UTS2R gene polymorphisms are associated with fatty acid composition in Japanese beef cattle
Abstract
Fatty acid composition of beef adipose tissue is one of its important traits because a high proportion of monounsaturated fatty acid is related to favorable beef flavor and tenderness. In this study, we searched polymorphisms in full length coding DNA sequence of urotensin 2 recepter and investigated the effects on fatty acid composition (C14:0, C14:1, C16:0, C16:1, C18:0, C18:1, C18:2, monounsaturated fatty acid, saturated fatty acid). Eight single nucleotide polymorphisms (SNP) were identified by sequence comparison among eight animals, including five Japanese Black and three Holstein cattle. One of these SNP (c.866C>T) was predicted to cause amino acid substitutions (P289L) and the other seven synonymous SNP, including c.267C>T, were presumed to be in linkage disequilibrium. Therefore we selected two SNP (c.267C>T and c.866C>T) for further analysis. We investigated associations between these genotypes and fatty acid composition in three Japanese Black populations (n = 560, 245 and 287) and a Holstein population (n = 202). Tukey-Kramer's honestly significant difference test revealed that CC genotype in c.267C>T indicated lower C14:0 and higher C18:1 than the other genotypes in Japanese Black cattle and CC genotype in c.866C>T showed lower C16:1 than CT genotype in Holstein cattle (P < 0.05). These results suggested that these genotypes would contribute to production of high-grade meat as selection markers in beef cattle.
Introduction
Fatty acid composition of adipose tissue in beef cattle has been recognized as an important trait in the beef industry. In bovine adipose tissue, higher concentration of monounsaturated fatty acids (MUFA) in the adipocytes and lower fat-melting point are considered to contribute to favorable beef flavor and tenderness (Melton et al. 1982; Yang et al. 1999). They also would be beneficial for human health by decreasing serum concentration of low-desnity lipoprotein (LDL) cholesterols (Rudel et al. 1995; Smith et al. 2006). In ruminants, fatty acid composition is much less dependent on the diet than in non-ruminants because the majority of dietary fatty acids are chemically reduced by microorganisms within the rumen and absorbed as saturated fatty acids (SFA) (Jenkins 1993). In addition, Zembayashi et al. (1995) reported that adipose tissue of Japanese Black cattle have higher percentage of MUFA and lower fat melting points than that of other breeds. These reports suggest the importance of genetic factors in determining fatty acid composition of cattle adipose tissue. Candidate genes controlling fatty acid composition in beef cattle may be found in fat synthesis and metabolism pathways, which are under the control of multiple genes.
Some studies showed that polymorphisms found in the fat metabolism-related gene were associated with fatty acid composition in cattle. Stearoyl-CoA desaturase (SCD) is a key enzyme responsible for conversion of SFA into MUFA. In a previous study, Taniguchi et al. (2004) demonstrated that an amino acid substitution in the SCD coding sequence is associated with the percentage of MUFA in Japanese Black cattle. Hoashi et al. (2008) also revealed that a 84 bp insertion in intron 5 of the sterol regulatory element-binding protein-1 (SREBP-1) affected the MUFA proportion in Japanese Black cattle. SREBP-1 is a transcriptional factor that plays a pivotal role in energy homeostasis by promoting glycolysis, lipogenesis and adipogenesis. In addition, Abe et al. (2008, 2009) demonstrated that the genotype of fatty acid synthase (FASN) had a significant effect on the fatty acid composition of fat tissue in a Japanese Black half-sibling population. These results suggest that the fatty acid composition would be controlled by polygenetic factors.
In mammals, three members of the urotensin 2 family, including urotensin 2 (UTS2), urotensin 2 receptor (UTS2R) and urotensin 2 domain containing (UTS2D), have been identified. UTS2 is an 11 amino acid cyclic peptide originally isolated from fish spinal cords and has been studied as a hormone in the neurosecretory system (Bern et al. 1985). An orphan human G-protein-coupled receptor was identified and then confirmed to function as a UTS2 receptor (Ames et al. 1999). In humans, both UTS2 and UTS2R have been reported to affect glucose metabolism and insulin resistance. Ong et al. (2006) reported that the GGT haplotype in UTS2 was associated with higher plasma level of insulin and the AC haplotype in UTS2R was associated with higher plasma glucose in a Hong Kong Chinese population. Clozel et al. (2006) also reported that long-term treatment of streptozotocin-induced diabetic rats with palosuran, which is a UTS2R antagonist, improved survival, increased insulin and slowed the increase in serum lipids. In addition, Forouhi et al. (1999) indicated that muscle lipid was significantly correlated with insulin sensitivity (P = 0.016) in a European population. These results suggest that the UTS2R gene plays an important role in insulin resistance and regulates muscle fat accumulation and fatty acid metabolism.
The objective of the present study is to develop additional selection markers for improvement of fatty acid composition in Japanese beef cattle. For this purpose, we sequenced the UTS2R gene to identify polymorphism and investigate the effect on fatty acid composition.
Materials and Methods
Animals and fatty acid analysis
In this study, we used four cattle groups, three Japanese Black cattle populations (JB1, JB2 and JB3) and a Holstein cattle population (H1), to evaluate the association between the genotype of the UTS2R gene and carcass traits. JB1 comprised the field cattle population produced in Miyazaki prefecture, Japan from April 2006 to October 2007, including a total of 560 cattle (506 steers and 54 heifers). JB2 comprised the field cattle population produced in Yamagata prefecture, Japan from November 2006 to August 2008, including a total of 245 cattle (71 steers and 174 heifers). JB3 comprised the cattle population fattened all over Japan for field progeny testing from 2002 to 2008, carried out by the Wagyu Registry Association, including a total of 287 cattle (178 steers and 109 heifers). H1 comprised the field cattle population produced in Tottori prefecture, Japan from September 2008 to February 2009, including a total of 202 steers. On a fattening farm, a group of animals (usually a few to several) are managed together in a barn. They are allowed restricted access to roughage and ad libitum to concentrate, which consists of corn, barley, wheat bran and so on. The average age at slaughter in JB1, JB2, JB3 and H1 were 29.10 ± 1.62, 31.54 ± 1.44, 28.54 ± 1.34 and 20.50 ± 0.59 months old, respectively.
Carcass traits including carcass weight (kg), rib eye area (cm2), rib thickness (cm), subcutaneous fat thickness (cm), yield estimate (%) and beef marbling standard (BMS) were measured by official graders of the Japan Meat Grading Association. Musculaus trapezius muscles were obtained for genomic DNA extraction and genotyping. Adipose tissues were collected from perirenal fat (JB1 and JB2), intramuscular fat of the longissimus muscle (JB3) and intramuscular fat of thoracic diaphragm (H1) to measure fatty acid composition. All tissue samples were stored at –20°C prior to DNA extraction or fatty acid purification.
Genomic DNA extraction was carried out using Wizard® Genomic DNA Purification Kit (Promega, Madison, WI, USA) according to the manufacturer's instructions. The measurements of fatty acid profile were carried out according to a previous study described by Hoashi et al. (2008). Analyzed fatty acid methyl esters were C14:0, C14:1, C16:0, C16:1, C17:0, C17:1, C18:0, C18:1 and C18:2 and the composition of each fatty acid was expressed as a percentage. (Table 1)
| JB1 (n = 560) | JB2 (n = 245) | JB3 (n = 287) | H1 (n = 202) | |||||
|---|---|---|---|---|---|---|---|---|
| Mean | SD | Mean | SD | Mean | SD | Mean | SD | |
| Carcass traits | ||||||||
| Dressed carcass weight (kg) | 432.06 | 46.91 | 453.12 | 56.53 | 442.01 | 56.91 | 460.50 | 34.95 |
| Rib-eye area (cm2) | 55.44 | 7.32 | 58.22 | 8.38 | 55.68 | 8.28 | 43.56 | 5.22 |
| Rib thickness (cm) | 7.46 | 0.80 | 8.03 | 0.92 | 7.71 | 0.92 | 6.03 | 0.63 |
| Subcutaneous fat thickness (cm) | 2.38 | 0.70 | 2.84 | 0.75 | 2.95 | 0.77 | 2.17 | 0.59 |
| Yield estimate (%) | 74.08 | 1.26 | – | – | 73.63 | 1.46 | 69.38 | 0.98 |
| Beef marbling standard | 6.07 | 1.98 | 7.30 | 2.16 | 6.22 | 2.20 | 2.26 | 0.52 |
| Fatty acid composition (%) | ||||||||
| C14:0 | 2.64 | 0.65 | 2.59 | 0.47 | 2.51 | 0.63 | 2.42 | 0.45 |
| C14:1 | 0.89 | 0.35 | 1.80 | 0.47 | 0.80 | 0.33 | 0.59 | 0.17 |
| C16:0 | 24.35 | 3.28 | 22.53 | 1.68 | 26.34 | 2.49 | 24.41 | 2.55 |
| C16:1 | 2.75 | 0.71 | 8.69 | 1.35 | 3.60 | 0.86 | 2.47 | 0.44 |
| C17:0 | – | – | – | – | – | – | 0.96 | 0.37 |
| C17:1 | – | – | – | – | – | – | 0.87 | 0.46 |
| C18:0 | 19.43 | 3.45 | 6.23 | 0.92 | 11.98 | 2.12 | 16.45 | 2.11 |
| C18:1 | 48.00 | 5.20 | 53.01 | 2.46 | 52.62 | 3.34 | 48.29 | 3.03 |
| C18:2 | 1.95 | 0.47 | 2.14 | 0.39 | 2.14 | 0.53 | 3.39 | 0.79 |
| MUFA | 51.63 | 5.41 | 63.50 | 2.20 | 57.03 | 3.33 | 52.22 | 3.13 |
| SFA | 46.42 | 5.47 | 31.34 | 2.25 | 40.83 | 3.42 | 44.32 | 3.24 |
- MUFA, monounsaturated fatty acid; SD, standard deviation; SFA, saturated fatty acid.
DNA polymorphism identification
To detect polymorphisms, a part of promoter region and full-length coding DNA sequence (CDS) in the UTS2R gene were sequenced using genomic DNA from five Japanese Black and three Holstein cattle. Primer sets for the PCR amplification and sequencing analysis were designed based on bovine genome sequence (Btau_4.6.1) [NC_007317] and bovine UTS2R messenger RNA (mRNA) sequence [NM_001040484]. The primer information is listed in Table 2. After purification of PCR product using a GENCLEAN® II KIT (MP Biomedicals, Santa Ana, CA, USA), standard double-stranded DNA cycle sequencing was performed with approximately 20 ng of amplified product using BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) on ABI PRISM® 3100 Genetic Analyzer (Applied Biosystems).
| Sequence (5′ to 3′) | Region | Amplicon size (bp) | Annealing temp. (°C) | Usage |
|---|---|---|---|---|
|
FW: AGCAGCACTAGTCACCATCACC RV: TGCTTCCCTTCGCCCTCTGCACT |
promoter | 741 | 62 | Sequencing |
|
FW: TGGCCCAGGGTGAGAATGCTAC RV: GCCGAGAGCACCACCCCGAT |
Exon 1 | 521 | 62 | Sequencing |
|
FW: AAGCCCAGTGTGAGGTGGCAGA RV: GCCCCACGATGCTGGTCCCGAA |
Exon 1 | 690 | 67 | Sequencing |
|
FW:CGTTCCAAGGGCTATCGTAAGGTC RV: ACGCTCAGACGCAGAGACTCCC |
Exon 1 | 679 | 67 | Sequencing |
|
FW: CTACCGCCAACGCTCGCTCCAC RV: AGCTCAGCGTTTATTGTTCCAGGT |
Exon 1 | 659 | 62 | Sequencing |
|
FW: CCTCTTATGGCCTCTTGGGA RV: AGGGTGAAGATGCTGGCGTG |
Exon 1 | 576 | 67 |
Genotyping 267C/T |
|
FW: CCTACCTGACGCTGCTCTTC RV: TGCTGGCTGCTGGAGGTCAC |
Exon 1 | 472 | 67 |
Genotyping 866C/T |
Genotyping
We applied PCR-RFLP (restriction fragment length polymorphism) methods to genotype two nucleotide substitutions in the bovine UTS2R gene. Two PCR primer sets were designed for DNA fragments flanking c.267C>T and c.866C>T in the UTS2R gene (Table 2). The PCR amplification was performed with 20 ng of genomic DNA and TaKaRaEx TaqTM polymerase (TaKaRa, Kyoto, Japan). Amplification was performed with a thermal cycler, GeneAmp PCR System 9700 (Applied Biosystems), with the following thermo-cycling protocol: initial denaturation at 94°C for 2 min, followed by 30 cycles of 94°C for 30 s, 67°C for 30 s and 72°C for 1 min, with a final extension step, 72°C for 7 min. The fragments flanking c.267C>T and c.866C>T were digestible with Hpy166II and TspRI, respectively. The digestions were performed in a total of 20 μL volume reaction mixture with approximately 5 μg of PCR products and three units of each restriction enzyme. The reaction was incubated at the proper temperature for each restriction enzyme. The digested PCR products were confirmed with undigested products and sequenced homozygous and heterozygous samples by agarose gel electrophoresis.
Statistical analysis
Significant effects of all factors in each trait were statistically tested by analysis of variance (ANOVA) with a model that accounted for age of slaughter, sire, sex and genotypes without interaction. Factors detected significant effects by ANOVA were further tested by Tukey's honestly significant difference (HSD) test.
Results and Discussion
Polymorphism identification and genotyping
We sequenced a part of the promoter region (AAFC03013715.1: g.2555–3295, 741bp) and the full length of coding sequence (1155bp) for UTS2R genes from genomic DNA of eight animals, including five Japanese Black cattle and three Holstein cattle. Sequence comparison among the eight animals revealed no polymorphisms in the promoter region and eight substitutions (NM_001040484: 207bpT/C, 267bpC/T, 354bpT/C, 510bpG/A, 591bpT/C, 603bpA/G, 866bpC/T and 993bpG/A, with the translation initiation site assigned as + 1) in the coding region (Table 3). One of them was predicted to cause amino acid substitutions, proline to leucine at 866bpC/T (P289L). Genotype comparison among eight animals indicated that the other seven synonymous substitutions form only two haplotypes and therefore one of them (267bpC/T) was selected for further analysis. We genotyped two polymorphisms (267bpC/T and 866bpC/T) in three Japanese Black cattle (JB1, JB2 and JB3) and one Holstein cattle population (H1). In 267bpC/T, the allele C frequencies were 0.89 (JB1), 0.58 (JB2), 0.59 (JB3) and 0.22 (H1). In 866bpC/T, the polymorphism was not observed in JB and the major allele (C) frequency was 0.87 in H1.
| SNP | AA | Genotype | |||||||
|---|---|---|---|---|---|---|---|---|---|
| JB 01 | JB 02 | JB 03 | JB 04 | JB 05 | Hol 01 | Hol 02 | Hol 03 | ||
| 207T/C | N69 | C/C | T/C | T/T | T/C | T/C | C/C | T/C | C/C |
| 267C/T | Y89 | T/T | C/T | C/C | C/T | C/T | T/T | C/T | T/T |
| 354T/C | F118 | C/C | T/C | T/T | T/C | T/C | C/C | T/C | C/C |
| 510G/A | A170 | A/A | G/A | G/G | G/A | G/A | A/A | G/A | A/A |
| 591T/C | S197 | C/C | T/C | T/T | T/C | T/C | C/C | T/C | C/C |
| 603A/G | P201 | G/G | A/G | A/A | A/G | A/G | G/G | A/G | G/G |
| 866C/T | P289L | C/C | C/C | C/C | C/C | C/C | C/T | C/C | C/T |
| 993G/A | S331 | A/A | G/A | G/G | G/A | G/A | A/A | G/A | A/A |
- AA, amino acid substitution; Hol, Holstein cattle; JB, Japanse Black cattle.
There are few studies on the bovine UTS2R gene; however, Jiang et al. (2008) reported the association between the gene polymorphisms and fatty acid composition using Japanese Black cattle × Limousin family. In this study, they identified eight polymorphisms within the coding region of the gene (207bpT/C, 267bpC/T, 354bpT/C, 510bpG/A, 591bpT/C, 603bpA/G, 993bpG/A and 1020C/T). In the current study, most of these polymorphisms with the exception of 1020C/T were also identified in our population. In agreement with our results, they also indicated that these polymorphisms have formed just two haplotypes. These result suggested that these polymorphisms would be in linkage disequiliblium in cattle.
Effect of UTS2R polymorphisms on the characteristics of carcasses and fatty acid composition
Effects of two polymorphisms of UTS2R on phenotypic traits (fatty acid composition and carcass traits listed in Table 1) were investigated by ANOVA (Table 4). In Japanese Black cattle population, 267C/T had a significant effect on the percentage of C14:0, C16:0, C18:1, C18:2, MUFA and SFA in JB1, C14:0, C14:1, C16:1 and C18:1 in JB2, C14:0, C14:1, C16:0, C16:1, C18:1, MUFA and SFA in JB3 at a significance level of P < 0.05. In the Holstein cattle population, 866bpC/T had a significant effect on the percentage of C14:0 (P < 0.05), C14:1 (P < 0.01), C16:1 (P < 0.001), C17:1 (P < 0.05) and C18:0 (P < 0.05) while no significant association was observed with 267bpC/T. These two substitutions did not show significant effect on any carcass traits analyzed in this study.
| JB1 (n = 560) | JB2 (n = 245) | JB3 (n = 287) | H1 (n = 202) | ||
|---|---|---|---|---|---|
| 267C/T | 267C/T | 267C/T | 267C/T | 866C/T | |
| Carcass traits | |||||
| Dressed carcass weight (kg) | NS | NS | NS | NS | NS |
| Rib-eye area (cm2) | NS | NS | NS | NS | NS |
| Rib thickness (cm) | NS | NS | NS | NS | NS |
| Subcutaneous fat thickness (cm) | NS | NS | NS | NS | NS |
| Yield estimate (%) | NS | – | NS | NS | NS |
| Beef marbling standard | NS | NS | NS | NS | NS |
| Fatty acid composition (%) | |||||
| C14:0 | 0.0007*** | <0.0001**** | <0.0001**** | NS | 0.0174* |
| C14:1 | NS | 0.0014** | 0.0037** | NS | 0.0018** |
| C16:0 | 0.0403* | NS | 0.0078** | NS | NS |
| C16:1 | NS | 0.0003*** | 0.0004*** | NS | 0.0003*** |
| C17:0 | – | – | – | NS | NS |
| C17:1 | – | – | – | NS | 0.0124* |
| C18:0 | NS | NS | NS | NS | 0.0160* |
| C18:1 | 0.0138* | 0.0098** | <0.0001**** | NS | NS |
| C18:2 | 0.0152* | NS | NS | NS | NS |
| MUFA | 0.0212* | NS | 0.0084** | NS | NS |
| SFA | 0.0116* | NS | 0.0055** | NS | NS |
- *P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. MUFA, monounsaturated fatty acid; NS, non-significance; SD, standard deviation; SFA, saturated fatty acid.
Tukey-Kramer's HSD test was conducted to investigate the detailed effects of 267C/T and 866bpC/T on fatty acid composition. Table 5 (267C/T in Japanese Black cattle) and Table 6 (866bpC/T in Holstein cattle) present the means of each fatty acid and index proportion among genotypes. 267C/T showed a significant effect on C14:0 and C18:1 in all three JB populations. In these two traits, additional effects among genotypes were observed; animals with C allele exhibited a lower percentage of C14:0, but higher percentage of C18:1 than those with T allele. Additionally, some of the effects were not significant but a similar tendency was observed in the other traits, for instance animals with C allele exhibited a higher percentage of MUFA and a lower percentage of SFA than those with T allele. This result was consistent with a previous report by Jiang et al. (2008). They also indicated that the 267C/T single nucleotide polymorphism (SNP: numbered as c.6506C>T in their study) in the same gene had significant effects on SFA and MUFA.
| JB1 (n = 560) | JB2 (n = 245) | JB3 (n = 287) | |||||||
|---|---|---|---|---|---|---|---|---|---|
| C/C | C/T | T/T | C/C | C/T | T/T | C/C | C/T | T/T | |
| n = 439 | n = 113 | n = 8 | n = 83 | n = 119 | n = 43 | n = 110 | n = 121 | n = 56 | |
| C14:0 | 2.41a ± 0.07 | 2.65b ± 0.08 | – | 2.49a ± 0.05 | 2.66b ± 0.04 | 2.87c ± 0.07 | 2.35a ± 0.04 | 2.54b ± 0.04 | 2.74c ± 0.06 |
| C14:1 | 0.85 ± 0.04 | 0.86 ± 0.04 | – | 1.68a ± 0.05 | 1.86b ± 0.04 | 1.96b ± 0.07 | 0.75a ± 0.03 | 0.81a,b ± 0.02 | 0.90b ± 0.04 |
| C16:0 | 23.62a ± 0.33 | 24.33b ± 0.38 | – | 22.68 ± 0.20 | 22.79 ± 0.17 | 22.93 ± 0.27 | 25.94a ± 0.19 | 26.34a,b ± 0.18 | 26.93b ± 0.26 |
| C16:1 | 2.63 ± 0.08 | 2.66 ± 0.09 | – | 8.28a ± 0.14 | 8.58a ± 0.12 | 9.20b ± 0.19 | 3.46a ± 0.07 | 3.68b ± 0.06 | 3.89b ± 0.09 |
| C18:0 | 19.66 ± 0.36 | 20.11 ± 0.42 | – | 6.41 ± 0.10 | 6.30 ± 0.08 | 6.27 ± 0.13 | 11.77 ± 0.18 | 11.88 ± 0.17 | 12.08 ± 0.25 |
| C18:1 | 48.79a ± 0.51 | 47.47b ± 0.59 | – | 53.26a ± 0.28 | 52.59a,b ± 0.24 | 51.84b ± 0.38 | 53.57a ± 0.28 | 52.55b ± 0.27 | 51.44b ± 0.39 |
| C18:2 | 2.04a ± 0.05 | 1.91b ± 0.06 | – | 2.14 ± 0.05 | 2.11 ± 0.04 | 2.03 ± 0.06 | 2.15 ± 0.05 | 2.19 ± 0.05 | 2.02 ± 0.07 |
| MUFA | 52.27a ± 0.53 | 51.00b ± 0.61 | – | 63.22 ± 0.25 | 63.0 ± 0.21 | 63.01 ± 0.34 | 57.79a ± 0.30 | 57.04a,b ± 0.29 | 56.23b ± 0.42 |
| SFA | 45.69a ± 0.53 | 47.09b ± 0.61 | – | 31.58 ± 0.26 | 31.76 ± 0.22 | 32.07 ± 0.35 | 40.06a ± 0.31 | 40.77a,b ± 0.29 | 41.75b ± 0.43 |
- a,b,cMeans with different superscripts within same trait and gene differ significantly at P < 0.05 (Tukey's HSD analysis). MUFA, monounsaturated fatty acid; SFA, saturated fatty acid. Values are expressed by least squares estimates.
| UTS2R 866C/T | |||
|---|---|---|---|
| C/C | C/T | T/T | |
| n = 152 | n = 49 | n = 1 | |
| C14:0 | 2.37a ± 0.04 | 2.55b ± 0.07 | |
| C14:1 | 0.57a ± 0.01 | 0.66b ± 0.02 | |
| C16:0 | 24.30 ± 0.22 | 24.72 ± 0.38 | |
| C16:1 | 2.41a ± 0.04 | 2.67b ± 0.06 | |
| C17:0 | 0.94 ± 0.03 | 1.04 ± 0.06 | |
| C17:1 | 0.82a ± 0.04 | 1.02b ± 0.07 | |
| C18:0 | 16.66a ± 0.18 | 15.80b ± 0.31 | |
| C18:1 | 48.39 ± 0.26 | 47.85 ± 0.45 | |
| C18:2 | 3.39 ± 0.07 | 3.46 ± 0.12 | |
| MUFA | 52.20 ± 0.27 | 52.20 ± 0.47 | |
| SFA | 44.35 ± 0.28 | 44.22 ± 0.48 | |
- a,bMeans with different superscripts within same trait and gene differ significantly at P < 0.05 (Tukey's HSD analysis). MUFA, monounsaturated fatty acid; SFA, saturated fatty acid. Values are expressed by least squares estimates.
Since these seven synonymous substitutions, including 267C/T SNP, are not predicted to cause amino acid replacement, it is unclear how they impact on the function of UTS2R. In a previous study, Jiang et al. (2008) predicted that 13 SNPs, including five SNPs identified in 3'UTR regions, do cause mRNA secondary structure changes and may affect the mRNA stability in the UTS2R gene. However, allele effects on fatty acid composition were opposite from our results; C allele in 267C/T SNP showed the higher percentage of MUFA than T allele in the current study but lower in the previous study. These results suggested that these SNPs would be in linkage diseqilibrium with a responsible mutation for fatty acid composition and the chromosome recombination occurred between the mutation and 267C/T SNP in Japanese Black cattle × Limousin family used in the previous study.
Recently some studies have been reported that microRNAs (miRNAs), which negatively regulate target mRNA by binding in their 3'UTR, play important roles in adipogenesis and regulate fatty acid metabolism. Esau et al. (2006) showed that the liver-specific miR-122 inhibition in normal mice resulted in increased hepatic fatty acid oxidation and a decrease in hepatic fatty acid and cholesterol synthesis rates. Peng et al. (2013) also indicated that miR-224-5p could regulate fatty acid metabolism by binding in the 3'UTR of Acyl coenzyme A synthetase long-chain family member 4 gene. These results suggested that there would be a responsible mutation for fatty acid composition in the 3'UTR of the UTS2R gene. Therefore, further study on uninvestigated regions, including 3'UTR, will be needed to elucidate the effect of UTS2R gene mutations on beef fatty acid composition.
Analyzed by Tukey-Kramer's HSD test in Holstein cattle, a novel SNP 866bpC/T showed a significant association with C14:0, C14:1, C16:1, C17:1 and C18:0 as well as ANOVA (Table 6). Since the SNP was predicted to cause amino acid substitutions, this change might impact on the function of UTS2R by affecting protein conformation and substrate specificity. Therefore, we suggested that the SNP could be used as a selective marker to improve fatty acid composition in Holstein cattle. In order to confirm the SNP effect, it would be effective to increase the number of samples or use other cattle populations that include adequate frequency of allele T in future investigations.
In conclusion, we revealed the effect of UTS2R gene polymorphisms on fatty acid composition using two different breeds. In particular, 267C/T SNP showed strong associations with multiple fatty acids, which was commonly observed in all three Japanese Black populations. These results suggested that UTS2R would play an important role in fatty acid composition and the SNPs identified in the current study would be useful markers to improve fatty acid composition in cattle.
