Programmed cell death protein 4 deficiency suppresses foam cell formation by activating autophagy in advanced glycation end-product low-density lipoprotein–induced macrophages

2.1 Prepared AGE-LDL

LDL and ox-LDL were obtained from Yiyuan Biotechnology (Guangzhou, China). AGE-LDL was prepared by an established method described by Sima et al4 Glycated LDL was prepared by incubation of LDL with 0.2M glucose for 4 weeks at 37°C with antioxidants (1 mg/mL ethylenediaminetetraacetic acid [EDTA] and 1 μM butylated hydroxytoluene) under sterile conditions, and was extensively dialyzed before use. The free, nonglycated amino groups were determined using the trinitrobenzene sulfonic acid assay (TNBSA). The TNBSA (0.01% [wt/vol]) is a sensitive reagent for quantification of primary free amino groups in available lysine contents of proteins. This compound reacts with protein's free amino groups to form trinitrophenolic derivatives.17 The extent of LDL protein glycation was evaluated by measuring pentosidine formation spectrofluorometrically (excitation 335 nm and emission 385 nm). The protein concentration was measured by Modified Lowry Protein Assay Kit (Thermo Fisher Scientific, Rockford).18 Agarose gel (0.6%) electrophoresis was used for detecting the mobility of native LDL, AGE-LDL, and ox-LDL. After agarose gel electrophoresis, sudan black 10B was stained with lipoprotein.

2.2 Cell culture

Mice monocyte-macrophage leukemia-derived cell line RAW 264.7 and human monocytic cell line THP-1 were purchased from the Shanghai Cell Bank of the Chinese Academy of Science (Shanghai, China). The cell lines were grown in RPMI-1640 medium (Gibco, CA) supplemented with 10% fetal bovine serum (FBS). Human THP-1 monocytes were treated with 160 nM of Phorbol 12-myristate 13-acetate (PMA) for 2 days for macrophage transformation. Mouse primary peritoneal macrophages were isolated from C57BL/6 mice. Eight-week-old mice were killed and the peritoneal cavity was washed with 5 mL of ice-cold PBS to isolate primary peritoneal macrophages. Peritoneal fluid was filtered through a 70-μm pore nylon mesh and centrifuged at 1200 rpm for 10 minutes. The pellet was first treated with red blood cell lysis buffer and resuspended in Dulbecco's modification Eagle's medium supplemented with 10% (vol/vol) FBS, 100 μg/mL streptomycin and 100 U/mL penicillin.19

2.3 Foam cell formation and analysis

Cells were stimulated with ox-LDL and AGE-LDL for 24 hours, incubated with 3-methyladenine (MA) (Sigma-Aldrich, MI) to block autophagy. Cells were then stained with Oil Red O (Sigma-Aldrich, MI), rinsed in 60% isopropanol and water. Hematoxylin was used as a counterstain. Multiple images were then taken, and the percentage of stained cells was quantified. The three random independent locations were used for one experiment repeated, three independent experiments for the final calculation and comparison.

2.4 Cell transfection

Short hairpin RNA (shRNA) were purchased from Shanghai GenePharma Co, Ltd (Shanghai, China). The sequences were here: for shRNA scramble control (named shNC): GTTCTCCGAACGTGTCACGT; for shPDCD4: CTGGACAGGTGTATGATGTGG. The vector has two promoters to expression target shRNA and fluorescent protein independently. Exponentially growing RAW 264.7 cells and THP-1 cells were stably transfected with the plasmids as described before.20 Primary peritoneal macrophages were transciently transfected with the plasmids, using Lipofectamine 3000 (Invitrogen, Carlsbad) reagent according to the manufacturer's protocols. The efficiency of transfection was observed by fluorescence microscope and Western blot analysis.

2.5 Real-time quantitative polymerase chain reaction

Total RNA was extracted from cells using TRIzol reagent (Invitrogen, Carlsbad) PDCD4 expression was measured by SYBR green qRT-PCR assay (Takara, Dalian, China). Primers for PDCD4 were forward, 5′-GATTAACTGTGCCAACCAGTCCAAAG-3′ and reverse, 5′-CATCCACCTCCTCCACATCATACAC-3′. Primers for glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were forward, 5′-AGCCTTCTCCATGGTGGTGAA-3′ and reverse, 5′-ATCACCATCTTCCAGGAGCGA-3′. Quantification real-time reverse-transcriptase polymerase chain reaction (RT-PCR) was performed on the iCycler System (Bio-Rad, Hercules, CA). The expression level of PDCD4 was normalized by the level of GAPDH. The PCR program was 95°C for 2 minutes, then 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 30 seconds for 40 cycles.

2.6 Western blots

Cells were lysed using mammalian protein extraction reagent containing protease inhibitors (Pierce, Thermo scientific, Rockford). The quantification of protein was detected by BCA assay (Pierce, Thermo scientific, Rockford). Samples (20 μg protein per lane) were loaded to 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels and subjected to electrophoresis. Proteins were transferred to polyvinylidene fluoride membranes and subsequently probed using the rabbit monoclonal antibodies against light chain 3 (LC3-II) (#3868), PDCD4, BAX, PARP(C), and caspase-3(C) (all 1:1000; Cell Signaling Technology, Danvers, MA), mouse monoclonal antibody against β-actin (sc-7210, 1:2000; Santa Cruz Biotechnology, Dallas), followed by secondary antibody conjugated (1:5000; EarthOx, San Francisco). Blots were developed with the enhanced chemiluminescence system according to the manufacturer's instructions (Pierce, Thermo scientific, Rockford).

2.7 Immunofluorescence

Cells were cultured on Glass Bottom Cell Culture Dishes (NEST Biotechnology, Wuxi, China) for detection by microscope (1.0 × 10⁵ cells per 35-mm dish), and then subjected to treatments as indicated. Cells were fixed with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100 for 15 minutes. After incubation for 2 hours with anti-LC3-II (1:300; Cell Signaling Technology, Danvers, MA), cells were washed with PBS and then incubated for 1 hour with DyLight 594-conjugated (1:500; EarthOx, San Francisco) secondary antibodies. Nuclei were stained by 4′,6-diamidino-2-phenylindole (DAPI; Beyotime, Shanghai, China) for 5 minutes. All slides were observed under a microscopy (Leica, Wetzlar, Germany).

2.8 Flow cytometry

Green fluorescent protein-LC3 (GFP-LC3) was used to monitor autophagic flux by flow cytometry. GFP-LC3 plasmid was cotransfect to the cells, after 24 hours, the cells were treatment with AGE-LDL. The cells are then washed, trypsinized, and resuspended in PBS and subjected to flow cytometric analysis. In the analysis, the GFP intensity of the treated cells is normalized to that of the control cells.21

Mitochondrial membrane potential was assessed using the fluorescent dye JC-1, which is a monomer molecule permeable to the mitochondrial membrane. JC-1 accumulates in functional mitochondria with high Δψ and forms aggregates that emit red fluorescence. But JC-1 does not accumulate in mitochondria with depolarized Δψ and remains in the cytoplasm as monomers. In mitochondria undergoing a transition from polarized to depolarized Δψ, JC-1 leaks out of the mitochondria into the cytoplasm as monomers resulting in a decrease of red fluorescence. Briefly, cells knockdown with PDCD4 and control were treated with 100 μg/mL AGE-LDL for 12 hours. Then, the cells were rinsed with PBS and stained with MitoScreen JC-1 (BD Pharmingen, Frank-lin Lakes, NJ), according to the manufacturer's instructions. Platelets were washed and resuspended into the MitoScreen buffer. Relative degrees of mitochondrial polarization were quantified by measuring the red-shifted JC-1 aggregates on FL-2 channel and the green-shifted monomers on FL-1 channel.

2.9 Statistical analysis

All data are expressed as mean ± SD and statistical significance was examined with one-way analysis of variance pairwise comparison using SPSS13.0 software (Chicago). P < 0.05 indicate statistical significance.

3.1 Characterization of AGE-LDL

In vivo, glycation of LDL is very complex involving the nonenzymatic reaction of glucose and its metabolites with the free amino groups of lysine.4, 6 The extent of LDL glycation was estimated using TNBSA, which upon coupling to free, nonglycated amino groups gives the highly chromogenic 2,4,6-trinitrophenyl (TNP) derivatives. We used TNBSA assays to detect the level of glycated epitopes. It showed that 36% reduction in free amino groups of apoB in AGE-LDL relative to n- or ox-LDL (0.28 ± 0.02 AU in AGE-LDL vs 0.45 ± 0.03 AU in n-LDL or 0.43 ± 0.05 AU in ox-LDL, respectively; P < 0.05) was consistent with irreversible protein glycation (Figure 1A). To assess the intact of LDL, we load the sample for the native PAGE gel electrophoresis dyed with coomassie brilliant blue (Figure 1B). In addition, agarose gel electrophoresis dyed by sudan black showed the electrophoresis mobility of AGE-LDL was faster than n- and ox-LDL, indicating loss of positive charges due to the glycation of Lys residues (Figure 1C). Native SDS-PAGE and agarose gel electrophoresis of LDL preparations appeared as a single band, ruling out the possibility of contamination with other proteins.

3.2 AGE-LDL induces autophagy in mice macrophage cell line RAW264.7

Autophagy is a dynamic process, involving autophagosome formation, cargo sequestration, and eventual lysosomal fusion/degradation occurring in succession. LC3-II is a well-known marker of cell autophagy. To detect autophagy, we observed whether the levels of LC3-II was regulated by AGE-LDL. The results showed that both AGE-LDL and ox-LDL increased the expression of LC3-II (Figure 2A), AGE-LDL upregulated the levels of LC3-II in the concentrations of 50 and 100 μg/mL (Figure 2B). And the increased level of LC3-II determined during 2 to 12 hours indicated that the effect was time-independent (between 2 and 12 hours) (Figure 2C). For confirmation, the result in the primary nontransformed cells, primary peritoneal macrophages from C57BL/6 mice were used. We also detected the induction of autophagy in primary peritoneal macrophages by AGE-LDL (Figure 2D). Previous study reported that 9.3 mg/dL (93 μg/mL) glycated LDL apoB in the serum of diabetes versus 4.8 mg/dL (48 μg/mL) in controls. Therefore, we choose the 100 μg/mL (in the physiological range) as the optimal dose for the subsequent experiments.

3.3 Silence of PDCD4 facilitates AGE-LDL–induced autophagy

Previous studies have shown that PDCD4 deficiency clearly improved ox-LDL-impaired autophagy efflux, promoted autophagy-mediated lipid breakdown in murine macrophages and thus prevented macrophage conversion into foam cells.15, 16 Here, we detected the efficiency of two shPDCD4 (shPDCD4-1 and shPDCD4-2) by real-time RT-PCR and Western blot analysis. ShPDCD4-1 showed higher efficiency in knocking down of both (Figure 3A), so we used the shPDCD4-1 for the experiment after. Increases in the LC3-II levels were observed in PDCD4 deficiency cells compared with the control cells in the presence of AGE-LDL (Figure 3B). To observe the PDCD4 induced autophagic activity, we used a fluorescence microscope to detect the autophagosomes in cells. The autophagosome, a special vesicle with a double membrane layer, is an important marker of autophagy activation, which ultimately fuses with the lysosome to form the autolysosome, leading to the degradation of cellular structures.22-24 While control cells displayed a diffuse staining, PDCD4 deficiency cells exhibited a speckled fluorescent staining pattern, indicating the redistribution of LC3-II to autophagosomes in the cytoplasm (condensed spot, arrow in Figure 3C). In addition, pQCXIP-GFP-LC3 was used to monitor autophagic flux by flow cytometry in RAW 264.7 cells. pQCXIP-GFP-LC3 plasmid was cotransfect to the cells, after 24 hours, the cells were treatment with AGE-LDL. Flow cytometry detected that PDCD4 deficiency aggravated AGE-LDL–induced autophagic flux (represented by mean fluorescence intensity) in RAW 264.7 cells (Figure 3D).

3.4 PDCD4 deficiency attenuates apoptosis that relies on increased autophagy

Autophagy and apoptosis are the two major pathways of cell death; the current knowledge has shown that there is a crosstalk between the components of these two pathways.25 Hence, we further investigated the roles of autophagy and apoptosis in PDCD4 deficiency cells. First, we detected the apoptosis induced by AGE-LDL in PDCD4 deficiency cells. Our results indicated that PDCD4 deficiency cells had decreased levels of BAX, cleaved poly(ADP-ribose) polymerase (PARP), and caspase-3 (Figure 4A), suggesting that the PDCD4 deficiency resulted in decreased apoptosis with the treatment of AGE-LDL. We wondered whether the mitochondria damage involved in the RAW 264.7 cells apoptosis. The mitochondria membrane potential was assessed by JC-1 staining and measured by flow cytometry. The results showed that JC-1 green fluorescence positive cells decreased, it indicated that PDCD4 deficiency attenuated cell mitochondria dysfunction (Figure 4C). Autophagy inhibitor 3-MA was utilized in the current study to examine whether autophagy plays a protective or promoting role in apoptosis. The apoptosis status of PDCD4 deficiency cells was examined again. Conversely, pharmacological treatment with 3-MA that inhibits autophagy resulted in restore of apoptosis proteins (BAX, PARP(C), and Cas3(C)), respectively (Figure 4B). To confirmation the effect of PDCD4 in the other independent system, we used human monocytic cell line-THP-1 and primary peritoneal macrophages to detect the role of PDCD4 deficiency involved in autophagy and apoptosis induced by AGE-LDL. The results showed that PDCD4 deficiency-activated autophagy is required for inhibition of apoptosis in THP-1 cells (Figure 4C and 4D) and primary peritoneal macrophages (Figure 4E and 4F). Taken together, the observation that PDCD4 deficiency inhibits apoptosis through activated autophagy in multiple cell types suggests that the effect of PDCD4 is universal. These results further suggested that the higher level of autophagy was a potential target for suppressing apoptosis.

3.5 PDCD4 deficiency suppress AGE-LDL–induced lipid accumulation

Macrophage with overloaded lipids will transform into foam cells. Next, we analyzed the role of PDCD4 in macrophage foam cell formation and established the association between autophagy and foam cell formation. As shown in Figure 5, PDCD4 deficiency caused the reduction of lipid accumulation in AGE-LDL–treated macrophages. However, PDCD4 deficiency-alleviated foam cell formation was restored by 3-MA. This result suggested that autophagy inhibitor exacerbated the antilipid accumulation effect of PDCD4 deficiency in RAW 264.7 cells.