Erratum

The authors of the paper entitled ‘Rapid detection of the major Mediterranean β-thalassaemia mutations by real-time polymerase chain reaction using fluorophore-labelled hybridization probes’ published in volume 119, pp. 554–557 wish to point out the presence of an error in the sequence of reverse primer (GLO R) in Table I. Instead of copying the sequence of reverse primer (GLO R) the complementary sequence of it (see below) was used so that both primers, the forward (GLO F) and reverse (GLO R), were placed on the sense strand. The incorrect sequence (ACTGAGTGAGCTGCACTGTGA) should be replaced with the correct sequence of GLO R as follows: TCA CAG TGC AGC TCA CTC AGT.