2.1 Expression Profile Assessment of PRKCQ in Mouse Testis

PKC is a family consisting of several phospholipid-dependent serine/threonine kinases and play vital roles in a wide range of cellular functions (Newton 2001, 2018b). Based on their structural and activation characteristics, PKC family is classified into three subfamilies (Dempsey et al. 2000; Steinberg 2008): SSC, spermatogonia stem cells; conventional or classic PKC isozymes (cPKCs; PRKCA, PRKCB, and PRKCG), novel or non-classic PKC isozymes (nPKCs; PRKCD, PRKCE, PRKCH, and PRKCQ), and atypical PKC isozymes (aPKCs; PRKCZ and PRKCI). To investigate the PKC family function in spermatogenesis, we analyzed their expression patterns in various mouse tissues according to the Comprehensive Mouse Transcriptomic BodyMap (Li et al. 2017). As shown in Figure 1A, only Prkcd and Prkcq was preferentially expressed in testis and Prkcq mRNA was expressed highly in testis compared to other tissues. Moreover, PRKCQ is evolutionarily conserved from Danio rerio to Homo sapiens according to multiple sequence alignment analysis (Figure 1B).

To further explore the role of PRKCQ in spermatogenesis, we first validated that Prkcq mRNA was highly expressed in testis among the eight adult mouse tissues (Figure 2A). Kit^w/wv mice only have undifferentiated spermatogonia and normal somatic cells in testis (Ohta et al. 2003) and qPCR analysis showed that Prkcq was not expressed in Kit^w/wv mice (Figure 2B). On account of the first round of spermatogenesis is nearly synchronous, postnatal 1-, 2-, 3-, 4-, and 5- to 7-week testes can represent the different types of germ cells corresponding to spermatogonia, early spermatocytes, round spermatids, elongating spermatids and sperm, respectively. We performed qPCR analysis and the results showed that Prkcq begun to express at Week 4 and persisted until Week 7 (Figure 2C). Furthermore, spermatogonia stem cells, pachytene spermatocytes, round spermatids, elongating spermatids, Sertoli cells and interstitial cells were purified and we found that Prkcq was expressed in pachytene spermatocytes, round and elongating spermatids but not in somatic cells (Figure 2D).

2.2 Prkcq^−/− Mouse Generation

To examine the function of PRKCQ in spermatogenesis, we used CRISPR/Cas9 approach to generate Prkcq^−/− mouse with sgRNAs targeting exon 11 (Figure 3A) and obtained 86 bp deletion mutant line validated by sanger sequencing (Figure 3B). Homozygous mutant Prkcq allele were then detected by PCR genotyping (Figure 3C). There was no expression of Prkcq mRNA in Prkcq^−/− testis using qPCR analysis (Figure 3D). Western blot further confirmed the absence of PRKCQ protein in Prkcq^−/− testis (Figure 3E). Taken together, above results indicated Prkcq knockout mice were successfully generated.

2.3 Prkcq^−/− Male Mice Are Fertile and Show Normal Spermatogenesis

The Prkcq^−/− mice were viable and displayed normal behavior. To investigate whether Prkcq deletion affected male fertility, we mated Prkcq^−/− male mice with wild-type female mice and the results showed that litter sizes of Prkcq^−/− males were no significantly difference compared to Prkcq^+/+ males (Figure 4A,B). Also, no difference was observed in testis appearance and testis weight in Prkcq^−/− mice (Figure 4C). In addition, compared to Prkcq^+/+ males, the PAS-stained Prkcq^−/− testis section showed normal spermatogenic cells in seminiferous tubules and did not display any differences in spermatogenesis (Figure 4D). Using TUNEL assay, we then examined the apoptotic state of spermatogenic cells in Prkcq^−/− mice and found that the average number of TUNEL positive cells per tubule was similar to that in Prkcq^+/+ testis (Figure 4E).

To further characterize the spermatogenesis in Prkcq^−/− mice, we performed immunostaining by LIN28A (spermatogonia marker) and revealed that the numbers of LIN28A-positive spermatogonia did not differ between Prkcq^+/+ and Prkcq^−/− testis (Figure 5A,B). Next, immunofluorescent staining showed similar expression of γH2AX (spermatocyte marker) in Prkcq^−/− spermatocytes compared to the controls, suggesting that meiotic progression was not affected after deletion of Prkcq (Figure 5C). We examined the nuclear condensing using transition protein 1 (TNP1) immunofluorescent staining and found that nuclear condensation was normal in Prkcq^−/− spermatids (Figure 5D). We then immunostained testis sections for SOX9 (Sertoli cell marker) and the results showed that Prkcq^+/+ and Prkcq^−/− mice contained similar numbers of Sertoli cells in seminiferous tubules (Figure 5E,F). Altogether, these results indicated that Prkcq deficiency did not affect spermatogenesis.

2.4 Sperm Parameters Are Normal in Prkcq^−/− Mice

Hematoxylin and eosin (H&E) stained Prkcq^−/− mice caput epididymis exhibited normal histology morphology and cauda epididymis was full of mature sperm in Prkcq^−/− mice (Figure 6A). Subsequently, we detected the sperm parameters of sperm collected from cauda epididymis using computer-assisted sperm analysis (CASA). As shown in Figure 6B,C, sperm motility and progressive motility from Prkcq^−/− mice were similar with those of Prkcq^+/+ mice. Additionally, the number of sperm were also comparable between Prkcq^+/+ mice and Prkcq^−/− mice (Figure 6D). We next analyzed the histology morphology of sperm via H&E staining and found that Prkcq^−/− sperm exhibited normal morphology with sickle-shaped head and tail (Figure 6E). The percentage of abnormal sperm was also no significantly difference in Prkcq^−/− mice compared with Prkcq^+/+ mice (Figure 6F). Consistent with the H&E stained images, immunofluorescent staining suggested that the structures of nuclear, acrosome, and flagella remained normal in Prkcq^−/− sperm (Figure 6G).

2.5 No Transcriptional Compensation Observed for Other PKC Isozyme Members in Prkcq^−/− Testis

The genetic compensation response has been a possible explanation for the phenotypic absence in gene-knockout mouse. Previous studies showed that compensatory upregulation of the genes is specifically triggered by mRNA bearing a premature termination codon (PTC) and accompanied by an enhancement of H3K4me3 at the transcription start site regions of the compensatory genes (Ma et al. 2019; Rossi et al. 2015). On account of the homology between PKC family components, we further investigated the mRNA levels of other PKC isozymes to explore the effect of Prkcq deletion. The results showed that the mRNA expression levels of other PKC isozymes were not significantly increased in Prkcq^−/− testis when compared with that in the testis of controls (Figure 7), indicating that the loss of PRKCQ function was not compensated by other PKC family members.

4.1 Animals

All mice were housed under specific-pathogen-free animal (SPF) conditions in the Animal Core Facility of Nanjing Medical University. Animal care and experimental procedures were designed according to the guidelines and regulations of the Institutional Animal Care and Use Committee (IACUC) of Nanjing Medical University, and approved by the Animal Ethical and Welfare Committee (No. IACUC-1810007-2).

4.2 Generation of Prkcq Knockout Mice

CRISPR/Cas9 technology was used to generate the Prkcq knockout mice as described previously (Li et al. 2022b). Briefly, the single guide RNAs (sgRNAs) were designed and synthesized to target exon 11 of Prkcq gene. Cas9 mRNA and sgRNAs were then transcribed in vitro and then coinjected into fertilized eggs to obtain the founders. The F0 mice underwent serial mating to generate homozygous mutants following genotyping.

4.3 Genotyping

Tail DNA was extracted using One Step Mouse Genotyping Kit (Vazyme). The genotypes of the offspring were confirmed by PCR amplification (Forward primer, 5′- CCTGGAACTTGCTCTGTAGACTG -3′; Reverse primer, 5′- TGTTGGATGCTCTGTCATCTCAC -3′). Sanger sequencing was additionally conducted and analyzed by SnapGene.

4.4 Testicular Cells Isolation

Interstitial cells and Sertoli cells were collected as described previously (Li et al. 2022b). In brief, followed by 1 mg/mL collagenase IV and 25% trypsin with DNase I at 37°C, the testes were digested into single-cell suspensions and interstitial cells were collected from the supernatant. For the collection of Sertoli cells, single-cell suspensions of adult testes were cultured in cell culture dishes for 24–48 h with changing the medium every 12 h. Sertoli cells adhering to the bottom of the dish were collected for subsequent experiments.

The STA-PUT method (Bryant et al. 2013) was used to isolate pachytene spermatocytes, round spermatids, and elongated spermatids from adult mouse testes, and spermatogonia from postnatal Day 8 mouse testes. Briefly, the single-cell mouse testes suspensions digested by two-step process were subjected to a cell separation device (ProScience Inc. Canada) and separated by a 2%–4% bovine serum albumin (BSA) gradient. After 2.5 h sedimentation, spermatogenic cells were collected for later analysis.

4.5 qPCR

Total RNA was extracted by RNAiso Plus (Takara) and determined the concentration and purity by absorbance at 260/280 nm using a NanoDrop 2000 (Thermo Fisher Scientific). RNA was then reverse-transcribed into cDNA by PrimeScriptRT Master Mix (Takara). The cDNA was subsequently diluted and used for quantitative RT-PCR (qPCR) with SYBR Green Fast qPCR Mix (Abclonal). Primers were provided in Table S1. The QuantStudio 7 (Applied Biosystems) system was used to conduct gene expression levels and analyzed by the comparative ΔΔCt (cycle threshold) method according to the manufacturer's instruction.

4.6 Western blot

Testis tissues were separated from adult Prkcq^+/+ and Prkcq^−/− mice and lysed in ice RIPA buffer (Beyotime) containing protease inhibitor cocktail. Lysates were incubated on ice for 30 min and centrifuged at 12,000 g for 20 min at 4°C. The concentration of proteins was determined using the bicinchoninic acid (BCA) protein assay (Beyotime) according to the manufacturer's instructions. Extracted proteins were subsequently loaded and separated via SDS-PAGE gels and transferred to PVDF membranes. After being blocked with 5% non-fat milk at room temperature for 2 h, the membranes were incubated with primary antibodies and corresponding secondary antibodies. Following by three washes with TBS-Tween-20 (TBST), high-sig ECL western blot analysis substrate (Tanon) was used to detect protein bands. The primary antibodies were used as follows: anti-PRKCQ (13643S, Cell Signaling Technology), anti-GAPDH (AB0038, abways).

4.7 Histology Analysis

Tissues were fixed in modified Davidson's fluid (MDF) for 48 h and dehydrated with a graded ethanol series (70%–100%). After being cleared in xylene and embedded in paraffin, sections were then cut at a 5-μm thick and mounted onto glass slides. These sections were subjected to Periodic Acid-Schiff's (PAS) or H&E reagent for further histological examination routinely.

4.8 Immunofluorescence and TUNEL Assay

For immunofluorescence, paraffin sections were rehydrated and boiled in heat-induced citrate buffer (1.8 mM citric acid, 8.2 mM sodium citrate, pH 6.0) to facilitate antigen retrieval. Samples were then washed with PBS-Triton-X-100 (PBST) and blocked with 5% BSA at room temperature for 2 h. Sections were incubated with primary antibodies and corresponding fluorescence-conjugated secondary antibodies and analyzed using a fluorescence microscope (ZEISS LSM800, Germany). The primary antibodies were used as follows: anti-LIN28A (ab46020, Abcam), anti-γH2AX (ab26350, Abcam), anti-TNP1 (17178-1-AP, Proteintech), anti-SOX9 (A19710, Abclonal), anti-AC-TUBULIN (T6793, Sigma). For TUNEL assay, paraffin sections were performed using TUNEL BrightGreen Apoptosis Detection Kit (Vazyme) according to the manufacturer's instruction.

4.9 Sperm Parameters Analysis

Sperm were released from the cauda epididymis and incubated in fresh human tubal fluid (HTF) media (Irvine Scientific) supplemented with 10% FBS at 37°C for 10 min. A 10 µL sperm suspension was then analyzed for sperm motility test via CASA detection (Hamilton Thorne Inc). Diluted sperm were counted using a hemocytometer for sperm count test.

4.10 Statistical Analysis

Two-tailed unpaired Student's t-test was used to determine the statistical significance and p < 0.05 was considered statistically significant.