneumoniae. Mol Microbiol 38: 867–878.
10.1046/j.1365-2958.2000.02187.x
CAS PubMed Web of Science® Google Scholar
Milanino, R., Marrella, M., Gasperini, R., Pasqualicchio, M., and Velo, G. (1993) Copper and zinc body levels in inflammation: an overview of the data obtained from animal and human studies. Agents Actions 39: 195–209.
10.1007/BF01998974
CAS PubMed Web of Science® Google Scholar
Moore, C.M., Gaballa, A., Hui, M., Ye, R.W., and Helmann, J.D. (2005) Genetic and physiological responses of Bacillus subtilis to metal ion stress. Mol Microbiol 57: 27–40.
10.1111/j.1365-2958.2005.04642.x
CAS PubMed Web of Science® Google Scholar
Moore, C.M., and Helmann, J.D. (2005) Metal ion homeostasis in Bacillus subtilis. Curr Opin Microbiol 8: 188–195.
10.1016/j.mib.2005.02.007
CAS PubMed Web of Science® Google Scholar
Nies, D.H. (1992) CzcR and CzcD, gene products affecting regulation of resistance to cobalt, zinc, and cadmium (czc system) in Alcaligenes eutrophus. J Bacteriol 174: 8102–8110.
10.1128/jb.174.24.8102-8110.1992
CAS PubMed Web of Science® Google Scholar
Nies, D.H. (2003) Efflux-mediated heavy metal resistance in prokaryotes. FEMS Microbiol Rev 27: 313–339.
10.1016/S0168-6445(03)00048-2
CAS PubMed Web of Science® Google Scholar
Nies, D.H., and Silver, S. (1989) Plasmid-determined inducible efflux is responsible for resistance to cadmium, zinc, and cobalt in Alcaligenes eutrophus. J Bacteriol 171: 896–900.
10.1128/jb.171.2.896-900.1989
CAS PubMed Web of Science® Google Scholar
Novakova, R., Homerova, D., Feckova, L., and Kormanec, J. (2005) Characterization of a regulatory gene essential for the production of the angucycline-like polyketide antibiotic auricin in Streptomyces aureofaciens CCM 3239. Microbiology 151: 2693–2706.
10.1099/mic.0.28019-0
CAS PubMed Web of Science® Google Scholar
Pennella, M.A., and Giedroc, D.P. (2005) Structural determinants of metal selectivity in prokaryotic metal-responsive transcriptional regulators. Biometals 18: 413–428.
10.1007/s10534-005-3716-8
CAS PubMed Web of Science® Google Scholar
Percival, S.S. (1998) Copper and immunity. Am J Clin Nutr 67: 1064S–1068S.
10.1093/ajcn/67.5.1064S
CAS PubMed Web of Science® Google Scholar
Ramos, J.L., Martinez-Bueno, M., Molina-Henares, A.J., Teran, W., Watanabe, K., Zhang, X., et al. (2005) The TetR family of transcriptional repressors. Microbiol Mol Biol Rev 69: 326–356.
10.1128/MMBR.69.2.326-356.2005
CAS PubMed Web of Science® Google Scholar
Rink, L., and Gabriel, P. (2000) Zinc and the immune system. Proc Nutr Soc 59: 541–552.
10.1017/S0029665100000781
CAS PubMed Web of Science® Google Scholar
De Ruyter, P.G., Kuipers, O.P., and De Vos, W.M. (1996) Controlled gene expression systems for Lactococcus lactis with the food-grade inducer nisin. Appl Environ Microbiol 62: 3662–3667.
10.1128/aem.62.10.3662-3667.1996
CAS PubMed Web of Science® Google Scholar
Sanders, J.W., Venema, G., Kok, J., and Leenhouts, K. (1998) Identification of a sodium chloride-regulated promoter in Lactococcus lactis by single-copy chromosomal fusion with a reporter gene. Mol Gen Genet 257: 681–685.
10.1007/s004380050697
CAS PubMed Web of Science® Google Scholar
Schaible, U.E., and Kaufmann, S.H. (2004) Iron and microbial infection. Nat Rev Microbiol 2: 946–953.
10.1038/nrmicro1046
CAS PubMed Web of Science® Google Scholar
Shankar, A.H., and Prasad, A.S. (1998) Zinc and immune function: the biological basis of altered resistance to infection. Am J Clin Nutr 68: 447S–463S.
10.1093/ajcn/68.2.447S
CAS PubMed Web of Science® Google Scholar
Singh, V.K., Xiong, A., Usgaard, T.R., Chakrabarti, S., Deora, R., Misra, T.K., and Jayaswal, R.K. (1999) ZntR is an autoregulatory protein and negatively regulates the chromosomal zinc resistance operon znt of Staphylococcus aureus. Mol Microbiol 33: 200–207.
10.1046/j.1365-2958.1999.01466.x
CAS PubMed Web of Science® Google Scholar
Song, J.H., Ko, K.S., Lee, J.Y., Baek, J.Y., Oh, W.S., Yoon, H.S., et al. (2005) Identification of essential genes in Streptococcus pneumoniae by allelic replacement mutagenesis. Mol Cells 19: 365–374.
CAS PubMed Web of Science® Google Scholar
Stragier, P., Bonamy, C., and Karmazyn-Campelli, C. (1988) Processing of a sporulation sigma factor in Bacillus subtilis: how morphological structure could control gene expression. Cell 52: 697–704.
10.1016/0092-8674(88)90407-2
CAS PubMed Web of Science® Google Scholar
Terzaghi, B.E., and Sandine, W.E. (1975) Improved medium for lactic streptococci and their bacteriophages. Appl Environ Microbiol 29: 807–813.
10.1128/AEM.29.6.807-813.1975
CAS Web of Science® Google Scholar
Tettelin, H., Nelson, K.E., Paulsen, I.T., Eisen, J.A., Read, T.D., Peterson, S., et al. (2001) Complete genome sequence of a virulent isolate of Streptococcus pneumoniae. Science 293: 498–506.
10.1126/science.1061217
CAS PubMed Web of Science® Google Scholar
Thijs, G., Marchal, K., Lescot, M., Rombauts, S., De, M.B., Rouze, P., and Moreau, Y. (2002) A Gibbs sampling method to detect overrepresented motifs in the upstream regions of coexpressed genes. J Comput Biol 9: 447–464.
10.1089/10665270252935566
CAS PubMed Web of Science® Google Scholar
Throup, J.P., Koretke, K.K., Bryant, A.P., Ingraham, K.A., Chalker, A.F., Ge, Y., et al. (2000) A genomic analysis of two-component signal transduction in Streptococcus pneumoniae. Mol Microbiol 35: 566–576.
10.1046/j.1365-2958.2000.01725.x
CAS PubMed Web of Science® Google Scholar
Thurnham, D.I., Mburu, A.S., Mwaniki, D.L., and De, W.A. (2005) Micronutrients in childhood and the influence of subclinical inflammation. Proc Nutr Soc 64: 502–509.
10.1079/PNS2005468
CAS PubMed Web of Science® Google Scholar
Tseng, H.J., McEwan, A.G., Paton, J.C., and Jennings, M.P. (2002) Virulence of Streptococcus pneumoniae: PsaA mutants are hypersensitive to oxidative stress. Infect Immun 70: 1635–1639.
10.1128/IAI.70.3.1635-1639.2002
CAS PubMed Web of Science® Google Scholar
Ulijasz, A.T., Andes, D.R., Glasner, J.D., and Weisblum, B. (2004) Regulation of iron transport in Streptococcus pneumoniae by RitR, an orphan response regulator. J Bacteriol 186: 8123–8136.
10.1128/JB.186.23.8123-8136.2004
CAS PubMed Web of Science® Google Scholar
Versieck, J. (1985) Trace elements in human body fluids and tissues. Crit Rev Clin Lab Sci 22: 97–184.
10.3109/10408368509165788
CAS PubMed Web of Science® Google Scholar
Wei, Y., and Fu, D. (2006) Binding and transport of metal ions at the dimer interface of the Escherichia coli metal transporter YiiP. J Biol Chem 281: 23492–23502.
10.1074/jbc.M602254200
CAS PubMed Web of Science® Google Scholar
Xiong, A., and Jayaswal, R.K. (1998) Molecular characterization of a chromosomal determinant conferring resistance to zinc and cobalt ions in Staphylococcus aureus. J Bacteriol 180: 4024–4029.
10.1128/JB.180.16.4024-4029.1998
CAS PubMed Web of Science® Google Scholar

Citing Literature

Volume65, Issue4

August 2007

Pages 1049-1063

The novel transcriptional regulator SczA mediates protection against Zn²⁺ stress by activation of the Zn²⁺-resistance gene czcD in Streptococcus pneumoniae

Summary

Introduction

Results

Regulation and function of czcD in S. pneumoniae