ORIGINAL ARTICLE

Full Access

The alleviative effects of taurine supplementation on growth, antioxidant enzyme activities, hepatopancreas morphology and mRNA expression of heat shock proteins in freshwater prawn Macrobrachium nipponense (De Haan) exposed to dietary lead stress

Corresponding Author

Zhili Ding

[email protected]

orcid.org/0000-0002-7161-5649

Zhejiang Provincial Key Laboratory of Aquatic Resources Conservation and Development, College of Life Science, Huzhou University, Huzhou, China

Correspondence

Zhili Ding, Zhejiang Provincial Key Laboratory of Aquatic Resources Conservation and Development, College of Life Science, Huzhou University, Huzhou, Zhejiang 313000, China.

Email: [email protected]

Search for more papers by this author

Youqin Kong,

Youqin Kong

orcid.org/0000-0003-2221-8492

Zhejiang Provincial Key Laboratory of Aquatic Resources Conservation and Development, College of Life Science, Huzhou University, Huzhou, China

Search for more papers by this author

Changle Qi,

Changle Qi

Zhejiang Provincial Key Laboratory of Aquatic Resources Conservation and Development, College of Life Science, Huzhou University, Huzhou, China

Search for more papers by this author

Yan Liu,

Yan Liu

Zhejiang Provincial Key Laboratory of Aquatic Resources Conservation and Development, College of Life Science, Huzhou University, Huzhou, China

Search for more papers by this author

Yixiang Zhang,

Yixiang Zhang

Zhejiang Provincial Key Laboratory of Aquatic Resources Conservation and Development, College of Life Science, Huzhou University, Huzhou, China

Search for more papers by this author

Jinyun Ye,

Jinyun Ye

Zhejiang Provincial Key Laboratory of Aquatic Resources Conservation and Development, College of Life Science, Huzhou University, Huzhou, China

Search for more papers by this author

Zhili Ding,

Corresponding Author

Zhili Ding

[email protected]

orcid.org/0000-0002-7161-5649

Zhejiang Provincial Key Laboratory of Aquatic Resources Conservation and Development, College of Life Science, Huzhou University, Huzhou, China

Correspondence

Zhili Ding, Zhejiang Provincial Key Laboratory of Aquatic Resources Conservation and Development, College of Life Science, Huzhou University, Huzhou, Zhejiang 313000, China.

Email: [email protected]

Search for more papers by this author

Youqin Kong,

Youqin Kong

orcid.org/0000-0003-2221-8492

Zhejiang Provincial Key Laboratory of Aquatic Resources Conservation and Development, College of Life Science, Huzhou University, Huzhou, China

Search for more papers by this author

Changle Qi,

Changle Qi

Zhejiang Provincial Key Laboratory of Aquatic Resources Conservation and Development, College of Life Science, Huzhou University, Huzhou, China

Search for more papers by this author

Yan Liu,

Yan Liu

Zhejiang Provincial Key Laboratory of Aquatic Resources Conservation and Development, College of Life Science, Huzhou University, Huzhou, China

Search for more papers by this author

Yixiang Zhang,

Yixiang Zhang

Zhejiang Provincial Key Laboratory of Aquatic Resources Conservation and Development, College of Life Science, Huzhou University, Huzhou, China

Search for more papers by this author

Jinyun Ye,

Jinyun Ye

Zhejiang Provincial Key Laboratory of Aquatic Resources Conservation and Development, College of Life Science, Huzhou University, Huzhou, China

Search for more papers by this author

First published: 20 September 2021

https://doi.org/10.1111/anu.13354

Citations: 6

Funding information

This research was supported by Zhejiang Province Public Welfare Technology Application Research Project (CN; No. LGN21C190003, LGN21C190004), the Natural Science Foundation of Huzhou (No. 2019YZ04), and the Major Scientific, Technological Special Project of Zhejiang, China (No. 2014C02011).

Share a link

Email
Wechat
Bluesky

Abstract

To investigate the potential alleviative effect of taurine supplementation on growth and oxidant stress in freshwater prawn Macrobrachium nipponense (De Haan) exposed to dietary lead, pelleted feeds were prepared with two concentrations of lead (0 and 10 mg/kg diet) and two levels of taurine (0 and 15 g/kg diet). Healthy prawns were randomly distributed between the four treatment groups, with three tanks per group and 50 prawns per tank. Dietary lead decreased weight gain and the activities of superoxide dismutase, catalase and glutathione peroxidase; increased malondialdehyde content; altered hepatopancreas morphology; and decreased the expression of heat shock protein 90 (HSP90; p < .05). A significant interactive effect was found between dietary lead and taurine on the malondialdehyde level, and taurine supplementation significantly decreased the malondialdehyde level under lead stress (p < .05). No significant effect on growth, hepatopancreas morphology and HSP90 expression was observed with taurine supplementation under lead stress. Overall, dietary lead affected growth, induced oxidative stress and impaired hepatopancreas morphology of the prawns, and dietary taurine significantly alleviated oxidative stress through a decreased malondialdehyde level, whereas the capacity of taurine to alleviate the decreased growth rate, hepatopancreas damage and low HSP90 expression under lead stress was limited.

1 INTRODUCTION

With rapid development and modern industrialization, large quantities of various metals are introduced into the environment, including aquatic ecosystems (Lapanje et al., 2010). Metal ions are not biodegradable, and they can infiltrate into the food chain resulting in biomagnification of these toxic substances (Hu et al., 2014). Lead is one of the most dangerous metals to humans and other life forms owing to its persistent accumulation and high toxicity (Rubio & Hardisson, 1999). In mammals, lead causes adverse effects on the central and peripheral nervous systems, hematopoietic system, cardiovascular system, kidneys, reproductive organs and the antioxidant defence system (Pal et al., 2015).

In aquatic ecosystems, exposure to lead in the water or dietary lead can disrupt the physiology and biochemistry of aquatic organisms. Studies of the physiological responses to lead exposure in such organisms have reported lowered antioxidant capacity in the sea cucumber Apostichopus japonicus (Wang et al., 2015), altered haematological parameters in juvenile rockfish Sebastes schlegelii (Kim & Kang, 2015) and the generation of reactive oxygen species (ROS) and induced oxidative stress in fish (Sevcikova et al., 2011). Moreover, besides antioxidant defence system scavenging ROS, chaperone molecules are also involved in this process. Heat shock proteins (HSPs), as molecular chaperones, play a crucial role in maintaining protein homeostasis under sublethal stress conditions (Hofmann et al., 2002) and can be sensitive molecular biomarkers for aquatic monitoring of heavy metal pollution (Kim et al., 2014).

Interestingly, many studies have proved that proper nutritional supplementation can alleviate multiple stressors imposed by the environment, including heavy metals pollution (Hashish and Elgaml, 2015; Mezzomo et al., 2019; Ramos et al., 2018; Yu et al., 2016;). Taurine, as found in most animal tissues, is a sulphur-containing β-amino acid (Ripps & Shen, 2012). Taurine plays a role in regulating various physiological functions, including bile acid conjugation, cellular osmoregulation, anti-inflammation, anti-apoptosis, neuromodulation and immunity, as well as in antioxidative defence (Mezzomo et al., 2020; Salze & Davis, 2015). Research with higher animals demonstrated that the administration of taurine could reduce inflammation and oxidative stress in the lungs of adult mice, as induced by short-term exposure to cigarette smoke (Ramos et al., 2018); that dietary taurine had a protective effect in piglets with diquat-induced oxidative stress (Wen et al., 2019); and that taurine supplementation alleviated the negative effects of heat stress in laying quails (Orhan et al., 2020). In aquatic animals, exogenous taurine could mitigate the adverse effect of ammonia poisoning as manifested in physiological disorders in juveniles of yellow catfish Tachysurus fulvidraco (Zhang et al., 2018), and pretreatment with taurine could prevent stress-induced behavioural and biochemical changes in zebrafish (Mezzomo et al., 2019).

The freshwater prawn Macrobrachium nipponense (De Haan, 1849) is an economically and nutritionally important aquaculture species widely distributed in China, Japan and Southeast Asian countries (Yang et al., 2004). Our previous study showed that chronic exposure to lead can impair growth, bioaccumulate in muscle, damage intestinal morphology and induce oxidant stress or neurotoxicity-related effects in this species (Ding et al., 2019). Based on the alleviating effects of taurine to various stressors, we hypothesized that dietary taurine can protect against lead exposure in M. nipponense. Therefore, this study aimed to evaluate the alleviative effects of taurine supplementation on growth, antioxidant enzyme activities, hepatopancreas morphology and mRNA expression of HSPs in M. nipponense exposed to dietary lead stress.

2 MATERIALS AND METHODS

2.1 Diet preparation

Two concentrations (0 and 10 mg/kg diet) of lead (Pb) in the form of lead acetate (CAS 6080–56–4, 99.5% purity) and two taurine levels (0 and 15 g/kg diet) were added to the experimental basal diet. Four experimental diets were formulated (Pb0Tau0, Pb0Tau15, Pb10Tau0 and Pb10Tau15), and the proximate analysis of the diets is listed in Table 1. The hygienic standard for feeds in China (GB 13078–2017, 2017) stipulates that the lead limit in artificial feeds is 5 mg/kg, and therefore, we selected a level double this concentration as representative of lead stress in freshwater prawns. Our choice of taurine inclusion level referred to research on taurine supplementation in juveniles of Chinese mitten crab Eriocheir sinensis (Chen et al., 2018).

TABLE 1. Ingredients and nutrient composition of the experimental diets (air dry matter, g/kg)

Ingredients	Pb0	Pb0Tau15	Pb10	Pb10Tau15
Casein (82.57% crude protein)	380	380	380	380
Fish meal (70% crude protein)	100	100	100	100
Corn starch	250	250	250	250
Fish oil	40	40	40	40
Soybean oil	20	20	20	20
Lead acetate (mg/kg diet)	0	0	18.3	18.3
Taurine	0	15	0	15
Vitamin mix^a	20	20	20	20
Mineral mix^b	30	30	30	30
Lecithin	5	5	5	5
Cholesterol	5	5	5	5
Choline chloride	5	5	5	5
Cellulose	125	110	125	110
Sodium carboxymethylcellulose	20	20	20	20
Proximate composition (g/kg)
Crude protein	381.1	387.2	380.7	388.3
Crude lipid	80.5	81.2	79.3	82.2

^a Vitamin mixture (100 g⁻¹ mixture): vitamin A, 420000 IU; vitamin C, 6000 mg; α-tocopherol acetate, 2000 mg; vitamin D3, 120000 IU; vitamin K, 1000 mg; vitamin B1, 1000 mg; vitamin B2, 1000 mg; vitamin B6, 1600 mg; vitamin B12, 2 mg; niacin, 5000 mg; folic acid, 400 mg; inositol, 6000 mg; biotin, 10 mg; calcium pantothenic, 3500 mg.
^b Mineral mixture (mg g⁻¹ mixture): KCL, 28; MgSO₄·7H₂O, 100; NaH₂PO₄, 215; KH₂PO₄ 100; Ca(H₂PO₄)₂·H₂O, 265; CaCO₃, 105; C₆H₁₀CaO₆·5H₂O, 165; FeC₆H₅O₇·5H₂O, 12; ZnSO₄·7H₂O, 4.76; MnSO₄·H₂O, 1.07; AlCL₃·6H₂O, 0.15; CuCl₂·2H₂O, 0.24; CoC_l2·6H₂O, 1.4; KI,0.23; α-cellulose, 2.15.

All dry ingredients were accurately weighed and fully blended, and then thoroughly mixed to homogeneity with distilled water. The wet mixture was extruded into pellets (1.5-mm diameter) using a pelleting machine. The pellets were dried in a forced-air oven at 40°C to approximately 10% moisture and then stored at −20°C before being used in the feeding trial.

2.2 Experimental animals and feeding trials

Juvenile prawns were supplied by a local farmer. Prior to the feeding trial, the prawns were fed a commercial diet (38% protein) for 1 week to acclimate to the culture conditions. Thereafter, healthy prawns with an average initial weight of 0.104 g were randomly stocked in 12 tanks (300 L), with 50 prawns per tank (three replicates per dietary group). Prawns were fed twice a day (07:30 and 17:00 h) at 8% of body weight for 8 weeks. During the feeding trial, the water conditions were maintained at 25–28°C, dissolved oxygen >6.5 mg L⁻¹ and ammonia and nitrate <0.1 mg L⁻¹, under a natural photoperiod. Water was continuously aerated using air stones, with a daily water exchange rate of 1/3 of the tank volume. Some nylon fishing nets were placed in each tank as an artificial shelter to minimize disturbance to the animals.

2.3 Sample collection

Feeding was stopped 24 h prior to termination of the experiment. The hepatopancreas of six prawns per dietary group was dissected and fixed separately in Bouin's solution for 24 h before histological analysis, and the other hepatopancreas samples were stored at −80°C for subsequent analyses.

2.4 Growth parameters and biochemical analysis

Growth performance was measured using the following parameters: weight gain (%) = (final body weight−initial body weight)/(initial body weight) × 100; specific growth rate (%) = (ln final weight−ln initial weight)/(days of the experiment) × 100; and survival rate (%) = (final prawn number)/(initial prawn number) × 100.

The crude protein, crude lipid and moisture in the prepared diets were determined conducted using standard procedures (AOAC, 2005).

2.5 Lipid-peroxidation levels and antioxidant enzyme activities

The hepatopancreas of 10 prawns (intermolt) per tank were obtained for assaying enzyme activities and then combined as one sample. The hepatopancreas samples were homogenized with ice-cold 0.86% (w/v) NaCl solution to get a crude extract. Lipid-peroxidation levels (malondialdehyde, MDA) and antioxidant enzymes were determined using commercially available kits (Nanjing Jiancheng Bioengineering Institute). MDA levels were determined following the thiobarbituric acid method (Buege & Aust, 1978). Superoxide dismutase (SOD) activity was determined based on the method of Beauchamp and Fridovich (1971). Catalase (CAT) activity was determined by measuring the decrease in H₂O₂ concentration (Aebi, 1984). Glutathione peroxidase (GPx) activity was evaluated from the decrease in absorption at 340 nm due to the oxidation of NADPH to NADP⁺ (Balic et al., 2012).

2.6 Histological assay

The fixed hepatopancreas were dehydrated in an ascending alcohol concentration. Dehydrated tissues were embedded in paraffin and cut as continuous section blocks into 5-μm sections. The sections were stained with haematoxylin and eosin to reveal changes in the hepatopancreas and then examined with CaseViewer software (3DHISTECH Ltd).

2.7 qRT-PCR analysis of heat shock proteins

Total RNA was extracted from the hepatopancreas of five prawns (intermolt) per tank, using a commercial assay kit (Aidlab Biotechnologies Co) in accordance with the manufacturer's protocols. cDNA for qRT-PCR was synthesized via reverse transcription using a PrimeScript^™ RT-PCR Kit (Takara). Reaction conditions were those recommended by the manufacturer.

Gene-specific primers were designed using online Primer3 software based on the cDNA sequences in GenBank. The upstream primer of HSC70 (DQ660140.1) is GCGTCTTATTGGTGATGC, and the downstream primer is TAAAGGGCCAATGTTTCA. The upstream primer of HSP90 (GU319963.1) is GAAGGAAAGGGACAAGGA, and the downstream primer is GGTCCATAAAGGCTTGGT. The upstream primer of β-actin (FL589653.1) is GTGCCCATCTACGAGGGTTA, and the downstream primer is CGTCAGGGAGCTCGTAAGAC. qRT-PCR analysis was performed using a SYBR® Premix Ex Taq^™ Kit (Takara) in the CFX96^™ Real-Time PCR Detection System (Bio-Rad). Amplification was performed in a total volume of 20 μl containing 10 μl 2 × SYBR Green Premix Ex Taq, 0.2 μl of each primer (10 μM), 2 μl of cDNA and 7.6 μl of PCR-grade water. The cycling conditions were as follows: 95°C for 30 s followed by 40 cycles at 94°C for 15 s, 58°C for 20 s and 72°C for 20 s, with an 0.5°C/5 s incremental increase from 60 to 95°C. During the detection, each sample was run in triplicate. The amplification efficiencies of all genes were approximately equal. The relative mRNA expression of genes was calculated with the 2^−ΔΔCt comparative CT method (Livak & Schmittgen, 2001).

2.8 Statistical analysis

Statistical analyses were performed using SPSS Statistics for Windows ver. 17.0 (SPSS Inc.). Data are mean ± standard deviation (SD). Data were analysed by two-way analysis of variance (ANOVA) to determine whether there was any interaction between dietary lead level and taurine level. At the same lead level, an independent-samples t-test was used to determine significant differences between 0 and 15 g/kg taurine concentration. At the same taurine level, an independent-samples t-test was used to determine significant differences between 0 and 10 mg/kg dietary lead concentration. A p-value of <.05 was considered statistically significant, and a value of <0.01 was considered extremely significant.

3 RESULTS

3.1 Growth performance

As shown in TABLE 2, there was a significant main effect of dietary lead on weight gain or specific growth rate (p < .05) in M. nipponense. Prawns fed the diet with 10 mg/kg lead displayed significantly less weight gain and a lower specific growth rate compared with prawns fed 0 mg/kg lead regardless of the dietary taurine level (p < .05). The addition of dietary taurine did not improve the growth performance of prawns. The survival rate was not significantly affected by the dietary levels of lead or taurine (p > .05). There were no significant interactive effects between dietary lead and dietary taurine on weight gain, specific growth rate and survival rate (p > .05).

TABLE 2. Growth performance of the freshwater prawn, Macrobrachium nipponense as affected by dietary lead toxicity and taurine supplementation. Data are presented as mean ± SD

Groups	Final body weight/g	Weight gain/%	Specific growth rate (%/d)	Survival rate/%
Pb0	0.47 ± 0.03^B	355.54 ± 33.62^B	2.39 ± 0.13^B	59.67 ± 4.16
Pb0Tau15	0.49 ± 0.05^B	371.93 ± 52.36^B	2.45 ± 0.20^B	61.33 ± 3.51
Pb10	0.33 ± 0.05^A	224.44 ± 53.39^A	1.77 ± 0.31^A	57.67 ± 2.51
Pb10Tau15	0.37 ± 0.04^A	256.27 ± 43.09^A	1.95 ± 0.22^A	59.00 ± 4.35
Lead effect	0.002	0.002	0.003	0.341
Taurine effect	0.373	0.394	0.394	0.503
Lead * Taurine	0.815	0.780	0.667	0.940

Note

Capital letters denote significant differences between 0 and 10 mg/kg dietary lead concentration at the same taurine supplementation level.

3.2 Malondialdehyde content and activities of antioxidant enzymes

Figure 1 shows the effects of dietary lead and taurine on MDA content and the antioxidant enzyme activities of the prawns. There were significant main effects of dietary lead on SOD, CAT, GPx and MDA indexes (p < .05), but no significant main effect of dietary taurine on the activities of SOD, CAT and GPx. Dietary lead significantly decreased SOD, CAT and GPx activities and increased MDA content in hepatopancreas when compared with prawns given feed with no lead (p < .05). There was a significant main effect of dietary taurine on MDA (p < .05), and lead-contaminated diets with taurine supplementation significantly decreased MDA content in hepatopancreas (p < .01). Significant interactive effects were obtained between dietary lead and dietary taurine on SOD and MDA (p < .05).

Details are in the caption following the image — **FIGURE 1**
Open in figure viewer PowerPoint

Antioxidant capacity in hepatopancreas of freshwater prawns *Macrobrachium nipponense* as affected by dietary lead toxicity and taurine. CAT, catalase; GPx, glutathione peroxidase; MDA, malondialdehyde; SOD, superoxide dismutase. Asterisks (*) indicate significant differences between 0 and 10 mg/kg dietary lead concentration at the same taurine supplementation level, and between 0 and 15 g/kg taurine concentration at the same dietary lead concentration. Black columns represent 0 g/kg taurine concentration and red columns represent 15 g/kg taurine concentration

3.3 Hepatopancreas morphology

As shown in Figure 2, histology of the hepatopancreas in prawns of the Pb0Tau0 and Pb0Tau15 groups was normal, with tightly connected cells of the pseudostratified epithelium arranged along the hepatopancreatic tubule. The hepatopancreas of prawns fed Pb0Tau15 had more blister cells (B cells) than those fed Pb0Tau0. No difference was observed in the numbers of resorptive cells (R cells) between groups Pb0Tau0 and Pb0Tau15. Histopathological alterations in hepatopancreas were observed in group Pb10Tau0, which exhibited enlarged or disintegrated lumen. The taurine addition to the lead-contaminated diet (Pb10Tau15) resulted in no obvious improvement to the histological morphology of the hepatopancreas. There was no clear change in the proportions of R cells and B cells between groups Pb10Tau0 and Pb10Tau15.

3.4 mRNA expression of HSC70 and HSP90

The mRNA expressions of HSC70 and HSP90 in the hepatopancreas are shown in Figure 3. There was a significant main effect of dietary lead or dietary taurine on HSC70 mRNA expression, but no significant interactive effect was obtained between dietary lead and taurine supplementation. No difference in HSC70 mRNA expression was observed at the same level of lead (p > .05). Dietary lead significantly decreased the expression of HSC70 in prawns given 15 g/kg dietary taurine but not in prawns given no taurine supplementation. There was a significant main effect of dietary lead or dietary taurine on HSP90 mRNA expression, and a significant interactive effect was obtained between dietary lead and dietary taurine (p < .05). Dietary taurine significantly increased HSP90 mRNA expression under no dietary lead contamination (p < .01). Dietary lead significantly decreased HSP90 mRNA expression regardless of the dietary taurine level (p < .05). There was no significant difference in HSP90 mRNA expression in prawns fed a lead-contaminated diet with or without taurine addition (p > .05).

4 DISCUSSION

The feeding experiment investigated whether dietary taurine could be effective in countering the effects of lead toxicity in M. nipponense. The hygienic standard for feeds in China stipulates that the lead content of a formulated feed should not exceed 5 mg/kg. In the present study, 10 mg/kg lead added to the diet decreased growth of the prawns. This result agrees with our previous study, which found that chronic lead exposure (26.26 μg/L) could adversely affect the growth of M. nipponense (Ding et al., 2019). Similarly, the growth performance of juvenile rockfish Sebastes schlegelii was significantly decreased by dietary lead exposure (Kim & Kang, 2015). The decreased growth might be attributable to poorer food assimilation caused by stress (Hansen et al., 2002) and by reallocation of energy from growth and development to detoxification (Kim & Kang, 2015). The survival rate of the prawns was not affected by dietary lead, which is consistent with the results of lead exposure in the rearing water (Ding et al., 2019). Thus, the survival rate of M. nipponense may not be a sufficiently sensitive indicator of chronic lead exposure through either the water or diet. Previous studies have suggested that an appropriate addition of taurine can improve growth performance in some animals (Han et al., 2020; Lin and Lu, 2020). However, our data did not suggest a growth-promoting effect of taurine under dietary lead stress, which might be related to the amount of taurine supplementation and/or to the different metabolic systems of the experimental animals. Further study is needed to determine the optimal concentration of taurine supplementation in a diet for M. nipponense.

It has been shown that lead exposure can produce ROS and then trigger oxidative stress (El-Fara et al., 2017; Sudjaroen & Suwannahong, 2017). The antioxidant response can be a reliable and sensitive indicator for evaluating oxidative stress following exposure to metals (Lee et al., 2019). SOD catalyses dismutation of superoxide radicals to hydrogen peroxide, which can, in turn, be removed by CAT and GPx (Livingstone, 2003). In the present study, there were main effects of dietary lead on antioxidant enzyme activities, as the activities of SOD, CAT and GPx were inhibited in the prawns given lead-contaminated feed, which might indicate its reduced capacity to scavenge H₂O₂ and lipid hydroperoxides produced in organ tissues because of oxidative stress (Ballesteros et al., 2009). Although no significant increase was observed in the antioxidant enzyme activities of prawns given taurine supplementation under lead stress compared with prawns not given the supplementation, a significant decrease in lipid peroxidation in terms of MDA was observed in the hepatopancreas. This indicates that both the level of dietary lead and dietary taurine can affect lipid peroxidation in this freshwater prawn. The more dramatic change in the MDA level than in the enzyme activities will be because oxidative stress originating from heavy metals directly affects the MDA level (Ates et al., 2008). Antioxidant activity is one of the most important biological functions of taurine (Cassol et al., 2010; Das et al., 2012). Previous research suggested that the interaction of taurine with the plasma membrane results in a modulation of the membrane lipid ratio, thereby leading to a decrease in membrane fluidity and increased resistance to oxidative damage (Hamaguchi et al., 1991). The significant interaction of dietary taurine with dietary lead indicates that, to some extent, taurine has a protective role in terms of peroxidative damage caused by dietary lead. Although literature is lacking on the direct effects of taurine on lead stress, the known modulatory effects of taurine to various stresses indicate its capacity to alleviate oxidative damage (Mezzomo et al., 2019; Orhan et al., 2020; Ramos et al., 2018; Wen et al., 2019; Zhang et al., 2018).

The hepatopancreas, as an important organ for the digestion, absorption, storage and metabolism of nutrients, plays a very important role in the normal physiology of crustaceans (Vogt, 2019). Additionally, the organ is important in immune defences and the detoxification of pollutants (Müller et al., 2020; Roszer, 2014). Consequently, when the histological structure of the hepatopancreas is abnormal, the normal physiological functioning of crustaceans is impacted. In the present study, dietary lead induced structural damage of the hepatopancreas, which aligns with the results reported for silver sailfin molly Poecilia latipinna (Mobarak & Sharaf, 2011) and three terrestrial isopod crustacean species (Mazzei et al., 2014) exposed to lead. Similarly, hepatopancreas structural change was also observed after exposure to other heavy metals (Boudet et al., 2015; Mu et al., 2017). Histopathologies are related to environmental quality, demonstrating the high sensitivity of the hepatopancreas to the change in environmental quality (Boudet et al., 2015). R cells and B cells are important epithelial cells in the hepatopancreas (Liu et al., 2019); B cells have a secretory function, and R cells are involved in nutrient storage and detoxification processes (Chen et al., 2017; Sousa et al., 2005; Yeganeh et al., 2020). The relatively high proportion of B cells in the hepatopancreas of prawns fed taurine without lead stress may indicate that energy and nutrient utilization increased. However, the mitigation of damage to hepatopancreas morphology by dietary taurine under lead stress appeared to be limited in this study. The present results suggest that the hepatopancreas cell damage caused by dietary lead is unlikely to be achieved through taurine addition alone.

After an organism is subjected to stress, HSPs can maintain the homeostasis of the organism and resist sequential stresses by maintaining protein conformation, anti-apoptosis, cell protection and other functions (Basu et al., 2002). As a constituent heat stress protein, HSC70 can degrade and remove damaged and denatured proteins and play a role in protecting and repairing cells (Boorstein et al., 1994; Kiang & Tsokos, 1998). Data on HSC70 in relation to metal stress are limited, but some studies have shown that HSC70 can be induced (Oksala et al., 2014; Tawk et al., 2000). However, in our study, HSC70 transcript was not induced by a higher lead level in the diet. This result concurs with a study showing lack of change in HSC70 expression with heat shock and heavy metal exposure in rainbow trout hepatocytes (Boone and Vijayan, 2002). Interestingly, in our study, dietary lead significantly decreased the expression of HSC70 at 15 g/kg taurine concentration but not at 0 g/kg taurine concentration, and no interactive effects were observed on HSC70 expression between dietary lead and taurine. This may suggest HSC70 is not a sensitive index of dietary lead contamination in this prawn. HSP90 is highly expressed in the cytoplasm of eukaryotic cells; it not only plays the function of molecular chaperone but also an important role in intracellular transport, protein degradation, cell signal transduction and other processes (Xie et al., 2015). Choi et al. (2008) reported that cadmium (Cd) treatment increased HSP90 gene expression in the digestive gland and gill tissue of Pacific oyster Crassostrea gigas. However, Ivanina et al. (2008) reported that Cd exposure did not affect the expression of HSP90. Compared with other heavy metals, a relatively low modulation of the HSP90 gene was observed in the experiment with dietary lead regardless of the dietary taurine level in the M. nipponense. Organisms cannot achieve appropriate levels of metabolic function under strong oxidative stress (Zhang et al., 2004), so the decreased expression of HSP90 might be due to a decrease in the metabolic capacity of the organism caused by the strong toxicity of dietary lead. This damage can be confirmed from the abnormal structure of the hepatopancreas in M. nipponense. In a study with poultry, HSP90 gene expression was increased in the liver by acute heat stress but limited after chronic heat stress (Wang et al., 2013), so it seems stress duration may affect the HSP90 expression. The present experiment lasted for 2 months; therefore, different results might be observed whether the stress duration was changed. Although dietary taurine improved HSP90 expression in this prawn under no lead stress, its modulation of HSP90 expression under lead stress is indeterminate. Similarly, taurine supplementation in broilers (poultry) under heat stress resulted in lower expressions of HSP60 and HSP70 but not HSP90 (Belal et al., 2018).

5 CONCLUSIONS

Overall, the present study demonstrated that the main effects of dietary lead (10 mg/kg of feed) in M. nipponense included decreased growth, oxidative stress and histopathological changes in the hepatopancreas. Dietary taurine had an interactive effect with lead on the MDA level in the hepatopancreas, which alleviated the oxidative stress caused by lead consumption. The potential of dietary taurine to alleviate impaired growth, hepatopancreas damage and low HSP90 expression under dietary lead stress is limited.

ACKNOWLEDGEMENTS

This research was supported by Zhejiang Province Public Welfare Technology Application Research Project (No. LGN21C190003, LGN21C190004), the Natural Science Foundation of Huzhou (No. 2019YZ04), and the Major Scientific, Technological Special Project of Zhejiang, China (No. 2014C02011).

CONFLICT OF INTEREST

The authors declare no conflict of interest.

Open Research

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.

REFERENCES

Aebi, H. (1984). Catalase in vitro. Methods in Enzymology, 105, 121–126.
10.1016/S0076-6879(84)05016-3
CAS PubMed Web of Science® Google Scholar
AOAC. (2005). Official methods of analysis, 18th ed. Association of Official Analytical Chemists.
Google Scholar
Ates, B., Orun, I., Talas, Z. S., Durmaz, G., & Yilmaz, I. (2008). Effects of sodium selenite on some biochemical and hematalogical parameters of rainbow trout (Oncorhynchus mykiss Walbaum, 1792) exposed to Pb²⁺ and Cu²⁺. Fish Physiology and Biochemistry, 34, 53–59.
10.1007/s10695-007-9146-5
CAS PubMed Web of Science® Google Scholar
Balic, I. M., Milinkovic-Tur, S., Samardzija, M., & Vince, S. (2012). Effect of age and environmental factors on semen quality, glutathione peroxidase activity and oxidative parameters in simmental bulls. Theriogenology, 78, 423–431. https://doi.org/10.1016/j.theriogenology.2012.02.022
10.1016/j.theriogenology.2012.02.022
CAS PubMed Web of Science® Google Scholar
Ballesteros, M. L., Wunderlin, D. A., & Bistoni, M. A. (2009). Oxidative stress responses in different organs of Jenynsia multidentata exposed to endosulfan. Ecotoxicology and Environmental Safety, 72, 199–205. https://doi.org/10.1016/j.ecoenv.2008.01.008
10.1016/j.ecoenv.2008.01.008
CAS PubMed Web of Science® Google Scholar
Basu, N., Todgham, A. E., Ackerman, P. A., Bibeau, M. R., Nakano, K., Schulte, P. M., & Iwama, G. K. (2002). Heat shock protein genes and their functional significance in fish. Gene, 295(2), 173–183. https://doi.org/10.1016/S0378-1119(02)00687-X
10.1016/S0378-1119(02)00687-X
CAS PubMed Web of Science® Google Scholar
Beauchamp, C., & Fridovich, I. (1971). Superoxide dismutase: Improved assays and an assay applicable to acrylamide gels. Analytical Biochemistry, 44, 276–287. https://doi.org/10.1016/0003-2697(71)90370-8
10.1016/0003-2697(71)90370-8
CAS PubMed Web of Science® Google Scholar
Belal, S. A., Kang, D. R., Cho, E. S. R., Park, G. H., & Shim, K. S. (2018). Taurine reduces heat stress by regulating the expression of heat shock proteins in broilers exposed to chronic heat. Brazilian Journal of Poultry Science, 20(3), 479–486. https://doi.org/10.1590/1806-9061-2017-0712
10.1590/1806-9061-2017-0712
Web of Science® Google Scholar
Boone, A. N., & Vijayan, M. M. (2002). Constitutive heat shock protein 70 (HSC70) expression in rainbow trout hepatocytes: Effect of heat shock and heavy metal exposure. Comparative Biochemistry and Physiology, Part C: Toxicology & Pharmacology, 132, 223–233. https://doi.org/10.1016/S1532-0456(02)00066-2
10.1016/S1532-0456(02)00066-2
PubMed Web of Science® Google Scholar
Boorstein, W. R., Ziegelhoffer, T., & Craig, E. A. (1994). Molecular evolution of the HSP 70 multigene family. Journal of Molecular Evolution, 38(1), 1–17. https://doi.org/10.1007/BF00175490
10.1007/BF00175490
CAS PubMed Web of Science® Google Scholar
Boudet, L. N. C., Polizzi, P., Romero, M. B., Robles, A., Marcovecchio, J. E., & Gerpe, M. S. (2015). Histopathological and biochemical evidence of hepatopancreatic toxicity caused by cadmium in white shrimp, Palaemonetes argentinus. Ecotoxicology and Environmental Safety, 113, 231–240. https://doi.org/10.1016/j.ecoenv.2014.11.019
10.1016/j.ecoenv.2014.11.019
PubMed Web of Science® Google Scholar
Buege, J. A., & Aust, S. D. (1978). Microsomal lipid peroxidation. Methods in Enzymology, 52, 302.
10.1016/S0076-6879(78)52032-6
CAS PubMed Google Scholar
Cassol, O. J. Jr, Rezin, G. T., Petronilho, F. C., Scaini, G., Goncalves, C. L., Ferreira, G. K., Roesler, R., Schwartsmann, G., Dal Pizzol, F., & Streck, E. L. (2010). Effects of N-acetylcysteine/deferoxamine, taurine and RC-3095 on respiratory chain complexes and creatine kinase activities in rat brain after sepsis. Neurochemical Research, 35, 515–521.
10.1007/s11064-009-0089-3
CAS PubMed Web of Science® Google Scholar
Chen, Q., Ma, Q. Q., Shen, Z. H., Li, E. C., & Chen, L. Q. (2018). Effects of dietary methionine, bile acid, taurine supplementation in low fishmeal diet on growth performance, feed utilization and antioxidant capacity of juvenile Eriocheir sinensis. Marine Fisheries, 40(1), 65-75. (Chinese with English Abstract)
Google Scholar
Chen, W. W., Romano, N., Ebrahimi, M., & Natrah, I. (2017). The effects of dietary fructooligosaccharide on growth, intestinal short chain fatty acids level and hepatopancreatic condition of the giant freshwater prawn (Macrobrachium rosenbergii) post-larvae. Aquaculture, 469, 95–101. https://doi.org/10.1016/j.aquaculture.2016.11.034
10.1016/j.aquaculture.2016.11.034
CAS Web of Science® Google Scholar
Choi, Y. K., Jo, P. G., & Choi, C. Y. (2008). Cadmium affects the expression of heat shock protein 90 and metallothionein mRNA in the Pacific oyster, Crassostrea gigas. Comparative Biochemistry and Physiology, Part C: Toxicology & Pharmacology, 147, 286–292. https://doi.org/10.1016/j.cbpc.2007.11.002
10.1016/j.cbpc.2007.11.002
PubMed Web of Science® Google Scholar
Das, J., Roy, A., & Sil, P. C. (2012). Mechanism of the protective action of taurine in toxin and drug induced organ pathophysiology and diabetic complications: A review. Food & Function, 2, 1251–1264. https://doi.org/10.1039/c2fo30117b
10.1039/c2fo30117b
Web of Science® Google Scholar
Ding, Z. L., Kong, Y. Q., Shao, X. P., Zhang, Y. X., Ren, C. C., Zhao, X. M., Yu, W. S., Jiang, T. Q., & Ye, J. Y. (2019). Growth, antioxidant capacity, intestinal morphology, and metabolomic responses of juvenile Oriental river prawn (Macrobrachium nipponense) to chronic lead exposure. Chemosphere, 217, 289–297. https://doi.org/10.1016/j.chemosphere.2018.11.034
10.1016/j.chemosphere.2018.11.034
CAS PubMed Web of Science® Google Scholar
El-Fara, A. H., Korshom, M. A., Mandour, A. A., El-Bessoumy, A. A., & El-Sayed, Y. S. (2017). Hepatoprotective efficacy of Nigella sativa seeds dietary supplementation against lead acetate-induced oxidative damage in rabbit-Purification and characterization of glutathione peroxidase. Biomedicine & Pharmacotherapy, 89, 711–718. https://doi.org/10.1016/j.biopha.2017.02.044
10.1016/j.biopha.2017.02.044
PubMed Web of Science® Google Scholar
GB 13078–2017. (2017). Hygienic standard for feeds. Ministry of Agriculture and rural of the People’s Republic of China. (in Chinese).
Google Scholar
Hamaguchi, T., Azuma, J., & Schaffffer, S. (1991). Interaction of taurine with methionine: Inhibition of myocardial phospholipid methyltransferase. Journal of Cardiovascular Pharmacology, 18(2), 224–230. https://doi.org/10.1097/00005344-199108000-00008
10.1097/00005344-199108000-00008
CAS PubMed Web of Science® Google Scholar
Han, H. L., Zhang, J. F., Yan, E. F., Shen, M. M., Wu, J. M., Gan, Z. D., Wei, C. H., Zhang, L. L., & Wang, T. (2020). Effects of taurine on growth performance, antioxidant capacity, and lipid metabolism in broiler chickens. Poultry Science, 99(11), 5707–5717. https://doi.org/10.1016/j.psj.2020.07.020
10.1016/j.psj.2020.07.020
CAS PubMed Web of Science® Google Scholar
Hansen, J. A., Welsh, P. G., Lipton, J., & Suedkamp, M. J. (2002). The effects of long-term cadmium exposure on the growth and survival of juvenile bull trout (Salvelinus confluentus). Aquatic Toxicology, 58, 165–174. https://doi.org/10.1016/S0166-445X(01)00233-8
10.1016/S0166-445X(01)00233-8
CAS PubMed Web of Science® Google Scholar
Hashish, E. A., & Elgaml, S. A. (2015). Nephroprotective and antioxidant significance of selenium and a-tocopherol on lead acetate-induced toxicity of Nile Tilapia (Oreochromis niloticus). Fish Physiology and Biochemistry, 41, 651–660.
10.1007/s10695-015-0035-z
CAS PubMed Web of Science® Google Scholar
Hofmann, G. E., Buckley, B. A., Place, S. P., & Zippay, M. L. (2002). Molecular chaperones in ectothermic marine animals: Biochemical function and gene expression. Integrative and Comparative Biology, 42, 808–814. https://doi.org/10.1093/icb/42.4.808
10.1093/icb/42.4.808
CAS PubMed Web of Science® Google Scholar
Hu, H., Jin, Q., & Kavan, P. (2014). A Study of Heavy metal pollution in China: Current status, pollution-control policies and countermeasures. Sustainability, 6, 5820–5838. https://doi.org/10.3390/su6095820
10.3390/su6095820
CAS Web of Science® Google Scholar
Ivanina, A. V., Cherkasov, A. S., & Sokolova, I. M. (2008). Effects of cadmium on cellular protein and glutathione synthesis and expression of stress proteins in eastern oyster, Crassostrea virginica Gmelin. Journal of Experimental Biology, 211, 577–586.
10.1242/jeb.011262
CAS PubMed Web of Science® Google Scholar
Kiang, J. G., & Tsokos, G. C. (1998). Heat shock protein 70 kDa: Molecular biology, biochemistry, and physiology. Pharmacology & Therapeutics, 80(2), 183–201. https://doi.org/10.1016/S0163-7258(98)00028-X
10.1016/S0163-7258(98)00028-X
CAS PubMed Web of Science® Google Scholar
Kim, B. M., Rhee, J. S., Jeong, C. B., Seo, J. S., Park, G. S., Lee, Y. M., & Lee, J. S. (2014). Heavy metals induce oxidative stress and trigger oxidative stress-mediated heat shock protein (hsp) modulation in the intertidal copepod Tigriopus japonicus. Comparative Biochemistry and Physiology, Part C: Toxicology & Pharmacology, 166, 65–74. https://doi.org/10.1016/j.cbpc.2014.07.005
10.1016/j.cbpc.2014.07.005
CAS PubMed Web of Science® Google Scholar
Kim, J. H., & Kang, J. C. (2015). The lead accumulation and hematological findings in juvenile rock fish Sebastes schlegelii exposed to the dietary lead (II) concentrations. Ecotoxicology and Environmental Safety, 115, 33–39. https://doi.org/10.1016/j.ecoenv.2015.02.009
10.1016/j.ecoenv.2015.02.009
CAS PubMed Web of Science® Google Scholar
Lapanje, A., Zrimec, A., Drobne, D., & Rupnik, M. (2010). Long-term Hg pollution-induced structural shifts of bacterial community in the terrestrial isopod (Porcellio scaber) gut. Environmental Pollution, 158, 3186–3193. https://doi.org/10.1016/j.envpol.2010.07.001
10.1016/j.envpol.2010.07.001
CAS PubMed Web of Science® Google Scholar
Lee, J. W., Choi, H., Hwang, U. K., Kang, J. C., Kang, Y. J., Kim, K., & Kim, J. H. (2019). Toxic effects of lead exposure on bioaccumulation, oxidative stress, neurotoxicity, and immune responses in fish: A review. Environmental Toxicology and Pharmacology, 68, 101–108. https://doi.org/10.1016/j.etap.2019.03.010
10.1016/j.etap.2019.03.010
CAS PubMed Web of Science® Google Scholar
Lin, Y. H., & Lu, R. M. (2020). Dietary taurine supplementation enhances growth and nutrient digestibility in giant grouper Epinephelus lanceolatus fed a diet with soybean meal. Aquaculture Reports, 18, 100464. https://doi.org/10.1016/j.aqrep.2020.100464
10.1016/j.aqrep.2020.100464
Web of Science® Google Scholar
Liu, Y. L., Xing, R. G., Liu, S., Qin, Y. K., Li, K. C., Yu, H. H., & Li, P. C. (2019). Effects of chitooligosaccharides supplementation with different dosages, molecular weights and degrees of deacetylation on growth performance, innate immunity and hepatopancreas morphology in Pacific white shrimp (Litopenaeus vannamei). Carbohydrate Polymers, 226, 115254. https://doi.org/10.1016/j.carbpol.2019.115254
10.1016/j.carbpol.2019.115254
CAS PubMed Web of Science® Google Scholar
Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2^-△△CT method. Methods, 25, 402–408.
10.1006/meth.2001.1262
CAS ADS PubMed Web of Science® Google Scholar
Livingstone, D. R. (2003). Oxidative stress in aquatic organisms in relation to pollution and aquaculture. Revue De Medecine Veterinaire, 154(6), 427–430.
CAS Web of Science® Google Scholar
Mazzei, V., Longo, G., Brundo, M. V., Sinatra, F., Copat, C., Oliveri Conti, G., & Ferrant, M. (2014). Bioaccumulation of cadmium and lead and its effects on hepatopancreas morphology in three terrestrial isopod crustacean species. Ecotoxicology and Environmental Safety, 110, 269–279. https://doi.org/10.1016/j.ecoenv.2014.09.015
10.1016/j.ecoenv.2014.09.015
CAS PubMed Web of Science® Google Scholar
Mezzomo, N. J., Fontana, B. D., Müller, T. E., Duarte, T., Quadros, V. A., Canzian, J., Pompermaier, A., Soares, S. M., Koakoski, G., Loro, V. L., Rosemberg, D. B., & Barcellos, L. J. G. (2019). Taurine modulates the stress response in zebrafish. Hormones and Behavior, 109, 44–52. https://doi.org/10.1016/j.yhbeh.2019.02.006
10.1016/j.yhbeh.2019.02.006
CAS PubMed Web of Science® Google Scholar
Mezzomo, N. J., Müller, T. E., Franscescon, F., Michelotti, P., Souza, T. P., Rosemberg, D. B., & Barcellos, L. J. G. (2020). Taurine-mediated aggression is abolished via 5-HT1A antagonism and serotonin depletion in zebrafish. Pharmacology Biochemistry and Behavior, 199, 173067. https://doi.org/10.1016/j.pbb.2020.173067
10.1016/j.pbb.2020.173067
CAS PubMed Web of Science® Google Scholar
Mobarak, Y. M. S., & Sharaf, M. M. (2011). Lead acetate-induced histopathological changes in the gills and digestive system of silver sailfin molly (Poecilia latipinna). International Journal of Zoological Research, 7(1), 1–18. https://doi.org/10.3923/ijzr.2011.1.18
10.3923/ijzr.2011.1.18
CAS Google Scholar
Mu, C. M., Ren, X. Y., Ge, Q. Q., Wang, J. J., & Li, J. (2017). Antioxidant response of ridgetail white prawn Exopalaemon carinicauda to harmful dinoflagellate Prorocentrum minimum exposure and its histological change. Journal of Ocean University of China (Oceanic and Coastal Sea Research), 16, 285–293. https://doi.org/10.1007/s11802-017-3170-6
10.1007/s11802-017-3170-6
CAS Web of Science® Google Scholar
Müller, Y. M. R., Melo, M. S., Weiss, V. M. C., Quadros, T., Ammar, T., & Nazari, E. M. (2020). Ultraviolet B radiation affects epithelial cell morphology and ultrastructure in the hepatopancreas of the freshwater decapod Macrobrachium olfersii. Ecotoxicology and Environmental Safety, 204, 111096. https://doi.org/10.1016/j.ecoenv.2020.111096
10.1016/j.ecoenv.2020.111096
PubMed Web of Science® Google Scholar
Oksala, N. K. J., Ekmekçi, F. G., Özsoy, E., Kirankaya, S., Kokkola, T., Emecen, G., Lappalainen, J., Kaarniranta, K., & Atalay, M. (2014). Natural thermal adaptation increases heat shock protein levels and decreases oxidative stress. Redox Biology, 3, 25–28. https://doi.org/10.1016/j.redox.2014.10.003
10.1016/j.redox.2014.10.003
CAS PubMed Web of Science® Google Scholar
Orhan, C., Kucuk, O., Sahin, N., Tuzcu, M., & Sahin, K. (2020). Effects of taurine supplementation on productive performance, nutrient digestibility and gene expression of nutrient transporters in quails reared under heat stress. Journal of Thermal Biology, 92, 102668. https://doi.org/10.1016/j.jtherbio.2020.102668
10.1016/j.jtherbio.2020.102668
CAS PubMed Web of Science® Google Scholar
Pal, M., Sachdeva, M., Gupta, N., Mishra, P., Yadav, M., & Tiwari, A. (2015). Lead exposure in different organs of mammals and prevention by curcumin–nanocurcumin: A review. Biological Trace Element Research, 168, 380–391. https://doi.org/10.1007/s12011-015-0366-8
10.1007/s12011-015-0366-8
CAS PubMed Web of Science® Google Scholar
Ramos, C. D. O., Campos, K. K. D., Costa, G. D. P., Cangussú, S. D., Talvani, A., & Bezerra, F. S. (2018). Taurine treatment decreases inflammation and oxidative stress in lungs of adult mice exposed to cigarette smoke. Regulatory Toxicology and Pharmacology, 98, 50–57. https://doi.org/10.1016/j.yrtph.2018.07.008
10.1016/j.yrtph.2018.07.008
CAS PubMed Web of Science® Google Scholar
Ripps, H., & Shen, W. (2012). Taurine: A “very essential” amino acid. Molecular Vision, 18, 2673–2686.
CAS PubMed Web of Science® Google Scholar
Roszer, T. (2014). The invertebrate midintestinal gland (“hepatopancreas”) is an evolutionary forerunner in the integration of immunity and metabolism. Cell and Tissue Research, 358, 685–695. https://doi.org/10.1007/s00441-014-1985-7
10.1007/s00441-014-1985-7
CAS PubMed Web of Science® Google Scholar
Rubio, C., & Hardisson, A. (1999). Lead toxicology and the presence of lead in foods. Alimentaria, 36, 77–85.
Google Scholar
Salze, G. P., & Davis, D. A. (2015). Taurine: A critical nutrient for future fish feeds. Aquaculture, 437, 215–229. https://doi.org/10.1016/j.aquaculture.2014.12.006
10.1016/j.aquaculture.2014.12.006
CAS Web of Science® Google Scholar
Sevcikova, M., Modra, H., Slaninova, A., & Svobodova, Z. (2011). Metals as a cause of oxidative stress in fish: A review. Veterinary Medicine, 56(11), 537–546.
10.17221/4272-VETMED
CAS Web of Science® Google Scholar
Sousa, L. G., Cuartas, E. I., & Petriella, A. M. (2005). Fine structural analysis of the epithelial cells in the hepatopancreas of Palaemonetes argentinus (Crustacea, Decapoda, Caridea) in intermoult. Biocell, 29(1), 25–31. https://doi.org/10.32604/biocell.2005.29.025
10.32604/biocell.2005.29.025
PubMed Web of Science® Google Scholar
Sudjaroen, Y., & Suwannahong, K. (2017). Biomarker related lead exposure of industrial battery's workers. Annals of Tropical Medicine and Public Health, 10(1), 194–198. https://doi.org/10.4103/1755-6783.196523
10.4103/1755-6783.196523
Web of Science® Google Scholar
Tawk, M., Joulie, C., & Vriz, S. (2000). Zebrafish Hsp40 and Hsc70 genes are both induced during caudal fin regeneration. Mechanisms of Development, 99(1–2), 183–186. https://doi.org/10.1016/S0925-4773(00)00478-0
10.1016/S0925-4773(00)00478-0
CAS PubMed Web of Science® Google Scholar
Vogt, G. (2019). Functional cytology of the hepatopancreas of decapod crustaceans. Journal of Morphology, 1–40. https://doi.org/10.1002/jmor.21040
Web of Science® Google Scholar
Wang, D. Q., Lu, L. Z., Tian, Y., Li, J. J., & Shen, J. D. (2013). Cloning and expression of heat shock protein 90 (HSP90) cDNA sequence from Shaoxing duck (Anas platyrhynchos). Journal of Agricultural Biotechnology, 21, 55–61.
CAS Google Scholar
Wang, J., Ren, T. J., Han, Y. Z., Zhao, Y., Liao, M. L., Wang, F. Q., & Jiang, Z. Q. (2015). The effects of dietary lead on growth, bioaccumulation and antioxidant capacity in sea cucumber, Apostichopus Japonicus. Environmental Toxicology and Pharmacology, 40(2), 535–540.
10.1016/j.etap.2015.08.012
CAS PubMed Web of Science® Google Scholar
Wen, C. Y., Li, F. N., Duan, Y. H., Guo, Q. P., Wang, W. L., Zhang, L. Y., Li, J. Z., He, S. P., Chen, W., & Yin, Y. L. (2019). Dietary taurine regulates free amino acid profiles and taurine metabolism in piglets with diquat-induced oxidative stress. Journal of Functional Foods, 62, 103569.
10.1016/j.jff.2019.103569
CAS Web of Science® Google Scholar
Xie, Y., Song, L., Weng, Z., Liu, S., & Liu, Z. (2015). HSP90, HSP60 and sHSP families of heat shock protein genes in channel catfish and their expression after bacterial infections. Fish & Shellfish Immunology, 44(2), 642–651. https://doi.org/10.1016/j.fsi.2015.03.027
10.1016/j.fsi.2015.03.027
CAS PubMed Web of Science® Google Scholar
Yang, Y., Xie, S. Q., Lei, W., Zhu, X. M., & Yang, Y. X. (2004). Effect of replacement of fish meal by meat and bone meal and poultry byproduct meal in diets on the growth and immune response of Macrobrachium nipponense. Fish & Shellfish Immunology, 17(2), 105–114. https://doi.org/10.1016/j.fsi.2003.11.006
10.1016/j.fsi.2003.11.006
CAS PubMed Web of Science® Google Scholar
Yeganeh, V., Sharifinia, M., Mobaraki, S., Dashtiannasab, A., Aeinjamshid, K., Borazjani, J. M., & Maghsoudloo, T. (2020). Survey of survival rate and histological alterations of gills and hepatopancreas of the Litopenaeus vannamei juveniles caused by exposure of Margalefidinium/Cochlodinium polykrikoides isolated from the Persian Gulf. Harmful Algae, 97, 101856. https://doi.org/10.1016/j.hal.2020.101856
10.1016/j.hal.2020.101856
CAS PubMed Web of Science® Google Scholar
Yu, Y. Y., Chen, S. J., Chen, M., Tian, L. X., Niu, J., Liu, Y. J., & Xu, D. H. (2016). Effect of cadmium-polluted diet on growth, salinity stress, hepatotoxicity of juvenile Pacific white shrimp (Litopenaeus vannamei): Protective effect of Zn(II)–curcumin. Ecotoxicology and Environmental Safety, 125, 176–183. https://doi.org/10.1016/j.ecoenv.2015.11.043
10.1016/j.ecoenv.2015.11.043
CAS PubMed Web of Science® Google Scholar
Zhang, J. F., Wang, X. R., Guo, H. Y., Wu, J. C., & Xue, Y. Q. (2004). Effects of water-soluble fractions of diesel oil on the antioxidant defenses of the goldfish, Carassius Auratus. Ecotoxicology and Environmental Safety, 2004(58), 110–116. https://doi.org/10.1016/j.ecoenv.2003.08.025
10.1016/j.ecoenv.2003.08.025
Web of Science® Google Scholar
Zhang, M. Z., Li, M., Wang, R. X., & Qian, Y. X. (2018). Effects of acute ammonia toxicity on oxidative stress, immune response and apoptosis of juvenile yellow catfish Pelteobagrus fulvidraco and the mitigation of exogenous taurine. Fish & Shellfish Immunology, 79, 313–320. https://doi.org/10.1016/j.fsi.2018.05.036
10.1016/j.fsi.2018.05.036
CAS PubMed Web of Science® Google Scholar

Citing Literature

All articles

The alleviative effects of taurine supplementation on growth, antioxidant enzyme activities, hepatopancreas morphology and mRNA expression of heat shock proteins in freshwater prawn Macrobrachium nipponense (De Haan) exposed to dietary lead stress

Abstract

1 INTRODUCTION